ID: 1090397983

View in Genome Browser
Species Human (GRCh38)
Location 11:126431776-126431798
Sequence CAGAGGAAGGAGAGCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 988
Summary {0: 1, 1: 0, 2: 5, 3: 89, 4: 893}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090397983 Original CRISPR CAGAGGAAGGAGAGCGAGGC AGG Intronic
900105529 1:979334-979356 CAGAGGGAGGGGGGCGAGGCAGG + Exonic
900116521 1:1031543-1031565 CAGGGGAAGGGGAACCAGGCAGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900459308 1:2793945-2793967 AAGAAGAAGGAGGGCGAGGAGGG - Intronic
900465770 1:2824807-2824829 CAGAGGGAGGAGAGGCAGCCAGG - Intergenic
900617107 1:3570435-3570457 CAGGGAAAGGATAGCCAGGCAGG + Intronic
900662469 1:3791750-3791772 TAAAGAAAGGAGAGAGAGGCCGG - Intronic
900685589 1:3945849-3945871 CATAGGGAGGGGAGCAAGGCTGG - Intergenic
900696131 1:4011451-4011473 GAGAGGTAGGAGAGCCAGGTAGG + Intergenic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900701253 1:4049837-4049859 GAGAGGGAGGAGAGAGAGGGAGG + Intergenic
900718724 1:4161441-4161463 CAGAGGAAGTAGAGCAAGCCCGG + Intergenic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
900909448 1:5584611-5584633 AAGAGGAGGAAGAGAGAGGCGGG + Intergenic
901300452 1:8196565-8196587 GAGAGGGAGAAGAGGGAGGCAGG - Intergenic
901534613 1:9874102-9874124 AAGAGGAAGAAGAGACAGGCTGG - Intronic
901650221 1:10738719-10738741 GAGGGGGAGGAGAGGGAGGCAGG + Intronic
901653378 1:10755657-10755679 CGGAGGAAGGAGGCCCAGGCTGG + Intronic
901773044 1:11540483-11540505 AAGAGGAAGGAGAGAGAAGCGGG - Intergenic
901934703 1:12619241-12619263 CGGAGGAGCGAGAGCGAAGCAGG + Intergenic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902221933 1:14971907-14971929 CAGGGGAAGGAGGACGAGACTGG - Intronic
902364084 1:15959498-15959520 AAGAGGGAGGAGAGGGAGGGAGG + Intronic
902618233 1:17635443-17635465 CAGAGGGAGGTGAGTGAGGCAGG - Intronic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902682430 1:18052979-18053001 AAGAGGAAAGAGAGCGGGGGTGG - Intergenic
902783779 1:18720345-18720367 AAGAGGCAGGAGAGCAAGGGAGG + Intronic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903120738 1:21215506-21215528 AAGAGGAAGGAGGCCAAGGCGGG + Intergenic
903478342 1:23635678-23635700 CAGAGGAGAGACAGTGAGGCAGG + Intronic
903644498 1:24886405-24886427 CAGAGGAGGGGGAGCCTGGCTGG - Intergenic
903780374 1:25816608-25816630 CAGAGGTAGAAGAGCTAGCCTGG - Exonic
904083879 1:27889762-27889784 CACAGGCAGGAGAGCCAGCCAGG - Intergenic
904152940 1:28457953-28457975 CAGAGAAAGGAGAGCCAAGGCGG - Intronic
904274193 1:29369653-29369675 CACAGGAAGGAGAGAGGGGCAGG - Intergenic
904364481 1:30001743-30001765 CACAGGAGGGAGAGAGGGGCAGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904412046 1:30330437-30330459 GAGAGGAAGGAGAGGAAGGAGGG - Intergenic
904423773 1:30410440-30410462 CACAGGAAGGAGAGAGGGGCAGG + Intergenic
904431733 1:30468753-30468775 CAGGGGAAGGGGAGAGAGGGTGG - Intergenic
904615731 1:31748549-31748571 AAGAGGAAGCTGAGCCAGGCAGG + Intronic
904644400 1:31955075-31955097 CAGAGGCAGGGGAGGCAGGCAGG + Intergenic
904807737 1:33143572-33143594 AAGAGGAATGAGAACGAGGATGG - Intergenic
905327029 1:37160647-37160669 AACAGGAAGAAGAGAGAGGCTGG + Intergenic
905539245 1:38746971-38746993 TAGAGGAAGGAGAGCAGGGAGGG + Intergenic
905617122 1:39408951-39408973 CACAGGAAGGAGGACGAGGGCGG - Intronic
906259669 1:44377539-44377561 CAGAGTACGGAGAGAGAGGGAGG + Intergenic
906399695 1:45495952-45495974 CAGAGGGAGGAGAGATTGGCAGG - Intronic
906518249 1:46452244-46452266 AAGAGGAAGCAGAGTGGGGCTGG + Intergenic
906560917 1:46756222-46756244 CAGAGGCAGGAGAGTGGGGTAGG - Intergenic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
907216795 1:52870760-52870782 CTGAGGCAGGAGAGTCAGGCAGG + Intronic
907246312 1:53111273-53111295 GACAGGAAGGACAACGAGGCGGG + Intronic
907394136 1:54177885-54177907 CAGAGGAGGGAAAGCAAGGCTGG + Intronic
908030385 1:59992995-59993017 CAGAGGAAGCAAAGCTAGACAGG - Intronic
908287310 1:62621136-62621158 GAGAGGAAGAAGAGGGAGGAAGG + Intronic
909087065 1:71180764-71180786 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
912233088 1:107818105-107818127 CAGAGTGAGGAGAGCAGGGCAGG + Intronic
912303086 1:108536717-108536739 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
912669237 1:111608800-111608822 CTGAGGCAGGAGAACCAGGCAGG + Intronic
912756030 1:112325488-112325510 CAGAGAGAGGAGAGCCAGGCTGG + Intergenic
912954420 1:114144464-114144486 CAGAGGAAAGAGTGCCAGCCTGG - Intronic
913531521 1:119737302-119737324 CAGAGGGAGGAGAGGAAGGAAGG + Intronic
914260699 1:145996809-145996831 GAGAGGAAGGAGAGGAAGGAGGG + Intergenic
914343849 1:146781564-146781586 AAGAGGGAGGAGAGAAAGGCAGG + Intergenic
914664174 1:149819165-149819187 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
914671588 1:149874677-149874699 CTGAGGCAGGAGAATGAGGCAGG + Intronic
914803157 1:150974749-150974771 CGGAGGAGGGAGGGCGAGGGCGG - Exonic
915010101 1:152677327-152677349 TAGAGGAAGGGGAGGGAAGCAGG + Intergenic
915161253 1:153922498-153922520 GTGAAGAAGGAGCGCGAGGCGGG + Intronic
915530506 1:156500061-156500083 GAGAGGAGGGAGAGGGAGGGAGG + Intronic
916108732 1:161448175-161448197 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916110320 1:161455556-161455578 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916111905 1:161462966-161462988 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916113492 1:161470347-161470369 CGGAGGAAGGAGAGAGAAGGAGG + Intergenic
916211777 1:162365582-162365604 CAGAGGAAGCAGGGCTGGGCAGG - Intronic
916683285 1:167123258-167123280 CAGAGGGACAAGAGAGAGGCTGG - Intronic
916735791 1:167605806-167605828 TAGAGGAAGGAGAGCTGTGCTGG - Intergenic
916993493 1:170270112-170270134 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
917793020 1:178511969-178511991 CAGCGGAAGGAGAGGGAGTTGGG - Intergenic
917817568 1:178725724-178725746 CCCAAGAGGGAGAGCGAGGCGGG - Intronic
917968524 1:180193377-180193399 CAGAGGAGAGAGAGAGAGGCAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918022871 1:180711513-180711535 CTGAGGCAGGAGAATGAGGCAGG + Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918322926 1:183382182-183382204 CAGGAGAAGGAGAGCAAAGCAGG + Intronic
918660444 1:187081626-187081648 CAGATGAAGGAGAGCCATGTAGG + Intergenic
918842965 1:189567994-189568016 CAGAGGAAAGAAAGAGTGGCAGG + Intergenic
919422165 1:197383367-197383389 CAGAGAATGGAGAGCGTAGCGGG - Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920325654 1:205161292-205161314 CAGAGAAAGGCGGGCCAGGCGGG + Exonic
920440729 1:205978929-205978951 CTGGGGAAGGAAAGAGAGGCCGG + Intronic
920651180 1:207838522-207838544 CAGAGGGCGGAGAGTGAGGGGGG + Intergenic
921052011 1:211517535-211517557 GAGAGAAAGAAGAGTGAGGCTGG - Intergenic
921225527 1:213015571-213015593 CGGAGGGAGGAGAGAGGGGCGGG - Intronic
921252741 1:213312613-213312635 CTGTGGAAGGAAAGCGAGCCTGG + Intergenic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
922408115 1:225339895-225339917 CAGAGGAGGAAGAGGGAAGCTGG - Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922616144 1:226962272-226962294 CACAGGGATGAGAGAGAGGCTGG - Intronic
922764912 1:228151689-228151711 CACAGGCAGGACAGTGAGGCCGG + Intronic
923009551 1:230077264-230077286 GAGGGGAAGGAGAGTGCGGCAGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923549725 1:234953958-234953980 CAGAAAAAGGAGGCCGAGGCAGG - Intergenic
923798832 1:237186923-237186945 CAGTGGAAGGAGCTCAAGGCCGG - Intronic
924286163 1:242489443-242489465 CAGAGGAAGGACAGGAAGGAGGG + Intronic
924606664 1:245541251-245541273 CAGGGGCAGGAGACCGAGGGAGG + Intronic
924737132 1:246768394-246768416 CAGAGGAAGCAGAGTTAGGGTGG - Intergenic
1062802518 10:390645-390667 CAGAGGATTGAAACCGAGGCGGG + Intronic
1062858455 10:791337-791359 CAGAGGAAGGAAGGACAGGCAGG + Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063055608 10:2501390-2501412 CCGAGGAAGAAGGGCGAGGGAGG - Intergenic
1064002621 10:11676108-11676130 CAGGAGGAAGAGAGCGAGGCAGG - Intergenic
1064306764 10:14174293-14174315 GAGAGGGAGGAGAGAGAGGGAGG - Intronic
1065471925 10:26091009-26091031 CGAATGAAGGAGAGAGAGGCTGG - Intronic
1065497980 10:26349620-26349642 TAGAGGAAGGAGAGGAAGCCCGG + Intergenic
1065506335 10:26433626-26433648 CAGAGGGAGAAGAGCGGGGGAGG - Intergenic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1067047044 10:42990718-42990740 CAGAGGAAGGAGACAGGGGTGGG + Intergenic
1067238624 10:44472159-44472181 CAAAGGATGCAGAGAGAGGCCGG - Intergenic
1067462823 10:46470429-46470451 AAGTGGAAGGAGAGAGAGGTTGG - Intergenic
1067624371 10:47914208-47914230 AAGTGGAAGGAGAGAGAGGTTGG + Intergenic
1067813227 10:49447590-49447612 CTGAGGCAGGAGGCCGAGGCAGG + Intergenic
1069628323 10:69881596-69881618 CAGGGGCAGGAGAGCCAGGCTGG + Intronic
1069705796 10:70458536-70458558 CGGAGCAAGAAGACCGAGGCTGG + Intergenic
1069837683 10:71319462-71319484 GAGAGCAAGGAGAGAGAGGAGGG - Intronic
1069891513 10:71655396-71655418 AATAGGAAGGAGGGAGAGGCAGG - Intronic
1070155814 10:73834556-73834578 CAGAGGAAGGACAGAGAGGTAGG - Intronic
1070358027 10:75659339-75659361 GAGAGGAAAGGGAGGGAGGCAGG - Intronic
1070589858 10:77794160-77794182 CAGAGGAAGGAAAGAGGGCCTGG - Intronic
1070673728 10:78397514-78397536 CAGGGTATGGAGAGCCAGGCAGG + Intergenic
1070775581 10:79107976-79107998 GAGAGGAAGGACAGAAAGGCAGG - Intronic
1070837293 10:79457478-79457500 CTGTGGAAGGAGGGAGAGGCAGG - Intergenic
1071463792 10:85921781-85921803 CAGAGGAAGGGGACCCAGACTGG - Intronic
1071603407 10:86969897-86969919 CAGAGGAAGGAAGGCAGGGCAGG - Intronic
1072613046 10:97031681-97031703 CGGAGGAAGGAGATGGAGGAAGG + Intronic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1074454291 10:113583852-113583874 TTGAGGAAGGAGAGAGAGGTGGG - Intronic
1074496702 10:113985924-113985946 CAGAGGCAGGAGAGAGAGACAGG + Intergenic
1074509737 10:114101295-114101317 CAAAGGATGCAGAGCGAGGAGGG - Intergenic
1075123436 10:119681040-119681062 CAGAGGGCTGAGAGCGGGGCTGG + Intergenic
1076075076 10:127527181-127527203 CCCAGGAAGGAGAGAGAGACAGG + Intergenic
1076193784 10:128500632-128500654 CAGCGGGAGGGGAGCGAGGCAGG - Intergenic
1076194597 10:128508112-128508134 AGGAGGAAAGAGAGAGAGGCTGG + Intergenic
1076467082 10:130690350-130690372 CAGAGTGAGGAGAGCAAAGCCGG - Intergenic
1076612720 10:131736723-131736745 CAGAGGAGGGAGAGCCAGGATGG + Intergenic
1076736413 10:132461121-132461143 CAGAGGAAGGAAGGACAGGCTGG + Intergenic
1076743825 10:132502640-132502662 CAGAGGAGGGAGAGCAAGGCTGG - Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076792616 10:132785266-132785288 CAGGTGAAGGTGAGCGCGGCGGG - Exonic
1077163220 11:1122934-1122956 GAGAGGAAGGAAAGAGAGGGAGG - Intergenic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077321927 11:1946640-1946662 CCGAGGATGGACAGCGTGGCTGG + Intergenic
1077530300 11:3091860-3091882 CAGAGGGTGCAGAGCGCGGCCGG - Intronic
1077724693 11:4662274-4662296 GAGAGGAAGGAGAGGGAGGGAGG - Intergenic
1078418101 11:11182421-11182443 CAGTGGGAAGAGAGCGAGCCGGG + Intergenic
1078840606 11:15073234-15073256 GACAGGAGGGAGTGCGAGGCAGG + Intronic
1078943228 11:16032859-16032881 CAAAGGAAGGACAGGCAGGCTGG - Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079050607 11:17154704-17154726 CAGAGGAAGAAAAGTGAGGAAGG + Intronic
1079601425 11:22316346-22316368 CAGGGGAGAGAGAGAGAGGCGGG - Intergenic
1079601533 11:22316748-22316770 CAGGGGAGAGAGAGAGAGGCAGG - Intergenic
1079930513 11:26554086-26554108 CAGGGGAAGGTCAGGGAGGCAGG - Intronic
1080042517 11:27774108-27774130 GAGAGGAAGGAGAGAGAGAAAGG + Intergenic
1080632748 11:34094262-34094284 CTGAGGCAGGAGGCCGAGGCAGG - Intronic
1080652740 11:34235570-34235592 CACAGGAAGGGGAGCGGGGGAGG + Intronic
1081560582 11:44211609-44211631 CAGAGGTTGGAGAGAAAGGCAGG + Intronic
1081683761 11:45027101-45027123 GAGAGGGAGGAGAGGGAGACAGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081810935 11:45913832-45913854 CATAGAAAGGAGAGCGCAGCAGG + Exonic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082011001 11:47449417-47449439 CGGGGGAAGGAGAGCGAGGCTGG + Intergenic
1083230148 11:61312154-61312176 CAGAGGAAGAAAAACAAGGCAGG + Intronic
1083270464 11:61569714-61569736 GAGAGGAAGGACAGGGAGGAAGG + Intronic
1083310394 11:61780841-61780863 GAGAGGGAGGGGAGGGAGGCAGG - Intronic
1083324743 11:61867494-61867516 CAGAGGCAGCAGGGAGAGGCGGG - Intergenic
1083616349 11:64028423-64028445 CAGAGGGAGGAGGGAGAGGGAGG + Intronic
1083722986 11:64612578-64612600 CAGAGGAAGGAGAGTTGGGGAGG - Intronic
1083864202 11:65444859-65444881 CAGAGAATGGAAGGCGAGGCAGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084171217 11:67401852-67401874 GGGCGGAAGGAGAGCCAGGCCGG - Intronic
1084195135 11:67520208-67520230 CAGAGGAGGGAGGGCCAGGGAGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084393408 11:68892696-68892718 GAGGAGAAGGGGAGCGAGGCTGG + Intronic
1084890958 11:72237039-72237061 CAGTGGAAGGAGAACTAGACGGG - Intronic
1085275440 11:75295701-75295723 CAAAGGAAAGAGAGCATGGCAGG - Intronic
1085341708 11:75735691-75735713 CAGAGGCCGGAGAGCCAGCCTGG + Intergenic
1085449383 11:76622844-76622866 CAGGGGAAGGCGGGAGAGGCAGG - Intergenic
1085522572 11:77146982-77147004 CGGAGTAAGGAGAGCTGGGCAGG + Intronic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1086733575 11:90278927-90278949 TTGAGAAAGAAGAGCGAGGCTGG - Intergenic
1087940185 11:104087305-104087327 CTGAGGCAGGAGGCCGAGGCAGG - Intronic
1088001614 11:104888715-104888737 GAGAGGCTGGAGAGTGAGGCAGG - Intergenic
1088174033 11:107030767-107030789 CAGAGGAAAGAGAGAAAGACAGG + Intergenic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1089176470 11:116552306-116552328 GGGAGGAAAGAGAGAGAGGCAGG + Intergenic
1089352463 11:117829252-117829274 CAAAGGAGGGACAGAGAGGCGGG - Intronic
1089363630 11:117907679-117907701 CAGAGGAAGGATAGCCAAGGTGG - Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089579214 11:119470995-119471017 CAGAGGAGGAAGAGCCAGGGAGG - Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090428529 11:126627287-126627309 ATGAGGAAGGAGACAGAGGCTGG + Intronic
1090436886 11:126694465-126694487 CAGAGGAAGCAGGGCGAGCGTGG + Intronic
1090785616 11:130044780-130044802 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1090908205 11:131095842-131095864 ACGAGGAAGGAGAGTGAGGAGGG - Intergenic
1091094759 11:132810143-132810165 CAGAAGACGGAGGGAGAGGCTGG - Intronic
1202804943 11_KI270721v1_random:1953-1975 CCGAGGATGGACAGCGTGGCTGG + Intergenic
1091650476 12:2305388-2305410 CAGGGGAAGGAGCACCAGGCTGG - Intronic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1091919988 12:4296304-4296326 GTGAGGAAGGAGAGCAAGGCAGG + Intronic
1091978203 12:4843735-4843757 CAGAAGCAAGAGAGCGAGGTGGG + Intronic
1092164330 12:6333705-6333727 CACAGGCAGGAGAGTCAGGCGGG - Intronic
1092204878 12:6608566-6608588 CAGAGCAGGGAGGGCCAGGCAGG + Intergenic
1092231586 12:6778558-6778580 AAGGGGAAGGTGAGGGAGGCTGG - Intergenic
1092453386 12:8624453-8624475 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1092785068 12:12019084-12019106 CAGAGGAATGAGATCGAGTTTGG - Intergenic
1092910759 12:13142945-13142967 CAAAGGAAGAGGAGAGAGGCTGG - Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1095955331 12:47802672-47802694 CAGAGGTGGGAGAGCCTGGCTGG + Intronic
1096252917 12:50044796-50044818 TAGAGGTAGGAGATGGAGGCCGG - Intergenic
1096556526 12:52407284-52407306 AGGAGGAAAGAGAGTGAGGCGGG - Intergenic
1096655834 12:53091583-53091605 CAGAGGAAGGAGAGCTGGAAAGG - Intergenic
1096864686 12:54555449-54555471 CAGAGGAAGGCGAAAGAGGTTGG + Intronic
1096948436 12:55436915-55436937 CATGGGAAGGAGAGAGTGGCAGG - Intergenic
1097225513 12:57474974-57474996 CTGGGGAAGTAGAGTGAGGCGGG + Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097973092 12:65656069-65656091 CAGAGAAAGGAATTCGAGGCAGG - Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098460794 12:70731024-70731046 GAGAGGAAGGAGAGAGAGGAAGG + Intronic
1098460806 12:70731089-70731111 AGGAGGAAGGAGAGAGAGGAAGG + Intronic
1099301476 12:80900011-80900033 TAGAGGAGGGAGGCCGAGGCGGG - Intronic
1099650194 12:85416861-85416883 CAGAGGGAGAAGAGAGATGCAGG + Intergenic
1100257070 12:92895265-92895287 CTGAGGCAGGAGACTGAGGCGGG - Intronic
1100326367 12:93543492-93543514 CAGAGGTGGAAGAGCAAGGCTGG - Intergenic
1100391417 12:94148810-94148832 CCCAGGAAGGAGAGCGGGGAGGG - Exonic
1101856531 12:108448161-108448183 AAGAGCAAGGAGTGGGAGGCAGG - Intergenic
1101900707 12:108789317-108789339 CAGGGAAAGGGGTGCGAGGCCGG + Intronic
1102625740 12:114234208-114234230 CAGAGGAAGGAGACCCACGAAGG - Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103003994 12:117407444-117407466 CAGAGGAGGGAGAGGCAGGTGGG - Intronic
1103200347 12:119082975-119082997 CATAGGAAGGAAAGCGGGGAAGG + Intronic
1103219468 12:119231861-119231883 AGGAGGAAGGAGGGAGAGGCAGG - Intergenic
1103392747 12:120586004-120586026 CTGAGGAAGGAGAGCGCAACTGG + Intergenic
1103932564 12:124458315-124458337 CAGAGAGAGGAGGGCGTGGCAGG + Intronic
1103975940 12:124702729-124702751 GAGAGGAAGGAAAGCAAGGGAGG + Intergenic
1104411489 12:128561935-128561957 GGGAGGATGGAGAGCGAGGGAGG + Intronic
1104982328 12:132579047-132579069 CAGAGGAGGGAAGGGGAGGCGGG - Intronic
1105287220 13:19014227-19014249 GTGAGGATGGAGAGAGAGGCAGG - Intergenic
1105592849 13:21810653-21810675 CAGAAGAAGGAGAGACAGCCAGG + Intergenic
1106036845 13:26051519-26051541 CAGAGGAGGCTGAGCGCGGCCGG - Intergenic
1106065469 13:26344039-26344061 CAGAGGAGGGAGGGTGAGGTTGG - Intronic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108950230 13:56083464-56083486 CAGAGGAAGAAGAGAAAGACAGG + Intergenic
1109261031 13:60145179-60145201 GAAAGGAAGGAGAGTGAGGCTGG - Intronic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111942495 13:94625515-94625537 CAGAGGAGGGGGAGCTGGGCAGG - Intronic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1112386629 13:98946081-98946103 CAGCGGATGGTGAGAGAGGCGGG + Intronic
1112461384 13:99606529-99606551 GGGAGGAAGGAGGGCGTGGCTGG + Intergenic
1112692930 13:101916749-101916771 CAGAGGAGGGGGTGCCAGGCGGG + Intronic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113426571 13:110213379-110213401 GAGAGGAGGAAGAGCAAGGCTGG + Intronic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113843531 13:113373437-113373459 CAGAGGGAGAAGAGCCAGGGAGG - Intergenic
1114578571 14:23736133-23736155 CAGAGGAAGGAGGGAGAGCAAGG + Intergenic
1114635129 14:24182962-24182984 CAGAGGAAGGTGAGCAGGGCAGG - Exonic
1114898580 14:27026488-27026510 CAGAGGAAGGAGAGAGAGAGCGG - Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115547306 14:34475558-34475580 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1115641299 14:35337175-35337197 CTGAGGAGGGAGGGCGAGGCAGG + Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116739498 14:48736144-48736166 CAGGAGAAGGAGAGCAAGGTGGG + Intergenic
1117450839 14:55848277-55848299 GAGAGGAAGGAGATAGAGACTGG - Intergenic
1118019414 14:61695677-61695699 CAGAGGTGGGGGTGCGAGGCGGG - Intronic
1118347884 14:64952808-64952830 CAGAGGAGGGAGAGTGAATCTGG + Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1119104298 14:71909603-71909625 GAGAGAAAGGAGAGAGAGGGGGG + Intergenic
1119680731 14:76590621-76590643 CCGAGGCAGGAGGCCGAGGCAGG - Intergenic
1119853030 14:77879541-77879563 CAGAGGGAGGAGGGTGGGGCAGG + Intronic
1120502200 14:85310696-85310718 GAGAGAGAGGAGAGTGAGGCAGG + Intergenic
1120715734 14:87838952-87838974 TAGAGGAAAGAGAGTGAAGCAGG - Intronic
1120866502 14:89299732-89299754 CAAAGGAAGGAGGGAGTGGCTGG - Intronic
1120964205 14:90153166-90153188 CAGGGGAAGGAGAGTCAGGGAGG - Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121220479 14:92281203-92281225 CAGAGGCTGGAGAGCAGGGCAGG - Intergenic
1121437678 14:93929746-93929768 CAAAGGAAGGAGGGTGAGGAGGG + Intergenic
1121811394 14:96894216-96894238 GTGAGGAAGGAGTGCCAGGCAGG + Intronic
1122034271 14:98936071-98936093 TAGAGGATGGAGAACAAGGCTGG + Intergenic
1122113093 14:99515138-99515160 CAGAGGAAGAAGACAGGGGCTGG + Exonic
1122126261 14:99580166-99580188 CAGAGGAAGGAGAGGCTGGGTGG + Intronic
1122212150 14:100180385-100180407 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1122238058 14:100344179-100344201 CTGAGGCAGGAGAATGAGGCAGG - Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122295054 14:100700812-100700834 CATAGCAAGTAGAGGGAGGCTGG + Intergenic
1122624653 14:103078195-103078217 CAGAGGAAGGGGAGGAAGGGAGG + Intergenic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1122781140 14:104144039-104144061 CAGAGGCTGCACAGCGAGGCTGG - Intronic
1122913355 14:104844409-104844431 CAGAGGAAGCAGGGCCCGGCTGG - Intergenic
1123008484 14:105335785-105335807 CAGAGAAAGCTGAGTGAGGCTGG + Intronic
1123973168 15:25528068-25528090 CAGTGGAAGGACAGTGATGCTGG + Intergenic
1124100837 15:26691145-26691167 CAGAGCAGGGAGAGCAAGACTGG - Intronic
1124427141 15:29571221-29571243 CTGCGGAAGGAGAGCGGGGGCGG + Intergenic
1125447762 15:39776183-39776205 CGGAGGGAGGAGAGAGAGGGAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126336146 15:47588231-47588253 CAGAGGAAGGATAGTGGGGCAGG - Intronic
1126753028 15:51896716-51896738 CATAGGAAGGAGGGGGAAGCTGG - Intronic
1126836258 15:52669015-52669037 CTGAGGCAGGACAGTGAGGCAGG - Intronic
1127114090 15:55706781-55706803 GAGGAGAGGGAGAGCGAGGCAGG + Intronic
1127119227 15:55757035-55757057 CAGAGGAAGAACAGGGAGGAAGG + Intergenic
1127526133 15:59793248-59793270 GAGAGGAGAGAGAGAGAGGCAGG + Intergenic
1127736159 15:61840837-61840859 CAAAGGAAGGAAAGGGAGGGAGG - Intergenic
1128029588 15:64468193-64468215 GAGAGGAAGGGGAGGGAGGGAGG - Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128237318 15:66077155-66077177 CAGAGGAGTGGGAGCCAGGCTGG - Intronic
1128389820 15:67175303-67175325 CAGTGGCAGGAGTGAGAGGCAGG + Intronic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128683134 15:69665908-69665930 CAGTGGGAGGAGAGAGGGGCTGG + Intergenic
1129118242 15:73378354-73378376 GAGAGGGAGGTGAGTGAGGCTGG + Intergenic
1129177180 15:73848426-73848448 CAGAGCATGGAGATCAAGGCAGG - Intergenic
1129229176 15:74187227-74187249 CAGTGGAGGGAGAGAGAGGTAGG - Intronic
1129624151 15:77179292-77179314 GAGAAGAAGTAGAGCGTGGCGGG + Exonic
1129695273 15:77737432-77737454 GGGAGGAAGGAGAGGGAGGAAGG + Intronic
1129698002 15:77751605-77751627 CAGAGGAGGGAGGGCCAGGATGG - Intronic
1129964969 15:79726370-79726392 GAGAGAAAAGAGACCGAGGCAGG - Intergenic
1130415538 15:83691290-83691312 CAGCGGAAGGAAAGCCAGGCAGG - Intronic
1130428522 15:83823095-83823117 CTGAGGCAGGAGAATGAGGCAGG + Intronic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1132822866 16:1885407-1885429 CAGAGGAAGGGGAGTGAGGGGGG + Intergenic
1132921975 16:2400662-2400684 CTGAGGCAGGAGAACCAGGCAGG + Intergenic
1132929894 16:2453725-2453747 CTGAGGAAGGAGACCTGGGCTGG - Intronic
1133431674 16:5742353-5742375 GAGAGGAAGGAGAGGAAGGAAGG - Intergenic
1133547878 16:6825708-6825730 AAGAGGAAAGGGAGGGAGGCAGG + Intronic
1133816885 16:9204288-9204310 CTGATGAAGGGGAGCCAGGCAGG - Intergenic
1134449215 16:14353725-14353747 CAGGGGAAGGTGGGGGAGGCAGG + Intergenic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135676695 16:24421185-24421207 CAGAAGCAAGAGAGCGAGGCTGG - Intergenic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1135821222 16:25688288-25688310 CAGGAGCAAGAGAGCGAGGCAGG - Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136019321 16:27430019-27430041 CAGTGGAGGGTGAGCCAGGCGGG - Intronic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136165026 16:28448056-28448078 CTGAGGCAGGAGAATGAGGCAGG - Intergenic
1136197939 16:28666924-28666946 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136208057 16:28738437-28738459 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136214286 16:28781101-28781123 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136259006 16:29060946-29060968 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136987621 16:35125309-35125331 CAGAGGAAGGAAGGCAGGGCTGG - Intergenic
1137463724 16:48689233-48689255 CAGAGGGAGGACAGTTAGGCAGG - Intergenic
1137530926 16:49278354-49278376 CGCAGGAAGGAGCGCAAGGCCGG + Exonic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137684251 16:50374784-50374806 CTGAGGAGGGGGAGGGAGGCAGG + Intergenic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138455037 16:57116210-57116232 CCAAGGCAGGAGAGCCAGGCAGG - Intronic
1138595883 16:58028712-58028734 GAGAGGAAGTGGAGAGAGGCTGG - Intronic
1138925145 16:61581562-61581584 CATGGGAAGGAGGTCGAGGCGGG - Intergenic
1139274657 16:65716363-65716385 GAGAGGAAGGAAGGAGAGGCAGG + Intergenic
1139381855 16:66537444-66537466 CAGAGGCAGGAAACGGAGGCAGG - Intronic
1139558866 16:67729254-67729276 AGGAGGAAGCAGAGCAAGGCAGG + Intronic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1140044705 16:71432700-71432722 GAGAGGAAGAAGAGTAAGGCTGG + Intergenic
1140123387 16:72101808-72101830 CAGAGGAAGCAGTGTGAGGGAGG - Intronic
1140400322 16:74666069-74666091 AAGAGGAGGGAGAGGGAGACGGG + Intronic
1140782303 16:78307801-78307823 AAGAGTAAGGAGAGCAAGGAGGG - Intronic
1141195957 16:81861510-81861532 AAGAGGACGGAGAGAAAGGCAGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141428916 16:83960868-83960890 TAGAGGGAGGAGGGAGAGGCAGG - Intronic
1141470760 16:84236887-84236909 CAGCGCGAGGAGTGCGAGGCGGG + Exonic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1141920462 16:87132376-87132398 CGGAGGAAAGAGAGCAAGGCAGG - Intronic
1142252650 16:88999715-88999737 CAGAGGGAGGAGGGGGGGGCGGG + Intergenic
1142278666 16:89136711-89136733 CAGAGGCAGGTGGGGGAGGCAGG - Intronic
1142586825 17:979305-979327 CACAGGAAGGTGAGCGGCGCGGG - Exonic
1142670465 17:1485540-1485562 CAGGGGGAGGAGGCCGAGGCGGG - Intronic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143411284 17:6710985-6711007 CAGAGGAAGGATAGAGAGAGTGG + Intronic
1143711756 17:8740603-8740625 CAGAGGTAGGAGAGAGAGGGAGG + Intronic
1143785305 17:9251253-9251275 CAGAGGAGGCAGGGCGGGGCTGG - Intronic
1143973840 17:10815489-10815511 CAGATGAAAGGGAGCGGGGCTGG - Intergenic
1144457619 17:15432066-15432088 CAGAGGTAGGATGGTGAGGCTGG - Intergenic
1144624558 17:16838152-16838174 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1144727830 17:17510801-17510823 CAGCGTAAGGAGAGCCAGGATGG - Intronic
1144881870 17:18434569-18434591 CAGAGGGAGCAGAGCCAGGCAGG + Intergenic
1145026936 17:19475455-19475477 CTGAGGAAGGAGAATCAGGCAGG - Intergenic
1145150363 17:20509817-20509839 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1145251359 17:21298537-21298559 CAATGGAAGGAGTGAGAGGCAGG + Intronic
1145269973 17:21399614-21399636 CAAAGGAATGGGAGAGAGGCAGG + Intronic
1145684087 17:26637637-26637659 CTGAGGCAGGAGAGTCAGGCAGG - Intergenic
1145822552 17:27850722-27850744 CTGTGGAAGGAGAGTGATGCTGG + Intronic
1146003260 17:29144315-29144337 CAAATGACGGAGAGCCAGGCTGG - Intronic
1146065031 17:29627939-29627961 GAGAGGAGAGAGAGAGAGGCAGG + Exonic
1146162294 17:30566459-30566481 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1146651083 17:34606813-34606835 CAGAGGAAGTGCAGCCAGGCAGG - Intronic
1146747462 17:35345230-35345252 CTGGGTAAGGAGAGTGAGGCAGG - Intergenic
1146921835 17:36718364-36718386 CAGAGCAGGAAGAGCGAGGTTGG - Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147133637 17:38422935-38422957 CAGAGAAAGGAGGGAGAGGGTGG - Intergenic
1147526590 17:41230404-41230426 AAGAGGAAGGAGAGAGAAGAAGG + Intronic
1147578692 17:41616873-41616895 CAGAGGGAACAGAGCCAGGCAGG - Intergenic
1148069845 17:44902334-44902356 CAAAGGAAGGAAAGGGAGTCAGG - Intronic
1148247155 17:46040344-46040366 CAGAGGAAGGAAAGAGAGAATGG - Intronic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148486478 17:47994337-47994359 CAACGGAAGGCGAGGGAGGCTGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148806539 17:50266773-50266795 GGGAGGCAGGAGAGCCAGGCAGG + Intergenic
1148872973 17:50669258-50669280 CACATGAAGGTGAGAGAGGCAGG + Exonic
1149360463 17:55889617-55889639 AAGAGGAAGAAGAGGGAAGCTGG - Intergenic
1149583572 17:57768701-57768723 CAGGGGAAGGAGAGTGGGGTGGG + Intergenic
1149663734 17:58351675-58351697 GAGAGGAAGGAGTGGGAGGGTGG - Intronic
1149667966 17:58379308-58379330 GAGAGGAAGGAAGCCGAGGCTGG - Intronic
1150010021 17:61494785-61494807 CAGCGGCAGGAGAGTGACGCTGG + Intergenic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1150947601 17:69765371-69765393 CAGAGGAAGGAGGGGAAGGGAGG - Intergenic
1150974105 17:70064494-70064516 CTGAGGCAGGAGACTGAGGCAGG - Intronic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151331341 17:73411046-73411068 CAGAGGAAGGAAGGGGAGGCCGG - Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151443048 17:74145958-74145980 GGGAGGAAGGAGAGTGAAGCTGG - Intergenic
1151724892 17:75878112-75878134 GAGAGGCAGGACAGCGCGGCGGG + Exonic
1151974924 17:77479387-77479409 GCCAGGTAGGAGAGCGAGGCGGG + Intronic
1152105043 17:78323923-78323945 CACAGGAAGGAGAGAGAAGAGGG - Intergenic
1152157995 17:78647549-78647571 CATAGAGAGGAGAGAGAGGCAGG + Intergenic
1152307477 17:79529723-79529745 CAGAGGAAGGAGGGAGAGTGAGG + Intergenic
1152320794 17:79608091-79608113 CAGAGGAGGGAGGGCGAGGAGGG + Intergenic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1152792536 17:82289395-82289417 CAGAGGAATGACAGCAAGGATGG + Intergenic
1153313798 18:3702580-3702602 GAGAGACAGGGGAGCGAGGCAGG + Intronic
1153318714 18:3750817-3750839 CAGAGGAAGGAGAGCATTCCAGG - Intronic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1154220515 18:12449554-12449576 CACAGAAAGGAGAGCCAGCCCGG + Exonic
1154356597 18:13626489-13626511 CAGCGGATGGAGGGAGAGGCAGG + Intronic
1154382674 18:13866876-13866898 CAGAGGAGGAAGAGCAAGCCTGG - Intergenic
1155209117 18:23586107-23586129 CACAGGAAAGAGAGCGTGGCCGG + Intronic
1155451043 18:25963077-25963099 CAGATGAACAAGAGAGAGGCAGG - Intergenic
1156183994 18:34640263-34640285 CAGAGGAGGGACAGGCAGGCAGG - Intronic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1156664023 18:39383495-39383517 CAGAGGAGGGAGAGCCCAGCGGG - Intergenic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157975826 18:52325622-52325644 CAGAGGGAGGAGAGAGAGTTAGG + Intergenic
1158032398 18:52982170-52982192 CAGAGGGAGGATAGAGGGGCAGG + Intronic
1158409084 18:57188509-57188531 CAGAGAAAGGAGAGCGAGAGAGG + Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158495285 18:57949708-57949730 CAGAGGGAGGAAAGAAAGGCGGG + Intergenic
1158757324 18:60341626-60341648 CTGAGGAAAGGGAGAGAGGCTGG - Intergenic
1159134265 18:64318638-64318660 GAGAGGAAGGAGAAAGAGGGAGG - Intergenic
1160011519 18:75110061-75110083 GGGAGGAGGGAGAGGGAGGCTGG + Intergenic
1160263884 18:77321907-77321929 CAGAGGATGGAGGGCAGGGCTGG - Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160573187 18:79832292-79832314 CTGAGGAAGGACAGTGAGGATGG - Intergenic
1160604809 18:80042020-80042042 AAGAGGCAGGAGTGAGAGGCCGG - Intronic
1161013852 19:1973504-1973526 CCCAGGAATGAGAGCAAGGCTGG - Intronic
1161085816 19:2334389-2334411 CTGAGGAAGGTGAGCCAGTCTGG + Intronic
1161405692 19:4090090-4090112 AAAAGGAAGGAGAGTGAGGCTGG - Intergenic
1161479226 19:4502375-4502397 CAGTGGCAGGAGAGCTGGGCGGG + Exonic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161594020 19:5142159-5142181 CCGAGGAAGGACACCGAGCCGGG + Intronic
1161706582 19:5825004-5825026 CGGTGGGAGGAGAGAGAGGCTGG + Intronic
1161931295 19:7342145-7342167 CAGAGGATGAGGAGGGAGGCTGG + Intergenic
1162164996 19:8746450-8746472 CAGAGGCGGGAGGCCGAGGCAGG + Intergenic
1162393078 19:10401404-10401426 CAGAGGGAGGAGGGTGTGGCAGG + Intronic
1162602276 19:11677775-11677797 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1162662495 19:12181333-12181355 CAGATCAAGGAGAGTTAGGCCGG - Intronic
1162909598 19:13842069-13842091 CATAGGAAGGAAAGCCAGGTTGG - Intergenic
1163024636 19:14503444-14503466 AAAAGGAAGGAGAGAGAGGAAGG - Intergenic
1163314013 19:16530679-16530701 CGGTGGGAGGAGAGAGAGGCCGG + Intronic
1163565051 19:18046228-18046250 CAGAGGAGGGAGAGAGAGTGTGG + Intergenic
1163606667 19:18279659-18279681 CAGAGGGAGGAGAGAAAGGCGGG + Intergenic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1163783573 19:19262853-19262875 AGGAGGAAGGCGGGCGAGGCGGG + Intergenic
1164231343 19:23290707-23290729 CTGAGGCAGGAGAATGAGGCAGG + Intergenic
1164301009 19:23963500-23963522 CTGAGGCAGGAGAACGAGGCAGG - Intergenic
1164570311 19:29369896-29369918 CAGAGGTAGGAAAGGAAGGCAGG + Intergenic
1164683348 19:30150529-30150551 CAGATGAAAGAAAGCGTGGCAGG + Intergenic
1164820111 19:31243529-31243551 CAGAGGGAGGTGAGCCCGGCAGG + Intergenic
1164953119 19:32355753-32355775 CACAGGAGGGAGGCCGAGGCGGG + Intronic
1165168660 19:33875154-33875176 CAGAGAAAGAAGGCCGAGGCAGG - Intergenic
1165369946 19:35398777-35398799 CAGAGGAAGGAAGGCGGCGCAGG - Intergenic
1165374733 19:35433756-35433778 CAGAGGCAGCAGAGCCAGCCTGG + Intergenic
1165760150 19:38316152-38316174 GAGTGGCAGGAGGGCGAGGCCGG + Intronic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166982339 19:46638789-46638811 CACAGGGAGGAGGGCCAGGCGGG + Intergenic
1167149121 19:47698888-47698910 CGCAGGAAGGAGGGCGGGGCAGG - Intronic
1167169802 19:47823545-47823567 CAGAGGCTGCAGAGAGAGGCTGG + Intronic
1167249172 19:48391549-48391571 AAGAGGGAGGAGAGCGAGAGGGG + Exonic
1167529098 19:50003835-50003857 CAGTGCAGGGAGAGCGGGGCTGG - Intronic
1167859359 19:52270443-52270465 CAGATGAAGGACAGCAAGGTAGG + Intronic
1168075647 19:53979823-53979845 AAAAGGAGGGAGAGCGAGGGCGG - Intronic
1168078149 19:53991705-53991727 CCGAGGCAGGAGAGCGAGAGGGG + Intergenic
1168287382 19:55341369-55341391 CAGGGGGCGGAGACCGAGGCTGG + Intronic
1168327431 19:55545440-55545462 GAAAAGAAGGAGAGAGAGGCAGG - Intronic
1168357776 19:55713069-55713091 CAGAGAAAAGAGAGCCAGGCAGG - Intronic
1168414659 19:56160509-56160531 TGGAGGAGGGAGAGGGAGGCTGG - Exonic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
925407734 2:3616658-3616680 CTGAGGCAGGAGAACCAGGCAGG + Intronic
925902055 2:8515836-8515858 GGGAGGAAGGAGAGGGAGGAGGG - Intergenic
926053771 2:9761706-9761728 CAGAGGCAGGAAAGGGAGGGCGG - Intergenic
926113580 2:10197330-10197352 AAGAGCCAGGAGAGCCAGGCAGG - Intronic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926420630 2:12693350-12693372 CAGAGGAAGAGGAGCAAGTCAGG - Intergenic
927062203 2:19434161-19434183 CAGAGGCATGAGAGTGAGGGGGG - Intergenic
927282517 2:21321861-21321883 CAGAGGATGGAGAGGCAGGGTGG - Intergenic
927311755 2:21639451-21639473 CAGAAGCAAGAGAGAGAGGCGGG + Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927515137 2:23667867-23667889 CAGAGGGAGGACGGCGGGGCTGG - Intronic
927591234 2:24360092-24360114 CAGAGGAAGGAACCCGGGGCCGG + Intronic
927962711 2:27250706-27250728 GAGTGGAGGGAGAGAGAGGCAGG - Intergenic
928096143 2:28406356-28406378 AAGAGAATGGAGAGCGTGGCCGG - Intronic
928097524 2:28413565-28413587 GAGAGGCAGGGGAGGGAGGCGGG + Exonic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929427346 2:41856684-41856706 CAGACGCAGTAGAGAGAGGCAGG - Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930257219 2:49106138-49106160 CTCAGGAAGGAGAGATAGGCAGG - Intronic
931434463 2:62234971-62234993 CAGGGGCAGGAGAGCCAGGGCGG + Intergenic
931668366 2:64625903-64625925 GAGAGGAAGGAGAGAGAGGATGG + Intergenic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932556518 2:72829634-72829656 CACAGGATGGGGAGCGGGGCAGG - Intergenic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
934047332 2:88183591-88183613 GGGAAGAAGGAGAGCGAGGGAGG - Intronic
934604331 2:95682707-95682729 CAGAGGGAGTAGCGCGAGGGAGG - Intergenic
934793009 2:97078907-97078929 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
934813178 2:97301578-97301600 CAGAGGATGGAGGGTGAGGAGGG + Intergenic
934824517 2:97406902-97406924 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935874791 2:107494749-107494771 CAGAGGAAAGAAAGAGAGGAAGG + Intergenic
935902871 2:107811274-107811296 CTGGGGAGGGAGAGAGAGGCAGG - Intergenic
936012920 2:108936518-108936540 TGGAGGAAGGAGAGCGTGGGAGG - Intronic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936980196 2:118256705-118256727 CAGTGGGAGGTGAGCAAGGCTGG + Intergenic
937073464 2:119083563-119083585 GGGAGGAAGGAGGGCCAGGCAGG - Intergenic
938120725 2:128631354-128631376 CTCAGGAAGGAGAGTGGGGCAGG + Intergenic
938145723 2:128833514-128833536 CAGAGGAAGGCGTGGGAGGAGGG + Intergenic
938181252 2:129187153-129187175 CAGAGGAACAAGACTGAGGCTGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
939589459 2:144045789-144045811 GAGAGGAAGGAGGTCAAGGCTGG + Intronic
939708263 2:145481760-145481782 GAGAGGAAGGAGAGAAAGACAGG - Intergenic
940135014 2:150425797-150425819 CAGAGGAAGGAAACTGGGGCAGG - Intergenic
940298989 2:152159825-152159847 CTGAGGCAGGAGAATGAGGCAGG - Intronic
941204146 2:162550418-162550440 GAGAGGAAGGAGAGCCATGTTGG + Intronic
943635409 2:190301469-190301491 CAGAGGAGGGAGAGGGAGTTGGG + Intronic
944115433 2:196180872-196180894 CATAGAAAGGAGATCCAGGCTGG - Intergenic
944340434 2:198589987-198590009 TAGAGGAAACCGAGCGAGGCTGG + Intergenic
945285174 2:208074924-208074946 CACAGGAAGCACAGAGAGGCGGG - Intergenic
945314733 2:208359822-208359844 CAGGGGAAGGCGAGGGTGGCTGG + Intronic
946427421 2:219606677-219606699 GACAGGAAGGAGAGAGAGGTTGG - Intronic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946669672 2:222089362-222089384 CAGAGGATGGAGAGAGAGCCCGG - Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947772523 2:232681922-232681944 CAGAGGCAGGAGACAGAGGTGGG - Exonic
947847213 2:233254301-233254323 AAGAGGCAGGAGAGTGAGACAGG + Intronic
948121068 2:235530860-235530882 CAGAGGAAGGACACTGAGGTGGG - Intronic
948197844 2:236108353-236108375 CAGAGGAAGGAGAGAAAAGAGGG - Intronic
948288239 2:236803852-236803874 CAGAGGTCAGAGAGAGAGGCAGG + Intergenic
948342239 2:237263086-237263108 AAGAGGAAGAAGCGAGAGGCGGG - Intergenic
948486318 2:238283544-238283566 CTGAGGAAGGTGCACGAGGCTGG + Intronic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
1169557832 20:6768507-6768529 CAGGGGGAGGAGTGCGGGGCAGG - Exonic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1170338872 20:15301071-15301093 CAGAGGAAGGACAGCGAGCAAGG + Intronic
1170500278 20:16968504-16968526 CAGATGCAGGTGAGTGAGGCAGG - Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170819712 20:19746566-19746588 TAGAGAAAGAAGAGGGAGGCTGG + Intergenic
1171109119 20:22464315-22464337 CCCAGGAAGGGGAGGGAGGCTGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171377397 20:24702836-24702858 CCAGGGAAGGAAAGCGAGGCAGG + Intergenic
1171437718 20:25136010-25136032 CAGAGGGAGCAGACCGAGCCAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172011113 20:31846468-31846490 GAGAGAGAGGAGAGAGAGGCAGG + Intergenic
1172279797 20:33700873-33700895 CTGAGGCAGGAGAACCAGGCAGG - Intergenic
1172303485 20:33865613-33865635 CTCAGGCAGGAGAGTGAGGCTGG - Intergenic
1172442334 20:34974737-34974759 CAGAGGCTGGAGAGCTGGGCTGG - Intergenic
1172446463 20:34995986-34996008 CACAGGAGGGAAAGTGAGGCAGG + Intronic
1172735671 20:37125316-37125338 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1172777139 20:37414428-37414450 TGGGGGAAGGAGAGCGAGGGGGG - Intergenic
1172780659 20:37435148-37435170 CATGGGAAGTAGAGCGAGGTGGG - Intergenic
1173142206 20:40494337-40494359 CAGAGGAATGAAAGGGAGGGAGG - Intergenic
1173656056 20:44701043-44701065 CAAAGAAAGGAGTGAGAGGCTGG - Intergenic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1173905581 20:46626301-46626323 GAGAGGAAGAAGAGAGAGGGAGG - Intronic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1174359358 20:50018130-50018152 GACAGGAAGGAGAGTGAGGAAGG - Intergenic
1174404084 20:50292590-50292612 AAGAGGCAGGAGATGGAGGCTGG - Intergenic
1174886662 20:54343103-54343125 GAGAGAAAGGAGAGCGAAGAAGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175306750 20:57981485-57981507 CAGGGCAAGGTGAGTGAGGCGGG + Intergenic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175393985 20:58646109-58646131 CCTAGGAAGGAGAGCAAAGCAGG + Intergenic
1175748054 20:61475454-61475476 GAGAGGAGGGAGAGAGAGGGGGG - Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175887959 20:62302992-62303014 CCGAGGAGGAAGAGCGAGCCCGG + Exonic
1175912706 20:62412445-62412467 CAGAGGAGGGCGAGGGTGGCCGG - Intronic
1175921330 20:62451784-62451806 GAGAGGAGGGAGAGAGAGGGAGG + Intergenic
1176041921 20:63070226-63070248 CAGGGGAAGAACAGAGAGGCTGG - Intergenic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1177542689 21:22516270-22516292 CAGAGGAAAGAGTTAGAGGCTGG + Intergenic
1177645089 21:23891009-23891031 AGGAGGAAGGAGAGCCAGTCCGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1177899269 21:26893842-26893864 AAGAGGAAGGAGACCAAGGAAGG - Intergenic
1178308431 21:31509634-31509656 CACAGAGAGGAGAGAGAGGCAGG + Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178865294 21:36321724-36321746 GAGAGGAAGGAGAGAGAAGTGGG - Intronic
1179294869 21:40052795-40052817 CACTTGAAGGTGAGCGAGGCAGG + Intronic
1179477842 21:41659376-41659398 GCCAGGAAGGAGAGGGAGGCAGG + Intergenic
1179674823 21:42974410-42974432 CTGGGGGAGGAGAGCGAGGGCGG - Intergenic
1179885727 21:44313532-44313554 CAGTGGATGGAGAGGCAGGCAGG - Intronic
1179896105 21:44364604-44364626 GGGAGGAAGGAGAGGGATGCAGG + Intronic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1180039336 21:45268090-45268112 CTGAGGCAGGAGAACCAGGCAGG - Intronic
1180191625 21:46168173-46168195 TGGAGGGAGGAGAGCCAGGCTGG - Intronic
1180217973 21:46338299-46338321 CTGGGGAAGGAGAGAGCGGCTGG - Intronic
1181473274 22:23153665-23153687 AAGTGGAAGGAAAGTGAGGCTGG - Intronic
1181817287 22:25448110-25448132 GAGAAGAAGGAAAGCGGGGCCGG + Intergenic
1181844731 22:25698088-25698110 GGGAGGAAGGAGAGGGAGGGAGG + Intronic
1181844741 22:25698124-25698146 AGGAGGAAGGAGAGGGAGGAAGG + Intronic
1182763692 22:32743434-32743456 CAGAGGAAGGAAAGAAAGGTTGG + Intronic
1183068111 22:35377635-35377657 CAGAGGACAGAGAGAGAGACTGG - Intergenic
1183499801 22:38171993-38172015 CAGAGCAAGGAGAGAGAACCTGG - Intronic
1183731152 22:39619284-39619306 CAGAGAAAGGAGAGAGAGTGAGG - Intronic
1184174350 22:42778865-42778887 CTGAGGCAGGAGACTGAGGCAGG - Intergenic
1184268834 22:43365937-43365959 CAGACCATGGAGAGAGAGGCTGG + Intergenic
1184379581 22:44136668-44136690 CAGAGGGAGGAGAGCTGGGGTGG - Intronic
1184959319 22:47917740-47917762 GGGAGGAAGGAGAGGGAGGGAGG - Intergenic
1185006033 22:48277460-48277482 CAGAAGAAGGTGGGAGAGGCTGG + Intergenic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185098545 22:48825252-48825274 CAGAGAAGGGAGTGAGAGGCAGG + Intronic
1185101472 22:48843166-48843188 CGGAGGAAGGAGGGATAGGCAGG + Intronic
1185183972 22:49381607-49381629 CAGAGGAAGCAGAGCCAGGCAGG - Intergenic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
950457542 3:13101616-13101638 GAGAGGAAGGGGAGTCAGGCTGG + Intergenic
950630119 3:14276686-14276708 AGGAGGAAGGAGGGCGCGGCCGG + Intergenic
951719173 3:25679715-25679737 CAGAGGAGGGGGAGAGAGGAGGG + Intergenic
952237504 3:31495216-31495238 CTTGGGAATGAGAGCGAGGCAGG - Intergenic
953127491 3:40105763-40105785 CAGAGAGAGAAGAGTGAGGCAGG + Intronic
953657579 3:44865743-44865765 AGGAGGCAGGAGAGTGAGGCAGG + Intronic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
954390216 3:50264749-50264771 CAGAGGAGGGAGGGAGAGGGAGG + Intergenic
954457400 3:50607351-50607373 CAGAGGATGGGGAGACAGGCAGG - Exonic
954762759 3:52888926-52888948 ACGAGGAAGGAGGGAGAGGCTGG - Intronic
954802112 3:53193421-53193443 CTGGGGAAGGAGAGACAGGCAGG + Intergenic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
956604934 3:71064777-71064799 CGGGGGAAGGAGAGCGAAACCGG + Intronic
956659684 3:71584563-71584585 CAGTTGAAGGAGAGCGGGGTGGG + Intergenic
958462541 3:94418067-94418089 CAGAGGAAGGACAGAGACCCTGG + Intergenic
958616059 3:96494445-96494467 CAGAGGGAGGACACAGAGGCAGG - Intergenic
959021760 3:101195231-101195253 CAGAAGAAAGAGAGTGAAGCGGG + Intergenic
959095525 3:101951364-101951386 CAGGGGTAGGGGAGCGGGGCAGG + Intergenic
959626315 3:108456119-108456141 AAGAGGAAAGAGAGGGAGGGAGG + Intronic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
960119327 3:113931224-113931246 CAGAGGATGGTGATAGAGGCAGG + Intronic
960245405 3:115394702-115394724 TATAGGATGGAGAGGGAGGCAGG - Intergenic
960551785 3:118984064-118984086 AAGAGGAAGGAGAGCTGGGTAGG - Intronic
960583444 3:119299973-119299995 CAAAGGATGAAGAGTGAGGCAGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961561637 3:127734290-127734312 AAGAGGAATGCCAGCGAGGCCGG + Intronic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
962181306 3:133208784-133208806 CAGAGGTAAGACAGTGAGGCAGG - Intronic
963214055 3:142724613-142724635 AAGAGGATGGAGAGGAAGGCAGG - Exonic
963963059 3:151331931-151331953 CGGAGGCAAGAGAGTGAGGCAGG - Intronic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965034502 3:163421006-163421028 TAGGGGGAGGAGAGAGAGGCTGG - Intergenic
965373931 3:167897707-167897729 GAGAGGGAGGGGAGGGAGGCAGG + Intergenic
965494730 3:169383888-169383910 CAGAGAGAGGAGTGCCAGGCAGG - Intronic
965991304 3:174821885-174821907 CAGAAGAAGGACAGCTAGGGAGG + Intronic
966313413 3:178619182-178619204 TAGGGGAAGGAGAGTGAGACTGG + Intronic
966818061 3:183905370-183905392 CAGAGCAAGGAGAGTGATGGAGG + Intergenic
966932452 3:184684739-184684761 AAGAGGTAGGAGAGCGGGGGAGG + Intronic
966934133 3:184694758-184694780 CGGAGGAGGGACAGTGAGGCTGG - Intergenic
966967077 3:185004379-185004401 CTGAGGCAGGAGAACCAGGCAGG + Intronic
967945114 3:194797974-194797996 GCGAGGAAGGAGAGGGAAGCAGG - Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968288174 3:197520173-197520195 GAGAGGGAGGAGAGGGAGACGGG + Intronic
968320017 3:197758147-197758169 CTGAGGCAGGAGGCCGAGGCAGG - Intronic
968780692 4:2578936-2578958 CAGAGGAGGTAGAGGAAGGCAGG + Intronic
968881311 4:3301595-3301617 CCGGGGATGGAGAGTGAGGCCGG + Intronic
968881336 4:3301661-3301683 CTGGGGATGGAGAGTGAGGCCGG + Intronic
968906093 4:3451441-3451463 CAGAGGCAGGGGAGAGAGACTGG + Intergenic
968942923 4:3648476-3648498 CAGAGGAAAGAGAGGCAGGGTGG - Intergenic
968978654 4:3835012-3835034 GAGAGGGAGGAGAGAGAGGGAGG + Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
969651214 4:8469378-8469400 CAGAGGAAGAAGGCTGAGGCTGG + Intronic
970523548 4:16909345-16909367 CAGGGGAGGGAAAGAGAGGCAGG - Intergenic
970749641 4:19342200-19342222 CAGAAGCAAGAGAGCGAGGGAGG - Intergenic
970980804 4:22094769-22094791 GATGGGAAGGAGAGAGAGGCGGG - Intergenic
971399042 4:26258281-26258303 CAGAGGCAGGAGAGACAGGTAGG - Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972933607 4:44104624-44104646 CAGTGGAAGGAGAGTGTGGGTGG + Intergenic
972939595 4:44181342-44181364 CTGAGGCAGGAGAACCAGGCAGG - Intronic
975139089 4:70902294-70902316 GAGGGGAAGGAAAGGGAGGCGGG - Intergenic
976802341 4:89006779-89006801 CAGCGGAAGGAGAGCTAGACAGG + Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
977856441 4:101900615-101900637 CAGATGAAGGAAAGAGAGGACGG + Intronic
977989934 4:103429400-103429422 CGGAGGAAGGGGAGCGAGATGGG + Intergenic
978277287 4:106967489-106967511 CAGAGGGAAGAGAGCAAGGTAGG + Intronic
979303105 4:119110085-119110107 CACAGCAAGGAGAGGGAGTCTGG - Intergenic
979357682 4:119724645-119724667 CAGAGGATCGAGAGCCAGGAGGG + Intergenic
980704793 4:136479322-136479344 CAGAGGAAGGAAAGCCAAACAGG + Intergenic
980856117 4:138442676-138442698 AAGAGAAAGGAAAGCTAGGCTGG + Intergenic
981917629 4:150052018-150052040 CTGAGGACGGAGAGGTAGGCAGG - Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982164925 4:152605523-152605545 GAGAGGAAGGACAGAGAGCCCGG + Intergenic
982306286 4:153934559-153934581 AAGGGGAAGGAGAGCACGGCAGG - Intergenic
983887712 4:172999087-172999109 CTGAGGAATGTGAGCAAGGCAGG + Intronic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
984574527 4:181432396-181432418 CAGAGGAAGAATAGAGAGTCAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985421256 4:189787163-189787185 GAGAGTAAGGAGAGTAAGGCAGG + Intergenic
985489050 5:168355-168377 CAGTGGCCGGAGAGCAAGGCCGG - Intronic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985711480 5:1432057-1432079 CAGAGGAAGGGTAGGGAGGAAGG + Intronic
986130687 5:4927129-4927151 CAGAGGGAGGAGAGAAAAGCAGG - Intergenic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
986748121 5:10761457-10761479 AGAAGGAAGGAGAGGGAGGCGGG + Intergenic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
988119273 5:26940058-26940080 CTGAGGCAGGAGACTGAGGCAGG + Intronic
988699296 5:33657329-33657351 CAAAGGGAGGAGATCCAGGCTGG + Intronic
989270474 5:39527097-39527119 CGGAGAAAGGAGAGAGAGGGTGG + Intergenic
990948619 5:61275235-61275257 GAGAGGAAGGAGAGCCAGGTGGG - Intergenic
991910263 5:71552719-71552741 CTGAGGCAGGAGAACCAGGCAGG + Intronic
992481353 5:77155121-77155143 GAGAGGAGGGAGAGAGAGGGAGG - Intergenic
992520974 5:77551048-77551070 TAGAGGAAGGAGAGAGAGAGGGG + Intronic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
994200826 5:96973984-96974006 CAGAGGTAGGAGACAGAGACAGG - Intronic
994438153 5:99764072-99764094 CTGTGGAAGGAGAGAGAAGCAGG - Intergenic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
995112882 5:108446811-108446833 CTGAGGAGGGAGGTCGAGGCAGG + Intergenic
995453043 5:112323674-112323696 CAGAGGAAGGAGGGCAAAGATGG - Intronic
996869684 5:128175085-128175107 CAGAGGTAGGAGAGTGAGGGTGG - Intronic
997191832 5:131945185-131945207 CAGAGAAAGCAGAGCGGAGCAGG - Intronic
997402425 5:133612738-133612760 CAGAGGCAGGAGCGCTACGCTGG - Intergenic
997875120 5:137538978-137539000 CTGAGGCAGGAGAATGAGGCAGG + Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998494462 5:142575498-142575520 CAGAGGAAGAGGAGAGAGGAGGG - Intergenic
998754585 5:145362166-145362188 GAAAGGAAGGAAAGCAAGGCTGG + Intergenic
999030383 5:148284109-148284131 GAGAGGAAGGAAAGGGAGGGAGG - Intronic
999121528 5:149213245-149213267 CAGAGGAAAGAGAGCAAGGAAGG + Intronic
999319338 5:150603724-150603746 CAGAGGAAGGAGCACAGGGCTGG + Intronic
999443440 5:151620456-151620478 CAGAGGAAGGAGCGCAAGGTGGG - Intergenic
999622913 5:153490571-153490593 CAAGGGAGGGAGAGAGAGGCAGG + Intronic
1000149437 5:158485321-158485343 CAGAGGAAGGAAAGCCAGCTTGG - Intergenic
1000202875 5:159028890-159028912 CAGAAGAAGGCCAGTGAGGCTGG + Intronic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001586140 5:172834766-172834788 TAGAGGGAGGAGAGGGATGCTGG - Intronic
1002059670 5:176619129-176619151 TAGAGGCTGGAGGGCGAGGCAGG + Intergenic
1002169336 5:177366681-177366703 GAGGGGAAGGAGGGGGAGGCAGG - Intronic
1002295751 5:178230237-178230259 CAGAGCAGGGAGAGAGAAGCTGG + Intronic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003619991 6:7691338-7691360 CAGAGGAAGGAGGGGAAGGGAGG - Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1004037914 6:11942234-11942256 CAGAGGAAGGAGAGAGCACCAGG + Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004131201 6:12921620-12921642 GGGAGGAAGGAGAGGGAGGGAGG + Intronic
1004617381 6:17303499-17303521 CAGAGGAAGGGGGGGGAGGGGGG + Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005285844 6:24326143-24326165 GAGAGGAAGGAAAGAGAGGAAGG + Intronic
1006026470 6:31150332-31150354 CACAGGAAGGAGATCTAAGCAGG + Intronic
1006149194 6:31976943-31976965 CTGAGGCAGGAGAGTCAGGCAGG + Intronic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006236587 6:32638684-32638706 AAGAGGAAAGAAAGCGAGGAAGG + Intronic
1007252885 6:40508370-40508392 CAGAGGAAGGAAAGAGAGCAGGG - Intronic
1007356082 6:41318847-41318869 CAGTGGAAGGAGTGCTGGGCTGG - Intergenic
1007577115 6:42932390-42932412 CAGAGGAAGGAGAACCTGCCCGG + Intronic
1007956091 6:45919207-45919229 CTCAGGAAGGAGAGCAAGGAGGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011697894 6:89929604-89929626 AAGAGGAAGAAAAGCAAGGCAGG + Exonic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013185868 6:107757423-107757445 CTGAGGATGGAGAGTGTGGCTGG + Intronic
1013191823 6:107810199-107810221 CAGAGTGAGAAGAGCGAGCCTGG - Intronic
1013405768 6:109841528-109841550 CAGAGGCTGGAGAGTTAGGCAGG + Intergenic
1013608592 6:111773555-111773577 CAGAGGAGGGAGAGGGAGAGGGG + Intronic
1014288701 6:119533599-119533621 CAGATGAAGGAGGGAGAGGGAGG + Intergenic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1015208424 6:130668043-130668065 AAGAGGAAGGAGAGAGAGAGAGG + Intergenic
1015750046 6:136550282-136550304 CAGGGGACGGCGAGCGGGGCCGG - Intronic
1015793357 6:136986314-136986336 GAGAGGAAGCAGAGAGAAGCAGG - Intergenic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1016476636 6:144434412-144434434 AAGATGAAGGAGAGAGAAGCTGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017210486 6:151850406-151850428 GAGAGGGAGGAGAGAGAGGGAGG + Intronic
1017210489 6:151850419-151850441 GAGAGGGAGGAGAGAGAGGGAGG + Intronic
1017788374 6:157774590-157774612 CAGAGGAAGGAGACCCCGGCAGG - Intronic
1017869420 6:158474249-158474271 CAAAGGGTGGAGAGGGAGGCTGG + Intronic
1017998939 6:159561124-159561146 CACAGGAAGAAGAGCAGGGCAGG + Intergenic
1018592468 6:165442513-165442535 CAGAAGAGGGAGTGCAAGGCGGG + Intronic
1018818143 6:167351148-167351170 CAGAGGCGGGAGAACCAGGCAGG - Intronic
1018931586 6:168243601-168243623 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1018931594 6:168243641-168243663 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931602 6:168243681-168243703 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931608 6:168243717-168243739 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1019637172 7:2082150-2082172 CAGAGAAAGGGAAGGGAGGCAGG + Intronic
1019695112 7:2441302-2441324 CAGGGGCAGGAGACCTAGGCTGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019805046 7:3117547-3117569 AAGAGAAAGGAGAGAGAGGAGGG + Intergenic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1022317935 7:29263125-29263147 CTGAGGCAGGAGAGTCAGGCAGG - Intronic
1022321486 7:29292150-29292172 CAGAGGATGGAGCGAGAGACGGG + Intronic
1022635481 7:32130393-32130415 GAGAGGAAGGAGAGAAAGGGAGG - Intronic
1023842637 7:44105689-44105711 CAGAGCCAGGAGAGCAAGCCTGG - Intronic
1024563862 7:50665767-50665789 CAGGTGAAGGACAGCCAGGCAGG + Intronic
1024912580 7:54463092-54463114 CAGAGGATGGAGAGACAGGAGGG - Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025821789 7:64968969-64968991 CTGAGGCAGGAGAGTCAGGCAGG + Intergenic
1026257288 7:68723690-68723712 CTGAGGAGGGAGAGAGAGGGTGG + Intergenic
1026890886 7:73981542-73981564 GAAAGGAAGGAGAGGGAGGGAGG + Intergenic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028189955 7:87835707-87835729 GCGGGGAAGGAGAGGGAGGCGGG + Exonic
1028744290 7:94309753-94309775 GAGAGGAAGGTGGGCGAGACTGG - Intergenic
1029306653 7:99624684-99624706 CAGAGGAAGCAGAGCTGCGCTGG + Intronic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1032056268 7:128686951-128686973 GAGAGGCTGGAGAGAGAGGCAGG - Intergenic
1032476130 7:132212647-132212669 AAGAGGAGGGAAAGAGAGGCAGG + Intronic
1032797406 7:135288909-135288931 GACAGGGAGGAGAGGGAGGCAGG + Intergenic
1033329214 7:140404196-140404218 CAGAGGTGAGAGAGCGAGACAGG + Exonic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034370011 7:150586814-150586836 CAGAGGGAGGAGAGTGAGCTTGG - Intergenic
1034407281 7:150913468-150913490 CAGAGGAAGGAGAGAGAGAGGGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035479067 7:159167560-159167582 CAGGGGAAGGAGGGAGAGGGTGG - Intergenic
1035568747 8:658869-658891 CAGAGGAAGGACGGCCAGGGAGG - Intronic
1036042926 8:5106417-5106439 CAGAGGAAGCATAGCAAAGCAGG + Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036453955 8:8892517-8892539 GAGAGGCAGGAGAGGGAGTCAGG + Exonic
1036561936 8:9905684-9905706 CGGGGGAAGGAGAGCGGCGCAGG + Intergenic
1036687131 8:10919101-10919123 GAGAGGATGGAGAGAAAGGCAGG - Intronic
1036947284 8:13106089-13106111 AAGAGGGAGGAGTGCAAGGCTGG + Intronic
1037292033 8:17361204-17361226 AAGAAGAAAGAGAGCAAGGCTGG - Exonic
1037560835 8:20073140-20073162 CTAAGGAAGGGGAGAGAGGCTGG - Intergenic
1037636320 8:20703863-20703885 CAGAGGAAGTAGAGAGATGCAGG + Intergenic
1037670800 8:21013601-21013623 CAGAGGAAGGAGGGGGGTGCAGG - Intergenic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1037835847 8:22214315-22214337 GGGAGGAAGGAGAGAGAGGATGG + Intergenic
1037887832 8:22604460-22604482 CAGAGGGAGGCGAGCGTGGTAGG + Intergenic
1038035251 8:23681945-23681967 GAGAGGCGGGAGAGGGAGGCAGG + Intronic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1039476500 8:37841765-37841787 CAGAGTCAGGTGTGCGAGGCGGG + Exonic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1039852439 8:41380877-41380899 CAGAGGAAGGAGTGCAAGAGTGG + Intergenic
1040575292 8:48646331-48646353 AAGAGAAAGGAGAGAGAGGTGGG - Intergenic
1040702660 8:50086311-50086333 CAGAGGAAGAAGTTGGAGGCAGG + Intronic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1042798894 8:72696130-72696152 TAGAGGAAGGAAAGCAAGGAGGG - Intronic
1043009280 8:74861712-74861734 CAGAGGAAGAACAGGGAGGGAGG + Intergenic
1043342978 8:79263948-79263970 CTGAGGAAGGAGAACGCGGGAGG + Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1045292913 8:100849135-100849157 CAGAGGAAGGAGAGCTTGGGAGG + Intergenic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1046689714 8:117268762-117268784 AAGAGGCAGGAGAGAGAGGGTGG + Intergenic
1047279663 8:123434153-123434175 CAGAGGCAGGAGAGCAATGCAGG - Intronic
1047340360 8:123975048-123975070 CAGAGGGAGGAGAGCCTGGGAGG + Intronic
1048430859 8:134369233-134369255 CAGAGGAGGAAGAGAGAGGTAGG - Intergenic
1048977552 8:139681457-139681479 CAGGGGAAGGAGTGAGAAGCTGG + Intronic
1049181790 8:141226655-141226677 CCGAGGATGGAGAGACAGGCCGG + Intronic
1049222608 8:141434806-141434828 CATAGGTGGGAGGGCGAGGCCGG - Intergenic
1049389378 8:142360218-142360240 CAGAGGAGGGAGGGCTGGGCAGG + Intronic
1049433975 8:142577763-142577785 CAGAGGGTGCAGAGCGTGGCTGG + Intergenic
1049455174 8:142682990-142683012 CACAGGAAGGAGAGCGTTCCGGG + Intergenic
1049514376 8:143045646-143045668 CAGAGGGAGGAAAGTGAGGAGGG - Intronic
1049682234 8:143924548-143924570 CAGAGGCTGGAGGCCGAGGCCGG - Exonic
1049685698 8:143938447-143938469 AAGAGGAGGAAGAGAGAGGCAGG + Intronic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1050519173 9:6479235-6479257 CAGTGGAAGGAAAGCTAGACTGG - Intronic
1050730539 9:8704238-8704260 CAGAGGATGGAGTGGGAGGGGGG - Intronic
1051351011 9:16197877-16197899 CAAAGGAAGGAGATTGAGGTGGG + Intergenic
1051353323 9:16218465-16218487 CCGAGGCAGAAGAGCCAGGCCGG + Intronic
1051901294 9:22044689-22044711 CACAGGAAGGAGGGGGAGGGAGG - Intergenic
1052219135 9:25998351-25998373 CCAAGGATGGAGAGAGAGGCAGG - Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1052998661 9:34565392-34565414 CAGAGGAAAGGGAGAGAGACAGG - Intronic
1053526120 9:38832705-38832727 CAGAGGAAGCCCAGAGAGGCTGG + Intergenic
1054198347 9:62057130-62057152 CAGAGGAAGCCCAGAGAGGCTGG + Intergenic
1054640007 9:67531233-67531255 CAGAGGAAGCCCAGAGAGGCTGG - Intergenic
1055048328 9:71953999-71954021 CTGAGGCAGGAGACTGAGGCTGG + Intronic
1055776191 9:79769460-79769482 CAGAGGATGGAGCCCGATGCAGG - Intergenic
1056135002 9:83622972-83622994 AAGGGGCAGGAGAGAGAGGCCGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056336289 9:85573200-85573222 CTGAGGCAGGAGAGTCAGGCAGG - Intronic
1056672200 9:88639810-88639832 CAGAGCTGGGAGAGCAAGGCAGG - Intergenic
1056729733 9:89155317-89155339 AAGAGCAAGGAGAGAGAAGCCGG - Intronic
1056759072 9:89402270-89402292 CTCAGGAAGGAAACCGAGGCTGG + Intronic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057029546 9:91764707-91764729 AAGAGGAAGGAGTGAGATGCAGG - Intronic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057709885 9:97430279-97430301 CAGGGGCATGAGAGCAAGGCAGG - Intronic
1057779768 9:98040138-98040160 CAAAGGAAAGAGAGAGATGCCGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058530584 9:105901710-105901732 CTCAGGAAAGAGAGGGAGGCAGG - Intergenic
1058727885 9:107820678-107820700 AGGAGGTAGGAGAGGGAGGCAGG + Intergenic
1058817963 9:108703189-108703211 CAGAGACAGGAAAGCCAGGCTGG + Intergenic
1058919562 9:109600135-109600157 TAAAGGATGGAGAGCGAGGCAGG - Intergenic
1058957011 9:109958688-109958710 GAGAGGAAGGAGAGGAAGGAAGG + Intronic
1059203379 9:112440321-112440343 GAGAGGCAGGAGACCGAGGCAGG + Intronic
1059366129 9:113787894-113787916 CCCAGGAAGGAAAGTGAGGCCGG - Intergenic
1059561628 9:115340410-115340432 CAGAGGACACAGAGCCAGGCAGG + Intronic
1060718955 9:125961275-125961297 CAGAGAAAGGACAGCGGTGCTGG - Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060771260 9:126333772-126333794 AAGAGGAAGGAGGGGGAGACTGG + Intronic
1060871467 9:127044725-127044747 TAGAGGAAGGAGAGAGAGTGTGG - Intronic
1060947596 9:127579276-127579298 GAGAGGAAGGAGGGCCAGGCTGG - Intergenic
1061128271 9:128689926-128689948 GAGGGGGAGGAGAGCGAGGGAGG - Intronic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061268536 9:129522816-129522838 AGGAGGAAGGAGAGTGTGGCAGG - Intergenic
1061385632 9:130287806-130287828 AAGAGGAAGGAGAGAGAGGCAGG + Intronic
1061783228 9:133007975-133007997 AAGAGGAGGGAGAGAGAGGAGGG - Intergenic
1062123344 9:134846262-134846284 AAGAGGAGAGAGAGCAAGGCAGG + Intergenic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062395619 9:136351460-136351482 CCAAGGAAGGAGTGGGAGGCTGG + Intronic
1062635503 9:137488523-137488545 CAAAGGATGGAGAGGAAGGCAGG + Intronic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485846 X:481525-481547 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485863 X:481580-481602 CGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485869 X:481597-481619 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485880 X:481635-481657 CGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485886 X:481652-481674 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485914 X:481752-481774 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485926 X:481786-481808 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485932 X:481803-481825 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485956 X:481894-481916 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485977 X:481962-481984 GGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185812736 X:3125696-3125718 CCGAGGAAGGAGTGGAAGGCTGG + Intergenic
1186105091 X:6196913-6196935 CTGAGGAGGGAGAGAAAGGCAGG + Intronic
1186642385 X:11469847-11469869 AAGAGGCAGGAGAGAGAGGTGGG + Intronic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1188284860 X:28315217-28315239 CCAAGGAAGGAGAGGGAAGCAGG + Intergenic
1189253506 X:39619852-39619874 AAGAGGAAGGAGAGTGATGCCGG - Intergenic
1189310523 X:40014550-40014572 CCGAGCAAGGGGGGCGAGGCGGG - Intergenic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190619917 X:52276544-52276566 AAAAGGAAGGAGGGCAAGGCGGG + Intergenic
1190723652 X:53172102-53172124 GAGAGGAAGAAGAGGGAGGGAGG + Intergenic
1190845098 X:54183581-54183603 TGGAGGAAGGGGAGCGAGGAGGG + Intergenic
1190873895 X:54446259-54446281 CAGAGGAACTACAGCGACGCTGG - Exonic
1192194464 X:69019022-69019044 CAGAGGAAGGAGGGAGAGGGAGG + Intergenic
1192397102 X:70793523-70793545 CAGAAGAAAGAGAGTGAGGGTGG - Intronic
1192656447 X:72999816-72999838 TAGAGGAAGGAAAGGGAGGAAGG - Intergenic
1192665673 X:73083185-73083207 TAGAGGAAGGAAAGGGAGGAAGG + Intergenic
1196178782 X:112668199-112668221 CAGTGGAAGGAAACCAAGGCTGG - Intronic
1196778385 X:119361492-119361514 CCGAGGCAGGAGAACCAGGCAGG - Intergenic
1197829902 X:130630405-130630427 TAGAGGGAGGAGAGAGTGGCTGG + Intronic
1197988596 X:132293598-132293620 TAGAGGAAGGGGAGGGAGACAGG + Intergenic
1198074375 X:133180489-133180511 CAGAAGCAAGAGAGCAAGGCTGG - Intergenic
1199249582 X:145644626-145644648 GAGGGGAAGGAGAGAGAGGGAGG + Intergenic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1200003465 X:153073411-153073433 CAGATGGTGGAGAGCGTGGCCGG + Exonic
1200004258 X:153076598-153076620 CAGATGGTGGAGAGCGTGGCCGG - Intergenic
1200045186 X:153397252-153397274 CAGGGGAATGCCAGCGAGGCTGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200231771 X:154447337-154447359 CAGAGGGAGAGAAGCGAGGCAGG + Intronic
1201622376 Y:15974244-15974266 CAGAGGAAAGAGGGAGAGGTAGG - Intergenic