ID: 1090395646

View in Genome Browser
Species Human (GRCh38)
Location 11:126416394-126416416
Sequence CAGAAAAAGGCGACAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 366}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090395646_1090395652 14 Left 1090395646 11:126416394-126416416 CCAGCCTCTGTCGCCTTTTTCTG 0: 1
1: 0
2: 0
3: 24
4: 366
Right 1090395652 11:126416431-126416453 AGTCATTTCTCTGCAACAAAAGG 0: 1
1: 0
2: 2
3: 16
4: 246
1090395646_1090395653 15 Left 1090395646 11:126416394-126416416 CCAGCCTCTGTCGCCTTTTTCTG 0: 1
1: 0
2: 0
3: 24
4: 366
Right 1090395653 11:126416432-126416454 GTCATTTCTCTGCAACAAAAGGG 0: 1
1: 0
2: 1
3: 20
4: 255
1090395646_1090395655 19 Left 1090395646 11:126416394-126416416 CCAGCCTCTGTCGCCTTTTTCTG 0: 1
1: 0
2: 0
3: 24
4: 366
Right 1090395655 11:126416436-126416458 TTTCTCTGCAACAAAAGGGTGGG 0: 1
1: 0
2: 4
3: 22
4: 199
1090395646_1090395654 18 Left 1090395646 11:126416394-126416416 CCAGCCTCTGTCGCCTTTTTCTG 0: 1
1: 0
2: 0
3: 24
4: 366
Right 1090395654 11:126416435-126416457 ATTTCTCTGCAACAAAAGGGTGG 0: 1
1: 1
2: 0
3: 21
4: 207
1090395646_1090395656 30 Left 1090395646 11:126416394-126416416 CCAGCCTCTGTCGCCTTTTTCTG 0: 1
1: 0
2: 0
3: 24
4: 366
Right 1090395656 11:126416447-126416469 CAAAAGGGTGGGTCCAGCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090395646 Original CRISPR CAGAAAAAGGCGACAGAGGC TGG (reversed) Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
901315334 1:8303566-8303588 CAGAAATAAGCCTCAGAGGCTGG + Intergenic
901631521 1:10650460-10650482 GAAAAAAAGGTGTCAGAGGCTGG + Intronic
901839524 1:11945121-11945143 TAGAGAAAGGAGACACAGGCCGG + Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902948684 1:19863552-19863574 CGAAAAAAGGTGCCAGAGGCCGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904234795 1:29108442-29108464 CAGAAATAGGAGGCAGGGGCCGG - Intronic
905791764 1:40793327-40793349 GAGAGAAAAGCCACAGAGGCAGG - Intronic
907425926 1:54379282-54379304 CAGAAAAAGGCCACACAGGTAGG - Intronic
907469817 1:54665992-54666014 CAGAAAAAGGCCAGTGTGGCAGG - Intronic
907738034 1:57134785-57134807 CAGTAAGGGGTGACAGAGGCAGG - Intronic
909164396 1:72200013-72200035 CATCAAAAAGTGACAGAGGCAGG + Intronic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
909415536 1:75401958-75401980 CAGAGAAAGGCAACAGAGAAAGG + Intronic
910162056 1:84283729-84283751 CAGCACAAGGAGACAGAAGCTGG - Intergenic
911708887 1:101046195-101046217 CTGAAAATGGCCACAGATGCTGG + Intergenic
912449297 1:109759523-109759545 AAGAGACAGGGGACAGAGGCTGG - Intronic
913233117 1:116758367-116758389 CAGAAAATGTCGCCAGAAGCAGG + Intronic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915354690 1:155249010-155249032 CTGAGAAAGGAGACAGTGGCCGG - Intronic
915919216 1:159961734-159961756 CAGAAGAAGCCCACACAGGCAGG + Intergenic
917918432 1:179728048-179728070 CAGAAAAAGGAGACAGTAGCTGG + Intergenic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
921337752 1:214105490-214105512 CAGGAAGAGGCTACAGAGACAGG + Intergenic
921986535 1:221318580-221318602 CATAAAAAGGCCAAAGAGGCTGG - Intergenic
922606233 1:226891549-226891571 CAGAACGATGCAACAGAGGCTGG - Intronic
923549725 1:234953958-234953980 CAGAAAAAGGAGGCCGAGGCAGG - Intergenic
923928667 1:238666631-238666653 CAGAAAGAGGGGACAGAGAAAGG - Intergenic
924264079 1:242263132-242263154 CAGAAAAAGGCCAGGCAGGCTGG - Intronic
924648099 1:245898413-245898435 CAGAAAAAGGGAACAAAAGCAGG + Intronic
1063446008 10:6117816-6117838 CAGAAAAAGGCGTTTCAGGCTGG - Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063977227 10:11427163-11427185 AAAAAAAAGACCACAGAGGCTGG - Intergenic
1064711769 10:18134876-18134898 TAGCTAAAGGTGACAGAGGCGGG - Intergenic
1066720719 10:38335332-38335354 CAGAAAAAGGCCAGGCAGGCTGG + Intergenic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070687027 10:78492654-78492676 CAGAAAGAGGAGGCAGAGACTGG + Intergenic
1072264119 10:93711160-93711182 CAGGAAAAGGCTTCAGAGACAGG + Intergenic
1073296540 10:102442943-102442965 CAGAAATAGGGGACAGACACTGG + Intergenic
1073445023 10:103575417-103575439 CAGACAAAGGGGGCAGGGGCAGG - Intronic
1074180917 10:111062078-111062100 CACAAAAAGGAGAAAGAGACAGG + Intergenic
1074357683 10:112800389-112800411 CAGAACAAGGCACCTGAGGCAGG + Intronic
1074498905 10:114004618-114004640 CAGAAAAAGGACACAAAGGGAGG - Intergenic
1074758539 10:116646694-116646716 CAAAAAAAGACCACACAGGCTGG - Intergenic
1075585711 10:123656653-123656675 CAGTAAAAGGAAACAGAGACAGG - Intergenic
1076735591 10:132457613-132457635 CATGAAAAGGAGCCAGAGGCTGG - Intergenic
1077295325 11:1823743-1823765 CCTAAAAAGGTGGCAGAGGCTGG + Intergenic
1077316724 11:1922626-1922648 CAGGAAGAGGGGACAGAGTCTGG + Intronic
1077837661 11:5938452-5938474 GGGAAAAAGGAGAGAGAGGCGGG + Intronic
1082081958 11:48019145-48019167 CAGGAAAAGGGCACAGAGACCGG - Intronic
1084451213 11:69239849-69239871 CAGAAACAGGGTTCAGAGGCAGG + Intergenic
1084506157 11:69569797-69569819 AAGAAGAAGGGGACAGAGACAGG - Intergenic
1085341544 11:75734691-75734713 CAGATAAAGGCAGCAGAGGATGG + Intergenic
1086965529 11:93024080-93024102 CAGGAAAAGGGGACAGAGCAGGG + Intergenic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1089285340 11:117404131-117404153 CAGAAATAGGCTTCAGAGGGTGG - Intronic
1089629284 11:119774089-119774111 CAGAGGAAGCCAACAGAGGCAGG - Intergenic
1090342255 11:126034421-126034443 CAGAAAAAGGCAACAGTGAGGGG + Intronic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1093156386 12:15691239-15691261 CCAAAAAAGGCAAGAGAGGCTGG + Intronic
1093981163 12:25477304-25477326 GGGAAAAAGGCGACAGAGAGAGG + Intronic
1094544173 12:31388974-31388996 CAGAAAAATGAGACAGAGCCAGG - Intronic
1095173712 12:39065315-39065337 AAGAAAAAGGGGAGAAAGGCTGG - Intergenic
1095245093 12:39910611-39910633 CAGAAAAAGTGGACAGCTGCAGG + Intronic
1096191876 12:49624551-49624573 CAGAAAGAAGCAACAGGGGCCGG + Intronic
1096195154 12:49644908-49644930 CAGAAAGAGGAGACAAAGTCAGG + Exonic
1096729697 12:53598509-53598531 CAGAAACAGGAGACAGAAGTAGG + Intronic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1098277083 12:68823625-68823647 AAGAAAAAGAGGGCAGAGGCAGG - Intronic
1099695631 12:86015103-86015125 CAGAAGTAGGACACAGAGGCCGG - Intronic
1101033644 12:100684355-100684377 AAGGCAAAGACGACAGAGGCTGG - Intergenic
1102202562 12:111067767-111067789 GAGAACAAGGGGACAGAGGGAGG + Intronic
1102962299 12:117100495-117100517 CAGCACATGGCCACAGAGGCTGG + Intergenic
1103087731 12:118074378-118074400 CAGATAAAGGGGACTGGGGCCGG - Intronic
1105026071 12:132849882-132849904 TAGAAAAAGGCCACCTAGGCTGG - Intronic
1105657054 13:22453117-22453139 CAGAAAAAGGAGGCTGAGCCTGG + Intergenic
1105809858 13:23985480-23985502 CTGAAAAATGGGACAGAGCCTGG - Intronic
1107749142 13:43545585-43545607 CAGAAAACAGGGAGAGAGGCAGG - Intronic
1107992774 13:45833031-45833053 CAGAAAACAGAGACAGAGGTGGG + Intronic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108861513 13:54865992-54866014 CAGAAAAAGGGGCCAGAAGAGGG - Intergenic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1110829330 13:80012434-80012456 CAGAAAAGCGTGACAGAGGTGGG - Intergenic
1113549277 13:111179378-111179400 CAGAAACAGGCGTTTGAGGCCGG - Intronic
1114279203 14:21175484-21175506 CAGCAAAAACTGACAGAGGCTGG + Intergenic
1114339488 14:21728088-21728110 CAGAAACAGGCCACACAGCCAGG - Intergenic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1114671839 14:24415634-24415656 CAGAGAAAGGCGGCAGAACCTGG - Exonic
1114904021 14:27102079-27102101 CAGAAAAAGGCCACAGAATTTGG + Intergenic
1115618476 14:35118994-35119016 CAGAGAAATGCAACAGAAGCTGG + Intronic
1115998006 14:39213633-39213655 CAGAAAAAAGACATAGAGGCTGG + Intergenic
1116342390 14:43740502-43740524 CAGAAAAAAGCAAAAGAGCCTGG + Intergenic
1119037246 14:71240961-71240983 CAGAAATACCCAACAGAGGCAGG - Intergenic
1119425703 14:74533537-74533559 AAGGAAAAGGAGGCAGAGGCTGG + Intronic
1119857778 14:77913701-77913723 AAGAAAGAGGTGACAGAGACAGG + Intronic
1120042225 14:79767168-79767190 AAGAATAAGACTACAGAGGCAGG - Intronic
1120182150 14:81354720-81354742 GTGAAAAATGCAACAGAGGCTGG + Intronic
1121498327 14:94413278-94413300 CAGAAAAAGGTGACTGGGGTGGG - Intergenic
1122539266 14:102488138-102488160 CATAAAAATGCAAAAGAGGCTGG - Intronic
1125790225 15:42359887-42359909 CAGAGCAAGGCCACTGAGGCTGG + Exonic
1127456842 15:59162787-59162809 CAGATAAAAGTGACAGAGGTGGG - Intronic
1128419481 15:67478086-67478108 CAGAAAAGGCAGACAGAGGCTGG + Intronic
1128656945 15:69469536-69469558 CAGCAAAAGGGGTCAGAGACTGG + Intergenic
1129518648 15:76171937-76171959 CAGAGGATGACGACAGAGGCAGG + Intronic
1129876984 15:78982048-78982070 CAGGGATAGGTGACAGAGGCTGG - Intronic
1130361135 15:83187590-83187612 TAGAAAAAGGCTGCAGTGGCCGG + Intronic
1131171604 15:90182980-90183002 TAGAAAAATGCGATATAGGCCGG + Intronic
1131414615 15:92243332-92243354 CAGACAAGGGCGTCAGAGGCTGG - Intergenic
1131424628 15:92335422-92335444 CAGAAAAAGAAGAGAGAGGGAGG - Intergenic
1131795140 15:96008531-96008553 CAAGAAAAGGGGACACAGGCTGG + Intergenic
1132582595 16:692086-692108 TCGAAAAAGGCAACTGAGGCTGG - Intronic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1132857829 16:2054932-2054954 CAGAAAAGGGCCTCAGTGGCTGG + Intronic
1133065510 16:3203919-3203941 CAGACAGACGGGACAGAGGCTGG - Intergenic
1133817656 16:9210468-9210490 AAGAAGAAGGAGCCAGAGGCTGG - Intergenic
1135213724 16:20546253-20546275 CAGAAAAAAGGGACGGAGGGAGG - Intronic
1138245459 16:55463761-55463783 CAGAAGAAGGCCACTGTGGCTGG - Intronic
1138447645 16:57074596-57074618 CAGCAGAAGGTGACTGAGGCTGG - Exonic
1139429738 16:66904726-66904748 GAGAGAAAGGCGCCAGAGCCGGG - Intergenic
1139518010 16:67463232-67463254 CATAAAAACTGGACAGAGGCTGG + Intronic
1139912936 16:70409335-70409357 AAAAAAAAGCCGCCAGAGGCGGG - Intronic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141095899 16:81162967-81162989 TTGAAAAAGAAGACAGAGGCTGG + Intergenic
1141373327 16:83507125-83507147 CAGAAAAAGTCCACAGAGGAGGG - Intronic
1141643259 16:85353979-85354001 CTGCACAAGGCGCCAGAGGCAGG - Intergenic
1141675548 16:85515517-85515539 CAGAAAGAAGGGCCAGAGGCTGG + Intergenic
1142512841 17:408595-408617 CTGAAAATGGCTGCAGAGGCTGG - Intergenic
1142799977 17:2338541-2338563 CAGACAACAGCCACAGAGGCAGG - Intronic
1143077170 17:4354229-4354251 CAGAAAAAGTCAAGAGAAGCTGG - Intronic
1143353395 17:6306450-6306472 CAGAACAAGGCAAGAGAGGTGGG - Intergenic
1143706942 17:8705205-8705227 CAGAAAAAGGCCTGAGGGGCTGG - Intergenic
1143857920 17:9866133-9866155 CAGAAAGAAGTGAAAGAGGCAGG + Intronic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1144937210 17:18909538-18909560 TATAAAAAGGCCACATAGGCCGG - Intronic
1145921630 17:28614164-28614186 CAGAGAGAGGAGGCAGAGGCTGG - Exonic
1145982610 17:29022374-29022396 CAGAGACAGGTGACAGAAGCTGG + Intronic
1146158824 17:30548075-30548097 CAGAAAACTGCCACAGGGGCAGG - Intergenic
1146521501 17:33528946-33528968 GAGGAAAAGAGGACAGAGGCAGG + Intronic
1147428032 17:40355581-40355603 CACACAAAGGTGACACAGGCGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149770383 17:59316264-59316286 CAAAAACAGGCCACAGAGGCCGG + Intergenic
1150455871 17:65306049-65306071 CAGAAACAGGCCACAGAGGTTGG + Intergenic
1151830727 17:76548501-76548523 CAGAACTAGGCCACCGAGGCTGG - Intronic
1152033871 17:77859814-77859836 CAGAACACGGCGTCAGATGCTGG - Intergenic
1153476865 18:5506517-5506539 CAGGAAACGGGGACAGAGCCAGG - Intronic
1155280673 18:24236371-24236393 GAGGAAATGGGGACAGAGGCTGG + Intronic
1157347130 18:46849148-46849170 TAGAAAAGGGCAACAGAAGCAGG + Intronic
1158082320 18:53607205-53607227 CAGAAAGATGGGACAGAGTCAGG - Intergenic
1160290954 18:77592860-77592882 CACAAAAAGGAGACTGAAGCTGG + Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160597585 18:79988048-79988070 CAGAAAAAGGCGTGAAACGCCGG + Intronic
1161950106 19:7463196-7463218 CAGAATAAGACGGCAGAGACGGG + Intronic
1163577958 19:18121742-18121764 CCGACAATGGCGACAGGGGCCGG - Exonic
1163719925 19:18894135-18894157 CAGAAAAAGGGGACAGGAGGCGG + Intronic
1164908499 19:31986661-31986683 CAGAAACAGTGGACAGAGGTGGG + Intergenic
1165268254 19:34679524-34679546 CAGCAACTGGTGACAGAGGCTGG - Intronic
1165884588 19:39068844-39068866 CAAAAAAAAGAAACAGAGGCTGG - Intergenic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166103100 19:40582906-40582928 CAGAAAGAGGTGACAGAGAAGGG + Intronic
1166668240 19:44694405-44694427 CTGAAGGAGGCGACAGAGGAGGG - Intergenic
1166937822 19:46345570-46345592 CATAAGAAGGTGACAGAGCCAGG - Intergenic
1167345146 19:48940842-48940864 CACAAAAAGGAGACAGGGTCTGG - Intronic
1167873689 19:52394133-52394155 AAGAAAAAGGTCAAAGAGGCCGG - Intergenic
1168046600 19:53798545-53798567 AAGAAAAAGACGACAGAAGTAGG + Intronic
1168440567 19:56362525-56362547 CACAAAAAGGCAACAGAGTGAGG + Intronic
925333581 2:3077065-3077087 CAGCCAAAGGAGACAGATGCAGG + Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926828963 2:16939181-16939203 CAGAATAAGGTCACAGTGGCAGG + Intergenic
927135311 2:20092504-20092526 CGGGCAAAGGCGGCAGAGGCTGG - Intergenic
927537044 2:23871532-23871554 AAGAAAAAGGAGACAGAGTCAGG - Intronic
927622107 2:24672227-24672249 CTGAAAAAAGGGACAGAGGAGGG + Intronic
927850555 2:26496016-26496038 CTGAAAAAGGCGGCTCAGGCAGG - Intronic
928593174 2:32837865-32837887 CAGGAAAAGGCAGCAGGGGCAGG + Intergenic
929375945 2:41287291-41287313 TAGAAAACGGAAACAGAGGCAGG - Intergenic
929928418 2:46233566-46233588 CTGAAAAAGGCCCCAAAGGCAGG + Intergenic
930082313 2:47461885-47461907 AAGAAAAGAGAGACAGAGGCTGG - Intronic
930621957 2:53652917-53652939 CAGAAATAAGCCTCAGAGGCTGG - Intronic
931150069 2:59563118-59563140 AAGAAAAAGGTGAAAGAGGTAGG + Intergenic
931171994 2:59813444-59813466 AAAAAAAAGAAGACAGAGGCTGG + Intergenic
931510275 2:62983836-62983858 CATAAAAAGGAGGCAAAGGCCGG - Intronic
932668610 2:73718110-73718132 CAGGAAAAGGGAACAGAGGGAGG - Intergenic
933687025 2:85149818-85149840 CAGAAAAAAGTTACAGAGCCGGG - Intronic
934019876 2:87937189-87937211 CAGAAAAAGCCGGTAGAGTCAGG + Intergenic
936629504 2:114186519-114186541 CAGGAAAAGGAGAGAGAAGCAGG - Intergenic
937690810 2:124752876-124752898 CAGCAAGAGGCGTCAAAGGCTGG + Intronic
938081593 2:128373187-128373209 CAGCCAAAGGGGACAGCGGCAGG - Intergenic
939480855 2:142745330-142745352 CAGGATAATGTGACAGAGGCTGG - Intergenic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
941009341 2:160281615-160281637 GAGAAAAAGGCGAAACAGACTGG + Intronic
941944991 2:171086327-171086349 TAGAAGAAGGGAACAGAGGCTGG + Intronic
943816262 2:192260022-192260044 CAAATAAAGGTGACAGAAGCAGG - Intergenic
947567080 2:231201118-231201140 CAGAAAAAGGCTGGAGAGGTGGG + Intronic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948095211 2:235327972-235327994 CAGAAAAAGGTCTTAGAGGCCGG + Intergenic
948147256 2:235716944-235716966 GAGAAAAAGGGGACAGTGCCAGG - Intronic
1169188601 20:3642161-3642183 CACAAGAAGGGGACAAAGGCAGG - Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169265746 20:4166511-4166533 CAGAAAGAAGCCAGAGAGGCTGG - Intronic
1171281677 20:23905104-23905126 CAGAAAAAGGCGACACGTCCAGG - Intergenic
1172265260 20:33606589-33606611 CACCAAGTGGCGACAGAGGCAGG - Intronic
1172726279 20:37044633-37044655 CAGAATAAGGCCACAGTGGCCGG - Intronic
1172760379 20:37317261-37317283 CAGCAAAAGACAACACAGGCAGG - Intergenic
1172761607 20:37327354-37327376 CAGAAGAAGGCCAAAGAAGCTGG - Intergenic
1172837091 20:37880125-37880147 CAGAAAAAGGCTTCTGTGGCAGG - Intergenic
1173003645 20:39123486-39123508 CAGACAAGGGCCACAGAGGAGGG - Intergenic
1173051610 20:39567736-39567758 CAGAAAAAAGAGAGAGAGGGGGG - Intergenic
1173607577 20:44342653-44342675 TAGAAAAAGCCCTCAGAGGCCGG + Intronic
1173998405 20:47357232-47357254 CAGAAAAAGGGGCTTGAGGCAGG + Intergenic
1174129161 20:48329568-48329590 GGGAAAAAGTAGACAGAGGCTGG - Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174551904 20:51368240-51368262 GAGAAGATGGAGACAGAGGCTGG - Intergenic
1174612817 20:51813086-51813108 CAGAAAAAGGCCAGTGGGGCTGG + Intergenic
1175190584 20:57210000-57210022 CAGAGAAAGGCAGCAGAGCCAGG + Intronic
1176717536 21:10365800-10365822 CAGAAAAAGGCCAGTGGGGCTGG + Intergenic
1177957276 21:27614439-27614461 CATAAAAAACCGACAGATGCTGG - Intergenic
1178464413 21:32833627-32833649 CAGAAAAGGACCAAAGAGGCAGG + Intergenic
1179219014 21:39390080-39390102 CCGAAAAAGGCAGCAGAGGCTGG + Intronic
1180183865 21:46129988-46130010 CGGAAACAGGCCCCAGAGGCTGG + Intronic
1180232959 21:46438466-46438488 CAGACAGAGGCAACAGAGCCTGG - Intronic
1180298763 22:11018720-11018742 CAGAAAAAGGCCAGTGGGGCTGG + Intergenic
1181878331 22:25957441-25957463 CAGAAATTGGAGACAGATGCAGG - Intronic
1181886013 22:26023003-26023025 AACAAAAAGGCGAGATAGGCTGG - Intronic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182876600 22:33697128-33697150 CAGAAAACGGCAGCAGAAGCAGG - Intronic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183501818 22:38184620-38184642 CAGAAAAGGCCAAGAGAGGCTGG + Intronic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184571421 22:45327431-45327453 CAGCAAGAGGCCACGGAGGCAGG - Intronic
1184892181 22:47386923-47386945 AAGAAAAACGGGACAGAGCCAGG + Intergenic
1185006033 22:48277460-48277482 CAGAAGAAGGTGGGAGAGGCTGG + Intergenic
1185074388 22:48675503-48675525 CAGCAAAAGGGGAAATAGGCTGG + Intronic
950721848 3:14888790-14888812 CAGAACAAAGACACAGAGGCTGG + Intronic
950771386 3:15314368-15314390 AAGAAAAACCAGACAGAGGCGGG - Intronic
950774811 3:15340469-15340491 CATAAAAAAGCAACATAGGCCGG + Intronic
951823018 3:26834883-26834905 AAAATAAAGGGGACAGAGGCTGG + Intergenic
953429709 3:42829142-42829164 GAGTAAAAGGCCACAGAGGTTGG + Intronic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
954198330 3:49009176-49009198 CAGGAAGAGGCTAGAGAGGCCGG - Intronic
955220056 3:57015963-57015985 CAGACAGAGACCACAGAGGCAGG + Intronic
955875922 3:63490295-63490317 CTGAAAAAGGAGGCAGAGGCTGG + Intronic
955972636 3:64450987-64451009 CAGAAAAATGATACAAAGGCTGG - Intergenic
956037768 3:65113811-65113833 GAGAAAAAGAAGACAGAGGAAGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960723714 3:120649437-120649459 TAGAAAAAGACAACGGAGGCCGG - Intronic
961385543 3:126521513-126521535 CAGAAAATGGCCACACAGCCAGG + Intergenic
963130644 3:141854753-141854775 CATAGAAAGGCAGCAGAGGCTGG + Intergenic
963562356 3:146881839-146881861 CAGAAACAGTTGAAAGAGGCTGG + Intergenic
964231533 3:154475937-154475959 CAGAATATGGGCACAGAGGCAGG + Intergenic
964533547 3:157694549-157694571 TAGAAAAAGACTACTGAGGCCGG - Intergenic
964721887 3:159775522-159775544 GAGAGAAAGGCGAAACAGGCAGG - Intronic
965327813 3:167329520-167329542 CAGAAAAAGGTGCAAGAAGCAGG + Intronic
967277104 3:187786816-187786838 AAGAAAGAGCAGACAGAGGCAGG - Intergenic
967729745 3:192896354-192896376 CAAAAAAAGGCGAAGGACGCTGG - Intronic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968410256 4:384339-384361 CTGAGAAAGGAGGCAGAGGCTGG + Intronic
968790197 4:2655024-2655046 CAAAAAAAGGGGACAAATGCTGG - Intronic
969404526 4:6981009-6981031 AAAAAAAAAGAGACAGAGGCCGG - Intronic
971026844 4:22597510-22597532 CAGAACAAGGTGTCAGAGTCAGG - Intergenic
971801677 4:31300952-31300974 GAGACAAAGAAGACAGAGGCAGG - Intergenic
973075789 4:45924200-45924222 GAGCAAAAGGAGCCAGAGGCAGG - Intergenic
973954486 4:56049330-56049352 CAGACAATGGGGACAGGGGCGGG + Intergenic
975838835 4:78453250-78453272 AAGAAAAAGGAGGCAGTGGCAGG + Intronic
976697038 4:87927748-87927770 AAGAAAAAAGAGACAGAGGGAGG - Intergenic
976803857 4:89023656-89023678 CAGATAAATGGGACAGAGACAGG - Intronic
979078751 4:116307671-116307693 CAGGAAAAGGAGGCAGAGCCTGG + Intergenic
979277969 4:118835020-118835042 CTGAAAAAGAGGAGAGAGGCAGG + Intronic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
981128963 4:141136822-141136844 AAGAAAAAGGCAACAGAGTATGG + Intronic
981661461 4:147171943-147171965 CAGAGAAAGGGGACAGTGGAAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985571077 5:645517-645539 CAGAGAAAGCCCACAGAGCCGGG - Intronic
986101173 5:4613043-4613065 CAGACAGAGGTGACAGAGCCTGG + Intergenic
986285259 5:6354331-6354353 CAGAAGAAGGAAGCAGAGGCTGG + Intergenic
986285317 5:6354572-6354594 CGGAAGAAGGAGGCAGAGGCTGG + Intergenic
987012653 5:13782969-13782991 CTGGAACAGGGGACAGAGGCTGG + Intronic
988314767 5:29610462-29610484 TAGAAAAAGGAGTCAAAGGCCGG + Intergenic
989433352 5:41381486-41381508 GAGAAAAAGGAGACAGAGACTGG + Intronic
992576287 5:78117028-78117050 CAGCAAGAGGTGAGAGAGGCAGG - Intronic
993027320 5:82661709-82661731 CTGGAAAAGTCAACAGAGGCAGG + Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
994598718 5:101873700-101873722 CATAAAAAGGTGAGAGAGGATGG + Intergenic
995049281 5:107684086-107684108 CAGCAAGAGGCCACAGTGGCTGG + Intergenic
996070869 5:119129990-119130012 CATATAAAGGCTACAGAGTCAGG - Intronic
996149572 5:120019000-120019022 CATTAAAATGCCACAGAGGCAGG - Intergenic
996422704 5:123279562-123279584 CAGAAGAAGGGGACAGAGAATGG - Intergenic
996576612 5:124983079-124983101 CAGAAAAAGGCGTAACAGGCTGG - Intergenic
996913534 5:128682701-128682723 GAGAAAGAGGCTTCAGAGGCAGG - Intronic
997368700 5:133342238-133342260 CAGAGAGAGGCGGCAGAGGTAGG + Intronic
997710702 5:136001635-136001657 CAGAGAAAAGCCACAGAGGAAGG - Intergenic
998142637 5:139708989-139709011 CAGAAAAAGGAAGCTGAGGCTGG - Intergenic
1000202875 5:159028890-159028912 CAGAAGAAGGCCAGTGAGGCTGG + Intronic
1001084169 5:168688299-168688321 CAGAAGGAGGTGACAAAGGCAGG + Intronic
1001460315 5:171906561-171906583 AAGAAAAAGCCCAGAGAGGCAGG - Intronic
1002846961 6:955533-955555 CAGAGAAAGCCGACTGAAGCAGG + Intergenic
1003286597 6:4739655-4739677 CATAAAAAGGTGATTGAGGCCGG + Intronic
1003844602 6:10160058-10160080 CAGAACATAGCAACAGAGGCTGG + Intronic
1003992291 6:11498237-11498259 CACAAAAAGGCTAGAGATGCAGG - Intergenic
1004310489 6:14540805-14540827 CAAAAATAGCCCACAGAGGCTGG - Intergenic
1005332117 6:24760704-24760726 CAGAAAAAGGCTGAAGAGGTGGG - Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006822094 6:36904933-36904955 AACAAAAAGGTGACAGAGGTGGG + Intronic
1006999709 6:38298686-38298708 AAGAAATAGGCATCAGAGGCTGG - Intronic
1007795167 6:44341336-44341358 CAGAAAAAGGGTAGAGAGGAAGG + Intronic
1008995068 6:57649640-57649662 GAGAAAAGGTTGACAGAGGCTGG + Intergenic
1009183601 6:60548399-60548421 GAGAAAAGGTTGACAGAGGCTGG + Intergenic
1010710049 6:79162974-79162996 AAGAGAAGGGAGACAGAGGCAGG - Intergenic
1010807110 6:80250347-80250369 CAGAAGATTGAGACAGAGGCTGG - Intronic
1010994954 6:82522848-82522870 CAGAAAAAGAGGACACATGCTGG + Intergenic
1011247972 6:85340085-85340107 CAGAAGCAGGTGACTGAGGCTGG - Intergenic
1011754874 6:90488186-90488208 GAGAAAAAGGCCACAGAAGGCGG - Intergenic
1013556966 6:111266248-111266270 CAGAAAAAGGAGACAAAGAAGGG - Exonic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1015562305 6:134529652-134529674 CACAAAAAGGAGACAGAGAAAGG + Intergenic
1015812490 6:137174925-137174947 CAGAGAACAGTGACAGAGGCAGG - Intergenic
1016609661 6:145974217-145974239 TAGAAAAAGCATACAGAGGCCGG + Intergenic
1016694114 6:146973317-146973339 CAGAGAAAGGCATCAGAGGGTGG - Intergenic
1017270429 6:152497045-152497067 CAGCAAAGGGAGACAGAGGTGGG - Intronic
1017838880 6:158205223-158205245 TAGAAAAAGGTGGCAGAAGCCGG + Intergenic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1019793598 7:3033491-3033513 CAGAGAAATGCGGCAAAGGCTGG + Intronic
1023021211 7:36013288-36013310 CATAAAAAGTCAACAGTGGCCGG - Intergenic
1023401304 7:39794179-39794201 CCGAAAGAGGCCACTGAGGCAGG - Intergenic
1023637820 7:42230064-42230086 CAGAAAAAGGCAACACAGACAGG - Intronic
1026732616 7:72924947-72924969 CAGAAACAGGCGTTAAAGGCAGG + Intronic
1026977007 7:74505179-74505201 CAGAAAATGAAGGCAGAGGCCGG - Intronic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028408408 7:90501194-90501216 TAGAAAAAGGAGATACAGGCAGG + Intronic
1029141495 7:98414006-98414028 TAGAAAAAAGGGGCAGAGGCCGG - Intergenic
1030096586 7:105906234-105906256 TATAAAAAGGAGACTGAGGCAGG + Intronic
1030600290 7:111584378-111584400 CAGAACAAAGCGGTAGAGGCAGG - Intergenic
1030670413 7:112329600-112329622 CAGAAAATGGCAACAGAGAAGGG + Intronic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1033087686 7:138357412-138357434 CAAAAAAAGCAGACACAGGCAGG - Intergenic
1033115329 7:138619984-138620006 CAGAGAAAGAGGACAGAGCCTGG + Intronic
1033368905 7:140691608-140691630 CATGACAAGGCGACAGAGCCGGG - Intronic
1034227831 7:149497208-149497230 CAGAAGGAGGGGACAGCGGCTGG + Intronic
1034529962 7:151689548-151689570 CAGGAGAAGGCGGCAGAGGCGGG + Intronic
1034654953 7:152721988-152722010 TAGAAAGAGGCCTCAGAGGCCGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035082835 7:156232166-156232188 CAGAGAAATGCCACAGGGGCAGG + Intergenic
1035265954 7:157690475-157690497 CTGGAAGAGGCGAGAGAGGCTGG - Intronic
1036476359 8:9096875-9096897 CAGAAAGTGGGAACAGAGGCCGG - Intronic
1038906534 8:31910309-31910331 ATGAAAATGGAGACAGAGGCGGG + Intronic
1039083885 8:33760541-33760563 CAGAGAACTGCCACAGAGGCAGG - Intergenic
1040861145 8:52000477-52000499 CAGGAAGAGGAGGCAGAGGCAGG + Intergenic
1042426871 8:68659355-68659377 CAGAAGGAGGCAAAAGAGGCTGG - Intronic
1047191719 8:122684419-122684441 CAGAAAAAGCCTGAAGAGGCTGG + Intergenic
1047499996 8:125432980-125433002 CAGGAAAGGGCCACAGAGGGTGG + Intronic
1049256945 8:141619226-141619248 CAGCAAGAGGGGACAGAGCCGGG + Intergenic
1049271470 8:141698434-141698456 CAGACAGAAGTGACAGAGGCAGG - Intergenic
1049433139 8:142574471-142574493 CAGAGAAAGGCAGCGGAGGCCGG - Intergenic
1049591493 8:143464902-143464924 GAGAAACAGGCGTGAGAGGCTGG + Intronic
1050552723 9:6761798-6761820 AAGAAAAAAGAGACAGAGGTTGG - Intronic
1054321119 9:63666315-63666337 CTGAAATAGGCCCCAGAGGCAGG - Intergenic
1054857477 9:69916309-69916331 TAGAGAAAGGTGGCAGAGGCAGG + Intergenic
1056475212 9:86946481-86946503 GAGAAAGAGGCGGCCGAGGCCGG + Exonic
1056553546 9:87671098-87671120 CAGATAACGGGGACAGAGGACGG - Intronic
1057004714 9:91547060-91547082 CAGGAAAAGGAGTCAGGGGCAGG + Intergenic
1057132463 9:92663893-92663915 CAGAAAAAGACAACAGCAGCAGG + Intronic
1058203176 9:102068733-102068755 CTGAAAAAAACGAAAGAGGCTGG + Intergenic
1059943420 9:119380654-119380676 AAGAAAGAGCCGAGAGAGGCAGG - Intergenic
1062160927 9:135079323-135079345 AAGAAGAAGAGGACAGAGGCTGG + Intronic
1186615567 X:11183623-11183645 AGGAAAAAGGAGACAGAGGGAGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187795374 X:22998568-22998590 CAGAAAACTTTGACAGAGGCTGG + Intergenic
1187896275 X:23982425-23982447 CAGTAAAAGGCTGCGGAGGCGGG + Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1189880534 X:45487013-45487035 CAGAAAACTGCCACAGAAGCAGG + Intergenic
1189907721 X:45779077-45779099 CAGAAATAGGCTACAGAGAACGG - Intergenic
1190068815 X:47262460-47262482 CAGAAAGCTGCAACAGAGGCTGG + Intergenic
1190703491 X:53005908-53005930 AAGAAAAGGGCAACAGGGGCTGG + Intergenic
1190732025 X:53232850-53232872 CAGAAGTAGGAGGCAGAGGCAGG + Intergenic
1190971930 X:55357644-55357666 CAGAAAAAGGCTCCAGAAGATGG + Intergenic
1197478020 X:126947299-126947321 GAGATAAAGTCTACAGAGGCTGG - Intergenic
1197750605 X:129961296-129961318 CATAAAAGGGCGAGAGAGGGGGG - Intergenic
1198039306 X:132834085-132834107 CCTAAAAAGGTGACATAGGCAGG + Intronic
1199124651 X:144101942-144101964 CAGAAAAAGCCGGTAGAGTCAGG - Intergenic
1199524777 X:148780727-148780749 CAGAAGTAGGCGTCAGAAGCTGG - Intronic
1200885507 Y:8264455-8264477 CTGAAAAAGGAGACCGAAGCAGG - Intergenic