ID: 1090396661

View in Genome Browser
Species Human (GRCh38)
Location 11:126423865-126423887
Sequence CTGGGGGGAGGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19856
Summary {0: 1, 1: 8, 2: 152, 3: 2625, 4: 17070}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090396661_1090396675 1 Left 1090396661 11:126423865-126423887 CCCTCCTCCCTCCCTCCCCCCAG 0: 1
1: 8
2: 152
3: 2625
4: 17070
Right 1090396675 11:126423889-126423911 ACACCAGGCTCTGACCGGACCGG 0: 1
1: 0
2: 1
3: 7
4: 80
1090396661_1090396679 22 Left 1090396661 11:126423865-126423887 CCCTCCTCCCTCCCTCCCCCCAG 0: 1
1: 8
2: 152
3: 2625
4: 17070
Right 1090396679 11:126423910-126423932 GGTCCCACCGCAGAGTTCAGCGG 0: 1
1: 0
2: 1
3: 16
4: 96
1090396661_1090396674 -4 Left 1090396661 11:126423865-126423887 CCCTCCTCCCTCCCTCCCCCCAG 0: 1
1: 8
2: 152
3: 2625
4: 17070
Right 1090396674 11:126423884-126423906 CCAGTACACCAGGCTCTGACCGG 0: 1
1: 0
2: 0
3: 22
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090396661 Original CRISPR CTGGGGGGAGGGAGGGAGGA GGG (reversed) Exonic
Too many off-targets to display for this crispr