ID: 1090396494

View in Genome Browser
Species Human (GRCh38)
Location 11:126422807-126422829
Sequence CTGTGGATTGGGACCATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090396489_1090396494 15 Left 1090396489 11:126422769-126422791 CCTCTGAGTGGAGGAGCTGTGTA 0: 1
1: 0
2: 1
3: 9
4: 205
Right 1090396494 11:126422807-126422829 CTGTGGATTGGGACCATCCAAGG 0: 1
1: 0
2: 0
3: 4
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090396494 Original CRISPR CTGTGGATTGGGACCATCCA AGG Intronic
901443722 1:9294374-9294396 GTGTGTGTGGGGACCATCCAGGG + Intronic
901455333 1:9359886-9359908 CTTTGGAATGGGCTCATCCATGG + Intronic
902551650 1:17223119-17223141 CTGTCGACTGGGGCCATCCCAGG + Intronic
907304341 1:53505485-53505507 CTCTGGAGTGGAACCATGCAAGG - Intergenic
910718147 1:90255505-90255527 CTCTGGATGGAGACCACCCAAGG + Intergenic
913132242 1:115851301-115851323 CTGGGGATGGGGAAAATCCATGG - Intergenic
915914480 1:159932628-159932650 CTGTGCCCTGGGACCAGCCAGGG + Exonic
922131777 1:222787293-222787315 CTATGCATTGGAATCATCCAAGG + Intergenic
924878170 1:248128578-248128600 CTGTGGATTGCAAAAATCCACGG - Intergenic
1065625147 10:27622695-27622717 TTGTGGCCTGGTACCATCCAGGG - Intergenic
1065868128 10:29931993-29932015 ATGTGGGAGGGGACCATCCAAGG - Intergenic
1069894942 10:71674755-71674777 CTGTGGATTAGAACCATGCCAGG + Intronic
1071118684 10:82252889-82252911 CTGAGGACTGAGAACATCCACGG - Intronic
1075649994 10:124121543-124121565 CTGTGGAGTGAGCCCACCCATGG + Intergenic
1076715321 10:132361084-132361106 CTGTGGAGAGGGGCCATCTAAGG + Intronic
1084418845 11:69050077-69050099 CTGTGGCATGTGCCCATCCATGG + Intronic
1084605067 11:70167654-70167676 CTGTGGCTGGGGACCATGCTTGG - Intronic
1084605076 11:70167680-70167702 CTGTGGCTGGGGACCATACCTGG - Intronic
1086893541 11:92286230-92286252 CTGTGGATTGGAAAAATTCAGGG + Intergenic
1086938896 11:92774760-92774782 CTGTGGCTGGGGTCCAGCCACGG - Intronic
1090396494 11:126422807-126422829 CTGTGGATTGGGACCATCCAAGG + Intronic
1093759736 12:22895210-22895232 CTGTGGAATGGGACCCTCTCTGG + Intergenic
1096217786 12:49808152-49808174 CTGTGGATCGGGGCCATGCCTGG - Intronic
1096898378 12:54848118-54848140 CTGTGGCCTGGGATCATCAAGGG - Intronic
1102573225 12:113840355-113840377 CTGTGGATGGGTCACATCCAGGG + Intronic
1103768964 12:123305242-123305264 CAGAGGACTGGGGCCATCCAAGG - Intronic
1105453734 13:20522552-20522574 CTGTCTATTGGGACCACGCATGG + Intronic
1107834607 13:44403543-44403565 CTGTGAATCGGGGCCATTCACGG + Intergenic
1109968677 13:69737162-69737184 CTGTGGATTGCAAGGATCCATGG - Intronic
1116254997 14:42542199-42542221 CTGGGGACTGAGACAATCCAAGG - Intergenic
1117343615 14:54812104-54812126 CTCTGGGTTGGGACCATCTCAGG + Intergenic
1118005293 14:61559912-61559934 CTGCGCATTGGAACCATCTAGGG - Intronic
1122150915 14:99725764-99725786 CTGAGAAATGGGACCATCCGTGG + Intronic
1122268952 14:100559770-100559792 ACGTGGAGTGGGACCAGCCAGGG - Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1124963529 15:34416146-34416168 CTGTGGAATGGGCCCTTCCGAGG + Intronic
1124980150 15:34562372-34562394 CTGTGGAATGGGCCCTTCCGAGG + Intronic
1126704343 15:51393744-51393766 CAGTGAACTGGGACAATCCAAGG + Intronic
1128213513 15:65918165-65918187 CTGTGGCTTGGGAACTTCTAGGG - Intronic
1129484984 15:75862179-75862201 CTGTGGGATGGGCCCATCCAAGG + Intronic
1129945240 15:79533969-79533991 CTGTGCATTAGCAGCATCCATGG - Intergenic
1130475357 15:84261436-84261458 CTGTGGGATGGGACTGTCCAAGG + Intergenic
1130482774 15:84375490-84375512 CTGTGGGATGGGACTGTCCAAGG + Intergenic
1135375570 16:21944093-21944115 CTGTGGATTGCAAAGATCCATGG + Intergenic
1140415455 16:74770992-74771014 CTGGGAGGTGGGACCATCCAGGG + Intronic
1141536188 16:84681907-84681929 TTGAGGATTGAGACCAGCCATGG - Intergenic
1142173183 16:88633506-88633528 CTGTGGACTGGGACCAGGCGAGG + Intergenic
1144891711 17:18497992-18498014 CTGTGCATCGGGACCCTTCAAGG - Intergenic
1145140511 17:20446325-20446347 CTGTGCATCGGGACCCTTCAAGG + Intergenic
1146213833 17:30962672-30962694 CTGGAGATTGAGACCATCCTGGG - Intergenic
1148114967 17:45170152-45170174 CTCTGGATGGGGACCTCCCAAGG + Intergenic
1151223291 17:72629933-72629955 CTGTCTATTGGGAAAATCCAGGG + Intergenic
1152912855 17:83015185-83015207 CTGTGGAGGGGGACCATCTGCGG + Intronic
1153799848 18:8659433-8659455 CTGTGAATTGGGACGATGCGCGG + Intergenic
1156462721 18:37330640-37330662 CTGTGCATTGGGGCCATGCTGGG - Intronic
1156782331 18:40865868-40865890 ATGTGGATTTTTACCATCCATGG - Intergenic
1158079557 18:53573725-53573747 CTTTGGATTGGGACCCTAAAGGG - Intergenic
926993000 2:18699996-18700018 ATGGGGCTTGGTACCATCCATGG + Intergenic
929948169 2:46386068-46386090 CTGTGGCTAGGGGCCATCCCTGG - Exonic
934622951 2:95826688-95826710 CTGTGGATTGCAAAGATCCATGG + Intergenic
934810815 2:97275400-97275422 CTGTGGATTGCAAAGATCCATGG - Intergenic
934826877 2:97432539-97432561 CTGTGGATTGCAAAGATCCATGG + Intergenic
935318897 2:101865917-101865939 GTGTGCTTTGGGTCCATCCATGG + Intronic
935825326 2:106942214-106942236 CTGGAGGTTGGGACCATCCTGGG - Intergenic
935852205 2:107235302-107235324 CTGTGGATTGCAAAAATCCATGG - Intergenic
941713027 2:168734628-168734650 CTGTATATTGGGAACATACATGG + Intronic
947826289 2:233107962-233107984 ATGTGGTTTGGGACCATGCCTGG + Intronic
948931836 2:241137065-241137087 CTGCCGGATGGGACCATCCACGG - Exonic
1170379904 20:15746957-15746979 ATTTGGAATGGCACCATCCATGG + Intronic
1170732624 20:18987874-18987896 ATGTGGGATGGGACCACCCAGGG + Intergenic
1170964351 20:21052844-21052866 CTGTGGACTGTGCTCATCCATGG - Intergenic
1171074432 20:22108012-22108034 CTATGGATTGGGTCAAGCCATGG - Intergenic
1175970264 20:62682808-62682830 CTGTGAATGGGGCCCATACAGGG + Intronic
1179315771 21:40243095-40243117 CTGTGCTTTGGGACCACCCCTGG + Intronic
1179511475 21:41876854-41876876 CTGTGGAGTGGAATCATGCAGGG + Intronic
1181738887 22:24904158-24904180 CTGTGAAATGGGATAATCCATGG + Intronic
1183044863 22:35211447-35211469 CTATGTATCAGGACCATCCAAGG - Intergenic
1183172663 22:36199262-36199284 CTGTGGGTAGGAACCAGCCAGGG + Intronic
949846865 3:8380417-8380439 CTGTGGGTTGGGAACTTCTATGG - Intergenic
950170298 3:10834474-10834496 CTGTGGGTTGGGTCCTTCCTGGG + Intronic
950217391 3:11169185-11169207 CTGTGGAATAGGACCATACTGGG + Intronic
951936749 3:28030958-28030980 CAGGAGATTGGGACCATCCTGGG + Intergenic
952429619 3:33210334-33210356 CTTTGGGTTGGGACCTTGCAGGG - Intronic
955175599 3:56611091-56611113 GTGTGGAGAGGGACCAGCCATGG + Intronic
955203552 3:56874794-56874816 CTGTGGAATCGAACCATCCTGGG + Intronic
955776660 3:62440843-62440865 CTGGGGTTTGGGACTATCGAGGG + Intronic
956212919 3:66820388-66820410 CTGAGGAATGGGGCCTTCCAGGG + Intergenic
959697490 3:109264129-109264151 CTGTGGATTGGGATAATTGATGG - Intergenic
961530758 3:127538685-127538707 CTGTGGCATGGGACCATGAATGG - Intergenic
969888871 4:10241041-10241063 CTGCTCATTGGGACTATCCAAGG + Intergenic
972325756 4:38014144-38014166 CTTTGGAGTGGGACCAGCCTGGG + Intronic
972867158 4:43246802-43246824 ATGTGAATTGGTACAATCCATGG - Intergenic
974539838 4:63219541-63219563 CTGTGGATTGCAAAGATCCATGG + Intergenic
976384279 4:84437440-84437462 CTGTGCACTGGAGCCATCCAAGG - Intergenic
977027133 4:91833952-91833974 CTGTGGTTTGGGACCATTGCTGG + Intergenic
979303617 4:119116115-119116137 GTGATGATTGGGACCAGCCAAGG - Intergenic
987165184 5:15190643-15190665 CTGTGGAATGACATCATCCACGG - Intergenic
987830003 5:23084002-23084024 CTGTGAAATGGGACCAGACAGGG + Intergenic
991350738 5:65718230-65718252 CTGTGCATTAGCAGCATCCATGG + Intronic
995182364 5:109240754-109240776 GTGATGAATGGGACCATCCAGGG - Intergenic
996790116 5:127283443-127283465 CTGTGGAGTGGGATCATGCTTGG - Intergenic
997588526 5:135058935-135058957 CTGTTGAATGGGAGCATGCAAGG + Intronic
1007207876 6:40167341-40167363 CTGTGGACTGGGAGCAGCCTGGG - Intergenic
1011104949 6:83769119-83769141 GAGTGGATTAGGACCATCAATGG + Intergenic
1012349219 6:98230917-98230939 CTGTGCATTGGAATCACCCAGGG - Intergenic
1013314135 6:108924823-108924845 CTGTGGAAGGAGCCCATCCAGGG + Intronic
1014365556 6:120536888-120536910 CTGTGGATTGGTACCAAGAAAGG + Intergenic
1019727851 7:2612756-2612778 CTGTGGATGGGGCCTAGCCATGG + Exonic
1022762158 7:33366243-33366265 CCGTGGAGTGGGAACTTCCATGG - Intronic
1024087880 7:45911754-45911776 CTGTGGCTTCAGAGCATCCAAGG - Intergenic
1026528019 7:71172640-71172662 CTGTGGAGTGGGAGCTACCAGGG + Intronic
1028378911 7:90176530-90176552 CTCTGGATTCAGGCCATCCATGG + Intronic
1028784543 7:94776834-94776856 CTGTGTAATAGGACCACCCAAGG + Intergenic
1033153889 7:138939936-138939958 CTGTGGTTTGAGACCAGCCTGGG + Intronic
1033738786 7:144251467-144251489 CTGGGGAATGGGACCATCCTGGG - Intergenic
1033744261 7:144299487-144299509 CTGGGGAATGGGACCATCCTGGG + Intergenic
1036143249 8:6227508-6227530 CAGGGCAGTGGGACCATCCATGG - Intergenic
1036574661 8:10015380-10015402 CTGTGGCTTGGGACCAGCTATGG - Intergenic
1041195509 8:55397891-55397913 CTGAGGGTGGGAACCATCCAAGG + Intronic
1047916829 8:129592279-129592301 GTGTTGATTTGGTCCATCCAAGG - Intergenic
1048396657 8:134020418-134020440 CTGTGTGTTGGCCCCATCCAGGG + Intergenic
1049249886 8:141582653-141582675 CTCTGGGTTGGGTCCATCCGTGG + Intergenic
1053398698 9:37799423-37799445 CAGTAGATTGGACCCATCCAGGG + Intronic
1059388648 9:113984945-113984967 CTGTGGAGTTAGACCAACCAGGG - Intronic
1061533635 9:131233974-131233996 TTGTGTATCAGGACCATCCAAGG + Exonic
1062264718 9:135681746-135681768 CTGGGGAGTGTGACCCTCCAGGG + Intergenic
1186870682 X:13768250-13768272 CTGTGGGTGGGGGACATCCAGGG + Intronic
1187198933 X:17116258-17116280 CTGTGCAATGGGATGATCCATGG + Intronic
1192432651 X:71122841-71122863 CTTTGGATTGGGACCTAGCAAGG + Exonic
1199985377 X:152946469-152946491 TTTTGGACTGGGACCCTCCAGGG - Intronic
1201405577 Y:13646405-13646427 TTGTGGAGGAGGACCATCCAGGG + Intergenic
1202375388 Y:24230656-24230678 CTGTGGGATGGGACTGTCCAAGG - Intergenic
1202495392 Y:25439463-25439485 CTGTGGGATGGGACTGTCCAAGG + Intergenic