ID: 1090396166

View in Genome Browser
Species Human (GRCh38)
Location 11:126420037-126420059
Sequence AGTCCACTTAGCCCACCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090396166_1090396175 30 Left 1090396166 11:126420037-126420059 CCCGTGGGTGGGCTAAGTGGACT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1090396175 11:126420090-126420112 TGGCAGGCAGATATTGGCAGAGG 0: 1
1: 0
2: 0
3: 21
4: 248
1090396166_1090396172 10 Left 1090396166 11:126420037-126420059 CCCGTGGGTGGGCTAAGTGGACT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1090396172 11:126420070-126420092 AAAGCACTGGGAACATGGAGTGG 0: 1
1: 0
2: 1
3: 44
4: 339
1090396166_1090396168 -3 Left 1090396166 11:126420037-126420059 CCCGTGGGTGGGCTAAGTGGACT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1090396168 11:126420057-126420079 ACTGTTTCCGAGAAAAGCACTGG 0: 1
1: 0
2: 0
3: 3
4: 100
1090396166_1090396169 -2 Left 1090396166 11:126420037-126420059 CCCGTGGGTGGGCTAAGTGGACT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1090396169 11:126420058-126420080 CTGTTTCCGAGAAAAGCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1090396166_1090396173 14 Left 1090396166 11:126420037-126420059 CCCGTGGGTGGGCTAAGTGGACT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1090396173 11:126420074-126420096 CACTGGGAACATGGAGTGGCAGG 0: 1
1: 0
2: 2
3: 20
4: 244
1090396166_1090396174 24 Left 1090396166 11:126420037-126420059 CCCGTGGGTGGGCTAAGTGGACT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1090396174 11:126420084-126420106 ATGGAGTGGCAGGCAGATATTGG 0: 1
1: 0
2: 0
3: 21
4: 252
1090396166_1090396171 5 Left 1090396166 11:126420037-126420059 CCCGTGGGTGGGCTAAGTGGACT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1090396171 11:126420065-126420087 CGAGAAAAGCACTGGGAACATGG 0: 1
1: 0
2: 1
3: 23
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090396166 Original CRISPR AGTCCACTTAGCCCACCCAC GGG (reversed) Intronic
910902358 1:92134793-92134815 TGTCCCCTTAGCCCACACACAGG + Intronic
916328474 1:163590330-163590352 AGTCCACTTATTCCAGCCCCTGG + Intergenic
921000938 1:211042042-211042064 AGTGCACTTGGCCCACCCACTGG + Intronic
922566243 1:226603648-226603670 AGCCCACCTACCCCATCCACCGG + Exonic
922885956 1:229020655-229020677 CCTCCACTTGGGCCACCCACTGG + Intergenic
1070767735 10:79066449-79066471 TGTGAACTTAGGCCACCCACAGG + Intergenic
1075007366 10:118840589-118840611 TGTGCACTCAGCCCACCCTCTGG - Intergenic
1080613768 11:33928045-33928067 AATCCATTTAGCTCACCCTCAGG + Intergenic
1083826397 11:65206407-65206429 TGCCCACTCAGCCCACCCTCAGG - Intronic
1087005399 11:93466055-93466077 ATTCCACTGAGCCCACCCATGGG - Intergenic
1090124228 11:124069465-124069487 AGTTCCCTTAGCCCCCTCACAGG + Intergenic
1090396166 11:126420037-126420059 AGTCCACTTAGCCCACCCACGGG - Intronic
1108753458 13:53472869-53472891 AGCCCACATAACCCACCTACTGG + Intergenic
1115256979 14:31413473-31413495 AGTCCAATTAGGGCTCCCACTGG - Intronic
1125538510 15:40456617-40456639 TGTCCAGTGACCCCACCCACTGG + Intronic
1132878988 16:2152973-2152995 AGTCCACCTGGCCCAGGCACAGG - Exonic
1134292671 16:12915042-12915064 AGCCCTCTAAGCCCACACACTGG - Intronic
1137341617 16:47612865-47612887 AGTCCACTTCACCCAGCCCCGGG - Intronic
1146707036 17:35008358-35008380 AGGTCACTTGGCCCAACCACAGG + Exonic
1152320117 17:79603982-79604004 AATCCACTCACCACACCCACAGG + Intergenic
1155359160 18:24982899-24982921 AGTCCACTTAGCAAAATCACAGG - Intergenic
1158983380 18:62787894-62787916 GTTCCACTTAACCAACCCACTGG - Intronic
1165924218 19:39317044-39317066 AGTCCACTTCTCCCTCCCCCTGG - Intergenic
930170513 2:48246884-48246906 AGCCCACATAGCCCAGCCAGAGG + Intergenic
930571473 2:53091790-53091812 AGTTAACTTGGCCCACCCCCAGG + Intergenic
932555404 2:72819649-72819671 AGTCCACATAGCAAACCCAAGGG + Intronic
936034378 2:109099110-109099132 AGTACACTTAGCCAACCCGTTGG - Intergenic
937968646 2:127533701-127533723 ACTCCATGGAGCCCACCCACAGG + Intergenic
940338113 2:152549739-152549761 AGTACAATTAGGCCACCCAGGGG - Intronic
948147745 2:235720743-235720765 AGTCTACATATCCCAGCCACGGG - Intronic
1172177345 20:32980397-32980419 CCGCCACTCAGCCCACCCACTGG - Intergenic
1172790184 20:37498562-37498584 AGTCCCCTTTGGCCACCCTCTGG - Intronic
1173593236 20:44241558-44241580 AGGCCACTTAGGCCACCTGCAGG - Intergenic
1175308676 20:57995817-57995839 GGACCACACAGCCCACCCACAGG + Intergenic
1175939600 20:62531947-62531969 GGTCCACTGAACCCACCCAGAGG - Intergenic
1180021711 21:45132605-45132627 CATCCCCTAAGCCCACCCACAGG - Intronic
1181622814 22:24102619-24102641 AGGCCTCTTACCCCACCAACAGG - Intronic
1184281284 22:43438883-43438905 TGCCCACCTCGCCCACCCACTGG + Intronic
1185075083 22:48678644-48678666 AGTGTCCTCAGCCCACCCACAGG + Intronic
961330863 3:126137120-126137142 AGTCCTCTTAGCCCACCCTAAGG - Intronic
961769325 3:129237123-129237145 AGTACACTTAGGCCACACATGGG + Intergenic
966853294 3:184177398-184177420 TGGCCACTAACCCCACCCACTGG - Intronic
970624026 4:17857499-17857521 GGTCAACTTAGCCCTACCACAGG + Intronic
977706114 4:100071988-100072010 AGTCTACATTGCCAACCCACGGG + Intergenic
980588648 4:134854310-134854332 AGTCCAGTCAGCCCACTCCCAGG + Intergenic
994058236 5:95444534-95444556 AGACAAATAAGCCCACCCACTGG - Intronic
997734098 5:136200816-136200838 AGTCTACTTCTCCCATCCACAGG - Intergenic
1001568068 5:172713288-172713310 AGGCCACGGCGCCCACCCACTGG - Intergenic
1006885884 6:37381905-37381927 AGTCTACTCTGCCCTCCCACAGG - Intronic
1007202676 6:40123424-40123446 TGTCCTCTAAGCCCACCCAAAGG - Intergenic
1021349163 7:19568263-19568285 AGTCAACTAACACCACCCACAGG - Intergenic
1022969525 7:35504554-35504576 AGTGCAGTTATCCCACCCCCTGG - Intergenic
1025718135 7:63982937-63982959 ATTGCCCTTAGCCCAGCCACAGG + Intergenic
1032496215 7:132364751-132364773 AGCCCACTTAGCTCAACCACAGG - Intronic
1037076746 8:14729956-14729978 AGTCCTCTAATCCCACCTACTGG + Intronic
1040314896 8:46255778-46255800 AGTCCCTGTGGCCCACCCACGGG - Intergenic
1041121578 8:54591690-54591712 AGTCCAATTGGCCCACCCAAAGG - Intergenic
1049330130 8:142045994-142046016 AGCTCACGTAGCCCACCTACGGG + Intergenic
1049853832 8:144849376-144849398 AGTCTACTGACCCCACCCCCAGG + Intronic
1053142406 9:35690054-35690076 CGCCCCCTTCGCCCACCCACTGG + Exonic
1054655572 9:67662570-67662592 AATAAGCTTAGCCCACCCACAGG + Intergenic
1057855138 9:98595877-98595899 AGTCCTCTTTCCCCAGCCACAGG + Intronic
1060889761 9:127180571-127180593 AGTCCCCTTAGTCCAGCCCCTGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic