ID: 1090398992

View in Genome Browser
Species Human (GRCh38)
Location 11:126436374-126436396
Sequence GCATGGGTGTGCTGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090398992_1090399006 28 Left 1090398992 11:126436374-126436396 CCAGGTTCCCAGCACACCCATGC 0: 1
1: 0
2: 0
3: 37
4: 296
Right 1090399006 11:126436425-126436447 GACACTTTGGTGTCAGACCAGGG 0: 1
1: 0
2: 2
3: 9
4: 107
1090398992_1090398998 2 Left 1090398992 11:126436374-126436396 CCAGGTTCCCAGCACACCCATGC 0: 1
1: 0
2: 0
3: 37
4: 296
Right 1090398998 11:126436399-126436421 GTGTATCCCACGCTCCACCCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
1090398992_1090399001 15 Left 1090398992 11:126436374-126436396 CCAGGTTCCCAGCACACCCATGC 0: 1
1: 0
2: 0
3: 37
4: 296
Right 1090399001 11:126436412-126436434 TCCACCCAGGCATGACACTTTGG 0: 1
1: 0
2: 0
3: 9
4: 109
1090398992_1090399005 27 Left 1090398992 11:126436374-126436396 CCAGGTTCCCAGCACACCCATGC 0: 1
1: 0
2: 0
3: 37
4: 296
Right 1090399005 11:126436424-126436446 TGACACTTTGGTGTCAGACCAGG 0: 1
1: 0
2: 0
3: 17
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090398992 Original CRISPR GCATGGGTGTGCTGGGAACC TGG (reversed) Intronic
900164787 1:1240351-1240373 GGCTGGGTGGGCTGGGAGCCTGG + Intergenic
900701112 1:4049159-4049181 CCCTGGCTGTGCTGGGAACAGGG + Intergenic
900704010 1:4067713-4067735 GGGTGGGGGTGCTGGGAGCCTGG + Intergenic
900877084 1:5350480-5350502 GCAGGGCTGGGCTGTGAACCGGG - Intergenic
901687625 1:10952232-10952254 GGGGAGGTGTGCTGGGAACCAGG + Intronic
901798952 1:11696186-11696208 GCATGGGTGTGGTGGGGGCCAGG - Intronic
902472103 1:16656477-16656499 GCATGGGGGTGCAGGGAGGCCGG - Intergenic
902486700 1:16750969-16750991 GCATGGGGGTGCAGGGAGGCCGG + Intronic
902727186 1:18344951-18344973 GCATGGGCTGGCTGGGATCCAGG + Intronic
902840410 1:19070608-19070630 GCAAGGCTGTGCTGAGACCCTGG - Intergenic
903673339 1:25049501-25049523 GCAAGGGGGTGCTGGGAAGATGG - Intergenic
903860291 1:26360612-26360634 ACACGGGTGGGCTTGGAACCGGG + Intergenic
904942826 1:34177093-34177115 GCAGGGGTCTGCTGGGGGCCGGG + Intronic
905179964 1:36159566-36159588 GCATGGGTGTGCTGGATAGCCGG - Intronic
906155926 1:43613857-43613879 GTAAGGGTCAGCTGGGAACCGGG + Intronic
907012004 1:50970992-50971014 GAATGGGTGGCCTGGGCACCGGG + Intronic
908115264 1:60934278-60934300 GCAGGGCTGCGCTGAGAACCAGG - Intronic
908860642 1:68483559-68483581 ACATGGATGTGCTGGGATCACGG + Intronic
909122083 1:71616162-71616184 GCAGGGGTCTGTTAGGAACCGGG + Intronic
912951508 1:114123708-114123730 TCAGGGATGTGATGGGAACCAGG - Intronic
913206981 1:116547932-116547954 GCATGGGTGTGGTGGGAAAAGGG - Intronic
914854633 1:151342379-151342401 TCTTTGGTATGCTGGGAACCGGG + Exonic
916478776 1:165195990-165196012 GTATTTGTGTGCTGGGATCCAGG - Intergenic
916518631 1:165543782-165543804 GCATGTGTGTGTTGGAGACCAGG - Intergenic
917457371 1:175196760-175196782 GCATGTGTGTGGTGGGAGACAGG - Intergenic
918441125 1:184568038-184568060 GCAGGAGTGTGCTGGGTACAAGG - Intronic
920102997 1:203529576-203529598 GCATGGGGGCGCAGGGAAACAGG - Intergenic
920254989 1:204648684-204648706 GCAGCTGTGTGCTGAGAACCAGG + Intronic
920255103 1:204649372-204649394 GCATCTGTGTGCTGAGAACCAGG - Intronic
920863100 1:209727276-209727298 GCATGGCTGTGCTGATAACTTGG + Intronic
922061304 1:222095094-222095116 GCAGTGGTGTGCTGGTAAACTGG - Intergenic
922241224 1:223756565-223756587 CCAGGGGTGTGCTGGGAAACTGG - Intronic
1064054389 10:12085214-12085236 GCATGGGAATCCTTGGAACCTGG + Intronic
1065830105 10:29607717-29607739 GCATGGGTGTGCTGGGCCTTGGG - Intronic
1065971853 10:30812028-30812050 GCATGGGTCTGCTGGAACCGGGG - Intergenic
1066535745 10:36389614-36389636 TCATGGGTGTGGTGGAAACATGG + Intergenic
1067283479 10:44890757-44890779 GGATGGGTGTGGTGGGAGACAGG + Intergenic
1067524564 10:47030324-47030346 TCATGGCTGTGCTGGGCCCCAGG + Intergenic
1069610320 10:69768515-69768537 GCATGTGTGGGCAGGGAATCTGG + Intergenic
1069888164 10:71636893-71636915 ACATGGGCTTGCTGGGTACCAGG + Intronic
1072249594 10:93571198-93571220 GCCTGTGTGTGCTGTGGACCTGG + Intronic
1073063117 10:100743981-100744003 GCCTGGGTCCGCTGGGATCCTGG - Intronic
1074073353 10:110096593-110096615 GGGGGGGTCTGCTGGGAACCTGG + Intronic
1074855250 10:117468614-117468636 GCAAGGGAGAGCTGAGAACCGGG - Intergenic
1075098659 10:119490383-119490405 GCATGTGTGTGCGGGGGACTGGG + Intergenic
1076109207 10:127848428-127848450 GCAAGGGTGTGCTGGGTGCCTGG + Intergenic
1076627241 10:131829611-131829633 GGGTGGGGGTGCTGGGATCCTGG - Intergenic
1076885470 10:133260260-133260282 GCAGGTGTGCGCTGAGAACCAGG + Intergenic
1077316284 11:1920803-1920825 GCAGGGGTGTGCTGGGGGCAGGG - Intronic
1077316291 11:1920820-1920842 GCAGGGGTGTGCTGGGGGCAGGG - Intronic
1077535807 11:3123488-3123510 GGATGGCTGTGCTGAGTACCTGG + Intronic
1077542141 11:3151780-3151802 GCCACGCTGTGCTGGGAACCTGG + Intronic
1077630593 11:3808662-3808684 GCATGGATGTGCTGGGCTGCCGG + Intronic
1077841756 11:5982896-5982918 GCATGGGGTTGCTGAGCACCAGG - Intergenic
1079317467 11:19421265-19421287 GCAGCTGTGTGATGGGAACCTGG - Intronic
1081657726 11:44868448-44868470 GTATGGGTGTGGAGGGCACCTGG + Intronic
1081898877 11:46610564-46610586 GCAGGAGAGTGCTGTGAACCCGG + Intronic
1083620318 11:64046124-64046146 GCAGGGGTAGGATGGGAACCCGG + Intronic
1083999040 11:66286107-66286129 GCATGGGTGTCCACTGAACCTGG - Intronic
1084008916 11:66337076-66337098 GGATGCGTGTGCTTGGAGCCTGG - Intergenic
1084652666 11:70498373-70498395 GGAAGGGTGTGCTTGGACCCTGG + Intronic
1085413765 11:76307034-76307056 GCAGGGGAGAGCTGGGCACCTGG - Intergenic
1088507665 11:110542110-110542132 GCATGGGGTTGCTGAGCACCAGG + Intergenic
1088843402 11:113645057-113645079 ACATGGGTGTGCTGGGAGTGAGG + Intergenic
1089679123 11:120109751-120109773 CCAGGGCTGTGCTGGGAACTGGG - Intergenic
1089966189 11:122656345-122656367 GGATGGGCGCGCTGGCAACCCGG + Intronic
1090398992 11:126436374-126436396 GCATGGGTGTGCTGGGAACCTGG - Intronic
1090838587 11:130471273-130471295 GGCTGGCTGTGATGGGAACCTGG + Exonic
1091174761 11:133547961-133547983 GCATGGGTGTGCAGGGATGCAGG - Intergenic
1091305751 11:134535176-134535198 GCATGGCTGAGCTGGGGGCCAGG + Intergenic
1091395511 12:152086-152108 GCAAGGCTGTGCTCGGGACCTGG - Intronic
1096975068 12:55695083-55695105 GGACGGGTGTGATGGGGACCTGG - Intronic
1100172449 12:91990857-91990879 GCAAGGCTGTACTGGGATCCAGG - Intronic
1102443798 12:112986164-112986186 GAAAGGCTGTGCTGGGAACAGGG + Intronic
1102935544 12:116893546-116893568 GCATGGATGTGCTGGAAAGAGGG + Intergenic
1103942911 12:124510626-124510648 GCATGGGTATGCTGGTGACAGGG - Intronic
1104592693 12:130097457-130097479 TCATGGGTGGGCTGGGATCTAGG + Intergenic
1104859459 12:131916918-131916940 GCAGGGCTGTGCTGGGTGCCCGG - Intronic
1106257912 13:28038544-28038566 GCAGGAGAGTGGTGGGAACCCGG - Intronic
1107728545 13:43324782-43324804 GCGTGGGTGTGGTGGGGAGCAGG - Intronic
1110775755 13:79406203-79406225 TCTTGGGGGTGCTGGGAGCCGGG - Exonic
1112299230 13:98214977-98214999 GAATGTGTGTGCTAGAAACCTGG - Intronic
1112972056 13:105273266-105273288 GGATGGTTGGGCTGGGGACCAGG + Intergenic
1113955098 13:114096099-114096121 GCATCGGTGTGCTGGGAAGGGGG + Intronic
1117994494 14:61466405-61466427 GCATGGATGTGCTGGAATCCAGG + Intronic
1119652098 14:76391263-76391285 GCCTGGGTTGGCTGGGACCCAGG - Intronic
1121441972 14:93955226-93955248 GCGTGGGTGTCCTGGGAATGAGG - Intronic
1121673830 14:95735758-95735780 GCATGGATATGCTGGGAAAAGGG - Intergenic
1121962583 14:98275059-98275081 GCATGGGTCTGCAGGGAAAGGGG - Intergenic
1122577153 14:102749719-102749741 GAATCGGTGTGCTGAGAAGCAGG + Intergenic
1122974369 14:105165033-105165055 GCATGTGTGTGCTGGGCTCCAGG - Intronic
1124226860 15:27902591-27902613 CCCTGCGTGTCCTGGGAACCTGG - Intronic
1124259551 15:28176366-28176388 GCAGGTGTGTGCAGGGAACCTGG - Intronic
1125170148 15:36757625-36757647 GCATGGATGTGCTGGGCAAGGGG - Intronic
1127738994 15:61879457-61879479 GTCTGGGAGTGCTGGGATCCAGG + Intronic
1128522828 15:68386800-68386822 GCAGGTGGGTGCTGGGAGCCTGG + Intronic
1128545039 15:68561091-68561113 GCAAAGTTGTGCTGGGAGCCTGG - Intergenic
1128976187 15:72155474-72155496 GCAGGGCTCTGCTGGGTACCAGG + Intergenic
1129570730 15:76681618-76681640 GCATGGGGATACTGAGAACCAGG + Intronic
1129659233 15:77543672-77543694 GCATGGAAGTGCTGGGGCCCTGG - Intergenic
1130811980 15:87389355-87389377 CCATTGGTGTGCTGGTTACCTGG + Intergenic
1130974138 15:88759992-88760014 GCATGGTGGTGGTGGGCACCTGG - Intergenic
1132556311 16:574250-574272 GCGTGGCCGTGCTGGGCACCTGG + Exonic
1132669579 16:1097103-1097125 GCATGGGGGTGCTGAGGGCCAGG - Intergenic
1132747594 16:1443415-1443437 GCAGGGGTGAGCTGGGCTCCAGG + Intronic
1133044110 16:3076649-3076671 GCATGGCTGTGCTGGACACTGGG - Intronic
1133233328 16:4376594-4376616 GCATGGCTGGGGTGGGACCCAGG - Intronic
1133285879 16:4690487-4690509 GCCTGGGTGTGCAGGGAGCTGGG - Exonic
1133379764 16:5320154-5320176 GCATAGGTGTGCGTGTAACCAGG + Intergenic
1136500913 16:30669350-30669372 GCGTGGGGGTGCTGCCAACCAGG - Exonic
1136654307 16:31700772-31700794 GCAGGGGTCGGCTGGGAACCGGG + Intergenic
1136682858 16:31978053-31978075 GGAGAGGTGTGCTGGGAGCCAGG + Intergenic
1136783496 16:32921619-32921641 GGAGAGGTGTGCTGGGAGCCAGG + Intergenic
1136886292 16:33932230-33932252 GGAGAGGTGTGCTGGGAGCCAGG - Intergenic
1137601093 16:49756751-49756773 TCATGGGTGGGCTGAGAACAGGG + Intronic
1137939189 16:52666221-52666243 GCATGGGTGTGTTGAGACCATGG - Intergenic
1139432969 16:66920944-66920966 GCATGGGTGGGCAGGGAGACAGG + Intergenic
1140117568 16:72056099-72056121 GCATGCATGTGCTGTGAAGCAGG + Intronic
1140119807 16:72073830-72073852 GCATGCATGTGCTGTGAAGCAGG + Intronic
1140356544 16:74311611-74311633 GAATGGGTGGGCTTGGAGCCAGG - Intergenic
1140474133 16:75230136-75230158 GCATGGGACTGCAGGGAAACGGG + Intronic
1141292933 16:82737144-82737166 TCATTTGTGTGCTGGGCACCTGG + Intronic
1141628211 16:85272610-85272632 CCACGGGTGTGCGGGGAGCCTGG + Intergenic
1141674406 16:85510069-85510091 GCATGGGGGTGCTTGGCCCCCGG - Intergenic
1142237897 16:88931279-88931301 GCCTGGCTGTGCTGGAAACCAGG + Intronic
1203086146 16_KI270728v1_random:1185603-1185625 GGAGAGGTGTGCTGGGAGCCAGG + Intergenic
1142514826 17:420793-420815 ACATGAGTGTGCTTGGAAGCAGG + Intronic
1143331483 17:6139307-6139329 GCAGGGCTTTCCTGGGAACCTGG - Intergenic
1145242695 17:21248997-21249019 GCATGGGGGTGCAGAGACCCAGG - Intronic
1146404872 17:32528355-32528377 GCATGGCAGAGCTGGGAAGCTGG + Intronic
1146641811 17:34547465-34547487 GTAGGGAGGTGCTGGGAACCAGG - Intergenic
1147771567 17:42871792-42871814 TCATGGCAGTGCTGGGGACCTGG - Intergenic
1148542210 17:48489857-48489879 GAATTGGTGCTCTGGGAACCAGG + Intergenic
1151223070 17:72627911-72627933 GCAGGGATGTGCTGGGGATCCGG - Intergenic
1152073336 17:78144844-78144866 GCCTGGGTGTGTTGGGAAGCTGG - Intergenic
1152342519 17:79733198-79733220 GAATGCGTGTGCAGGGATCCTGG - Intronic
1152407694 17:80107146-80107168 GCATGGCTGGGCTGGGATCTGGG + Intergenic
1152528440 17:80902874-80902896 GCACGGGTGTGCTTGGACTCTGG - Intronic
1152685151 17:81690287-81690309 GAAGGGGAGTGCTGGGAGCCCGG + Intronic
1153512856 18:5874262-5874284 GCATGGGAGGGCAGGGAAACAGG - Intergenic
1153758141 18:8303784-8303806 GCATGGCAGAGCTGGGAACCGGG + Intronic
1154374057 18:13794217-13794239 GCAAGTGTGTGCTGGCCACCTGG - Intergenic
1154502735 18:15004694-15004716 GCCAGGGTGTGCTGGGTACCAGG - Intergenic
1155527821 18:26735187-26735209 TCATGGGTTTGCTGGAAACTGGG + Intergenic
1158508206 18:58065852-58065874 TGCTGGGTGTACTGGGAACCCGG + Intronic
1159781733 18:72668016-72668038 TCATGGCTCTGCTGGGGACCAGG - Intergenic
1159942003 18:74415342-74415364 ACATGGGGGTGCTGGACACCGGG - Intergenic
1160575423 18:79850082-79850104 GCACGTGTGTGCTGGGTACATGG - Intergenic
1160667017 19:335686-335708 GCAGGGAGGTGCAGGGAACCCGG + Intronic
1161342940 19:3752771-3752793 GCACGGGTGTGGGGGGCACCAGG + Intronic
1161576743 19:5058567-5058589 GCCTGGGTGTGGTGGGAGCCGGG + Intronic
1161613701 19:5257910-5257932 GCTTGGGTGTGCAGGGGACGGGG + Intronic
1162301791 19:9848772-9848794 ACATGGCAGGGCTGGGAACCAGG + Intronic
1162910725 19:13846805-13846827 GCAGGGATGTGGTGGGATCCCGG - Intergenic
1163442614 19:17329343-17329365 GCGTGGCTGTGCTGGGGGCCTGG - Intronic
1164684708 19:30159042-30159064 GCATGTGTGTGGGGGGACCCTGG + Intergenic
1165160896 19:33815556-33815578 GCAGGGGTTTGGTGGGAAACGGG - Intronic
1166054685 19:40281193-40281215 GCTGTGGTGGGCTGGGAACCAGG + Intronic
1166321956 19:42024114-42024136 GGGTGGGTGTGATGGGAGCCTGG - Intronic
1166704824 19:44902977-44902999 GCATGGATATGGTGGGAAGCTGG + Intronic
1166800273 19:45452432-45452454 GCAGGGTGGTGCTGGGGACCTGG - Intronic
1167210680 19:48132311-48132333 GCATGTGTGTCCTGTGATCCAGG - Intronic
1167512139 19:49900996-49901018 GCACAGATGTGCTGGGGACCGGG + Intronic
1167798589 19:51726523-51726545 GGAGGAGGGTGCTGGGAACCTGG - Intergenic
1202704500 1_KI270713v1_random:13271-13293 GCATGGGGGTGCAGGGAGGCCGG - Intergenic
924964267 2:60515-60537 GCATGGCTTTGCTGGGGACAGGG - Intergenic
925021626 2:574109-574131 CCATGGGTGGGCTGGAACCCCGG - Intergenic
925076348 2:1019456-1019478 CCATAGGTGTGCTGGGAATGTGG + Intronic
925363085 2:3293246-3293268 GGAAAGGTGTCCTGGGAACCCGG - Intronic
926149197 2:10415357-10415379 GGATGGGGGTGCGGGGCACCTGG - Intronic
926415190 2:12642795-12642817 GCGAGGGTGAGCTGGGCACCAGG - Intergenic
927110843 2:19862838-19862860 GCTTGGGAGTGCTGGTAACAAGG - Intergenic
928658319 2:33475816-33475838 CCTTTGGTGTGCTGGGAACTTGG - Intronic
929664098 2:43820491-43820513 GGAAGGGGGTGCTGGGAAGCGGG - Intronic
937239400 2:120450611-120450633 GCACAGGTTTGCTGTGAACCAGG - Intergenic
937341288 2:121092456-121092478 ACATAGGAGTGCTGGCAACCAGG - Intergenic
937681391 2:124648340-124648362 GGGTGGGTGTGCTGAGATCCTGG - Intronic
938501902 2:131834862-131834884 GCCAGGGTGTGCTGGGTACCAGG - Intergenic
939566217 2:143789277-143789299 GCAGGAGAGTGGTGGGAACCCGG + Intergenic
940345708 2:152625615-152625637 GCATGGGTGTTCTGTTAACCTGG + Intronic
940883480 2:158969075-158969097 GAACCGGTGTGGTGGGAACCGGG + Intronic
941137898 2:161739977-161739999 GCAAGAGGATGCTGGGAACCTGG - Intronic
941681256 2:168401754-168401776 GCATGGGGTTGCTGAGCACCAGG - Intergenic
944358340 2:198820630-198820652 CCAGGGGTGTGCTGGTAAACTGG + Intergenic
948270496 2:236669958-236669980 GCAGGGGTGAGCTGAGTACCAGG - Intergenic
1171031080 20:21676857-21676879 GCATGGGCGTGCTGGTGAGCAGG + Intergenic
1171360608 20:24584089-24584111 GAAGGGGTGTGCTGGGAGCAGGG - Intronic
1172846439 20:37932249-37932271 CCAAGGGTGTGCTGGGAGCCTGG - Intronic
1173162189 20:40661276-40661298 ACATGGGCGGGCTGGGGACCAGG + Intergenic
1174447262 20:50598398-50598420 GGTGGGGTGTGCTGGGAACGGGG - Intronic
1175524844 20:59626549-59626571 GCTTGGGTGTGGTAGGAACAAGG + Intronic
1177960478 21:27660435-27660457 GCCTGGATCAGCTGGGAACCAGG + Intergenic
1179190883 21:39121005-39121027 GCAGGGGTCAGCTGGGATCCTGG + Intergenic
1179516153 21:41908497-41908519 GCATGGGGGTGCTGTTTACCTGG - Intronic
1179960191 21:44763746-44763768 GCCTGGGTGTGCTGGGTGCTTGG - Intergenic
1179960206 21:44763798-44763820 GCCTGGGTGTGCTGGGTGCCCGG - Intergenic
1179960235 21:44763886-44763908 GCCTGAGTGTGCTGGGTGCCTGG - Intergenic
1179960272 21:44764007-44764029 GCCTGGGTGTGCTGGGTGCCCGG - Intergenic
1179960305 21:44764111-44764133 GCCCGGGTGTGCTGGGTGCCTGG - Intergenic
1179960322 21:44764180-44764202 GCCCGGGTGTGCTGGGTGCCTGG - Intergenic
1179960328 21:44764197-44764219 GCCCGGGTGTGCTGGGTGCCCGG - Intergenic
1179960344 21:44764249-44764271 GCCTGGGTGTGCAGGGTGCCTGG - Intergenic
1179960350 21:44764266-44764288 GCCCGGGTGTGCTGGGTGCCTGG - Intergenic
1179960356 21:44764283-44764305 GCCCGGGTGTGCTGGGTGCCCGG - Intergenic
1179960373 21:44764335-44764357 GCCTGGGTGTGCCGGGTGCCTGG - Intergenic
1180824079 22:18851216-18851238 GCACTGGTGGGCTGGGGACCTGG - Intronic
1180957609 22:19747882-19747904 GCAGGGGTGGGCAGGGCACCGGG + Intergenic
1181124505 22:20694370-20694392 GCACTGGTGGGCTGGGGACCTGG - Intergenic
1181188659 22:21123332-21123354 GCACTGGTGGGCTGGGGACCTGG + Intergenic
1181210540 22:21287161-21287183 GCACTGGTGGGCTGGGGACCTGG - Intergenic
1181731432 22:24849753-24849775 GAATGGGTGGGGAGGGAACCCGG + Intronic
1182492539 22:30683033-30683055 GCATGTGCCTGTTGGGAACCTGG + Intergenic
1183482725 22:38073978-38074000 GCCTCGGGGTGCTGGGCACCCGG + Intronic
1183584200 22:38742728-38742750 AGCTGGGTGTGCTGGGAGCCAGG + Intronic
1184109723 22:42387676-42387698 TGAGGGGTGTGCTGAGAACCAGG - Intronic
1185134885 22:49063804-49063826 GGAGGGGTGTGCCGGGCACCTGG + Intergenic
1203274220 22_KI270734v1_random:77120-77142 GCACTGGTGGGCTGGGGACCTGG - Intergenic
950075445 3:10183625-10183647 GCAGGAGAGTGGTGGGAACCCGG + Intronic
950899626 3:16486069-16486091 AGGTGGGTGTGCTGGGCACCTGG - Intronic
952622865 3:35367431-35367453 ACATGGGTTTGCTGAGTACCAGG + Intergenic
952870126 3:37891429-37891451 GCACAGGTGTGCAGGGCACCAGG + Intronic
953039411 3:39241810-39241832 GCCTGGGTGTGTTGGGATCCAGG + Intergenic
953903824 3:46858332-46858354 GGAGGGGAGTGCTGGGACCCAGG - Intronic
954135683 3:48581179-48581201 TCATGGGGGTTCTTGGAACCAGG - Intronic
954538512 3:51378874-51378896 GCATGTGGGTGCTAGGAACTGGG + Intronic
954617743 3:51978220-51978242 GAATGTGTTTGCTGGGAACCTGG - Intronic
954717797 3:52534939-52534961 AAGTGGGTGTGCTGGGAACCTGG + Intronic
954774797 3:53007046-53007068 GCATGTGTCTGCTGGGATCAGGG - Intronic
954849610 3:53589438-53589460 GCATGGGGGTGCTGTGAGGCAGG + Intronic
958744280 3:98113900-98113922 GCTAGGGAGTGATGGGAACCAGG + Intergenic
958923417 3:100131486-100131508 GCAGAGGTGTGATGTGAACCAGG + Intronic
959299726 3:104582331-104582353 TCATGGGTGTCATGGGAACCAGG + Intergenic
961714253 3:128847826-128847848 GGCTGGGTGTGCTGGGCACATGG + Intergenic
961723084 3:128908848-128908870 GCCTGGGTATGCTGGGCCCCTGG - Intronic
966878755 3:184338079-184338101 GAATGGGTAGGCTGGGAAACGGG + Intronic
967984674 3:195086088-195086110 GTTTGGGGGTGCTGGAAACCAGG - Intronic
968271221 3:197405108-197405130 GCAGGGGTGGGGTGGGAACGGGG + Intergenic
970094841 4:12451609-12451631 GCAGGAGTGTGCTGGGAGCCAGG + Intergenic
974250706 4:59379119-59379141 GCATGGTAGTGCTGGGAAGAGGG - Intergenic
976774972 4:88698020-88698042 ACATGGGTGGGCTGGGAACAGGG - Exonic
978686784 4:111454951-111454973 GCAGTGGTGTTCTGGGACCCTGG - Intergenic
979386260 4:120068309-120068331 GCATGGGTGTGATAGGTAACAGG + Intergenic
979725337 4:123954356-123954378 TCATGGGTGTTCTGGGAAAGGGG + Intergenic
985577549 5:680561-680583 GCTTGGGAGGGCTGAGAACCAGG + Intronic
985592481 5:772657-772679 GCTTGGGAGGGCTGAGAACCAGG + Intergenic
985790450 5:1924110-1924132 ACATGGGTGTCCTGGAAGCCTGG + Intergenic
986167269 5:5285447-5285469 GCCTGTCTGTGCTGGGATCCTGG + Intronic
992092204 5:73327165-73327187 CCTTGGATGTGCTGGGCACCAGG - Intergenic
992402976 5:76428278-76428300 CTATGGGTCTGCTGGGTACCTGG + Intronic
993311412 5:86337819-86337841 GCATGGGTATGCTGGGGCCTTGG - Intergenic
994729130 5:103471293-103471315 GCATGGTGGTGCTGGGAGCTTGG - Intergenic
996103425 5:119469909-119469931 GCATGGTTTTGCTGGGAACAGGG + Intronic
998535080 5:142922714-142922736 TCCTGTGTGTGCTGAGAACCTGG + Intronic
1000064477 5:157683147-157683169 GCATGTGCCTGTTGGGAACCTGG + Intergenic
1000960608 5:167596700-167596722 GCAGGAGAGTGCTGTGAACCCGG + Intronic
1001773537 5:174312520-174312542 GAGTGGGTGTGCGGGGAAACCGG - Intergenic
1002175224 5:177397833-177397855 GCAGGCGTGTGCAGGGCACCGGG - Exonic
1003400046 6:5783589-5783611 GAATGTGGGTGCTGGGAGCCAGG - Intergenic
1005327722 6:24719627-24719649 GGCTGGGGGTGTTGGGAACCCGG - Exonic
1006118458 6:31788713-31788735 GCAGGAGTATGCTGTGAACCTGG + Intronic
1006962995 6:37952771-37952793 GCATGGGGCTGCTGAGCACCAGG - Intronic
1007380412 6:41486834-41486856 GCATGTGTGTGCTGGGGCCAAGG + Intergenic
1007476912 6:42125085-42125107 GCCTGGGCCTGCTGGGCACCAGG - Intronic
1007524287 6:42477863-42477885 GCATGAGTGGGCTGGGAACGGGG + Intergenic
1007636290 6:43301716-43301738 GCATGGGTGTGGTGGGAGGGAGG + Intronic
1008910858 6:56731089-56731111 GCTGGGGTGTGCAGGGCACCAGG + Intronic
1010758946 6:79699552-79699574 GCATGTGTGTGCTGAGTACCAGG - Exonic
1011260324 6:85463735-85463757 GCCTCGGTGTGGTGGGAACTTGG + Intronic
1012106577 6:95168162-95168184 ACATGGGTGTGCACGGAACCAGG - Intergenic
1013408818 6:109866180-109866202 GCATGGGGGTGCAGGGACCTGGG + Intergenic
1014761996 6:125366667-125366689 GCATGGGGGTGCTGAGTATCTGG - Intergenic
1016035648 6:139380206-139380228 TCATGGGTGTACTGTGAACCTGG + Intergenic
1016139066 6:140585903-140585925 GCATGGGGTTGCTGAGCACCAGG + Intergenic
1017720864 6:157242265-157242287 GCATGGGTGAGCTGGGTGCAAGG - Intergenic
1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG + Intronic
1018079508 6:160246868-160246890 TGATGGGGGTGCTGGGCACCTGG + Intronic
1018090285 6:160340563-160340585 GCTTGGGTGTGGCTGGAACCTGG + Intergenic
1019034478 6:169042964-169042986 GCATGAGGGTGCTGGGTTCCCGG - Intergenic
1019734092 7:2641917-2641939 GCAGTGGTGGGCTGGGACCCGGG + Intronic
1022240285 7:28504723-28504745 GCTTAGGTCTCCTGGGAACCTGG - Intronic
1022278350 7:28879517-28879539 TTATGGGTGCTCTGGGAACCTGG - Intergenic
1023725820 7:43141869-43141891 GCATGGGTGTACTGGCGACTTGG + Intronic
1023861909 7:44221659-44221681 GCATGGGGGTGCGGGGCAACAGG - Intronic
1024308036 7:47944551-47944573 CTTTGGGTGTGCTGAGAACCAGG - Intronic
1026396817 7:69963787-69963809 GCATGGCTGGGATTGGAACCAGG + Intronic
1027052428 7:75028651-75028673 GAAGGGGTGTCTTGGGAACCAGG - Intronic
1027200120 7:76058868-76058890 GCATGGGTATGCTGGGCAAAGGG + Intronic
1029477608 7:100794276-100794298 GCATGGGGCAGCTTGGAACCGGG - Intronic
1030089357 7:105843663-105843685 GCATGGGTGTTCCAGGACCCAGG + Intronic
1032091607 7:128914268-128914290 GCCTAGCTGTGCTGGGTACCAGG + Intergenic
1032192848 7:129774378-129774400 CCAAGCGTGTGCTGGGAGCCTGG + Intergenic
1032851462 7:135799059-135799081 GCATGGGTGTGGTGGGCACAAGG - Intergenic
1033651863 7:143350131-143350153 GGAGGGGTGTTCTGGGTACCTGG + Intronic
1034429356 7:151033536-151033558 CCATGGGTGTGCTGGTCAGCAGG + Intronic
1034431219 7:151042115-151042137 GCTCGGGTCTGCCGGGAACCAGG + Intronic
1035474976 7:159136894-159136916 GCCTGGGTGTCCTCAGAACCTGG - Intronic
1035634811 8:1136593-1136615 TCATGGGTCTGCTGTGCACCAGG - Intergenic
1037881119 8:22573963-22573985 GCAGGGGTGTGCAGGGAAAAGGG + Intronic
1038017153 8:23524917-23524939 GCAGAGGAGTGCTGGGACCCAGG + Intergenic
1040629046 8:49188075-49188097 GGTTGGGTGTGGTGGGAGCCAGG + Intergenic
1040779748 8:51093922-51093944 GCATGGGTACGCTGGACACCAGG + Intergenic
1041616821 8:59916827-59916849 GAATGTCTGTGCTGGGAACGTGG - Intergenic
1042216937 8:66437001-66437023 GCATTAGTGAGCTGGGAAGCTGG + Intronic
1042866726 8:73363055-73363077 GCATCTGGGTGCTGGGAAACTGG - Intergenic
1048403659 8:134096501-134096523 GCATGGGTGTTCTGAGCTCCAGG + Intergenic
1048984688 8:139729099-139729121 GCATGAGGGTGCTGGTCACCGGG - Intergenic
1049504711 8:142989943-142989965 GCATGGACGTGCTGTGAGCCTGG - Intergenic
1049777639 8:144413908-144413930 GGGTGGGTGTGCTGGGGGCCTGG - Intronic
1052447954 9:28588503-28588525 GTATAAGTGTGCTGGGAGCCTGG + Intronic
1053097565 9:35341756-35341778 GCGTGAGTGTGCTGGGAAGGGGG + Intronic
1053430563 9:38039462-38039484 GGATGGGTGTGCTTGGCCCCAGG - Intronic
1056047984 9:82739027-82739049 GCATTTGTGTGCTGGGAACAAGG + Intergenic
1056781309 9:89553222-89553244 GCCCAGGTGAGCTGGGAACCTGG + Intergenic
1060224619 9:121783370-121783392 CCCTGGGTGTGCTGGGCCCCAGG - Intronic
1060517740 9:124276304-124276326 GCAAGGGTGGGCTGGGGCCCTGG + Intronic
1060896388 9:127220548-127220570 GCGTGGGTGTGCAGAGCACCCGG - Exonic
1061808603 9:133149645-133149667 GCATCGGGGTGCTGGGCGCCAGG - Intergenic
1061876473 9:133546574-133546596 GCATGGGTGTGCTGACCACCAGG - Intronic
1061877357 9:133551090-133551112 GCATCGGTGTGATGGGAGGCAGG - Intronic
1061912666 9:133733321-133733343 CCATGGGTGTCCTGGCAAACTGG - Intronic
1061933700 9:133846192-133846214 GCAGAGGTGGGCTGGGAGCCAGG + Intronic
1062497545 9:136838806-136838828 GCCAGGGTGTGCTGGGTACCAGG + Intronic
1186616452 X:11193439-11193461 ACATGGATATCCTGGGAACCAGG - Intronic
1187693767 X:21897908-21897930 GCATGGGTGTGCTAGGGAGAAGG - Intergenic
1189383911 X:40521399-40521421 GCATGTGTGTGCAGGGAGCAAGG + Intergenic
1190458294 X:50646016-50646038 TCAGGGGTCTGCTGGGAGCCAGG - Intronic
1195370182 X:104166137-104166159 GAAAGAGTGCGCTGGGAACCAGG + Intergenic
1196053819 X:111333789-111333811 GCATGAGGGTCCTGGGAACATGG - Intronic
1198922262 X:141743070-141743092 GCAGGGGTCTGCTGGGACCTGGG - Intergenic
1200684130 Y:6245025-6245047 GCCTGGGTGTGCTGGGTCCAGGG + Intergenic
1201048505 Y:9909361-9909383 GCCTGGGTGTGCTGGGTCCAGGG - Intergenic
1201904603 Y:19076680-19076702 GCCTGGGGGTTCTGGGAGCCCGG - Intergenic
1202372776 Y:24209725-24209747 GCTTGGGTGTGCTGACAAGCAGG - Intergenic
1202498006 Y:25460395-25460417 GCTTGGGTGTGCTGACAAGCAGG + Intergenic