ID: 1090401075

View in Genome Browser
Species Human (GRCh38)
Location 11:126448666-126448688
Sequence CTTCTTGCTGTGGCATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3691
Summary {0: 2, 1: 72, 2: 233, 3: 1047, 4: 2337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090401075_1090401083 29 Left 1090401075 11:126448666-126448688 CCATGGGATGCCACAGCAAGAAG 0: 2
1: 72
2: 233
3: 1047
4: 2337
Right 1090401083 11:126448718-126448740 CCCACCAAAACCCACCACGATGG 0: 1
1: 0
2: 0
3: 9
4: 123
1090401075_1090401078 -3 Left 1090401075 11:126448666-126448688 CCATGGGATGCCACAGCAAGAAG 0: 2
1: 72
2: 233
3: 1047
4: 2337
Right 1090401078 11:126448686-126448708 AAGGCAGCTGCCTGCAAGCCAGG 0: 6
1: 77
2: 176
3: 479
4: 1588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090401075 Original CRISPR CTTCTTGCTGTGGCATCCCA TGG (reversed) Intronic
Too many off-targets to display for this crispr