ID: 1090401670

View in Genome Browser
Species Human (GRCh38)
Location 11:126453219-126453241
Sequence TGGTCTATTTGAGGACAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090401670_1090401674 -4 Left 1090401670 11:126453219-126453241 CCAGGTTGTCCTCAAATAGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1090401674 11:126453238-126453260 ACCAAGGTTTCATCTCGTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 28
1090401670_1090401673 -5 Left 1090401670 11:126453219-126453241 CCAGGTTGTCCTCAAATAGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1090401673 11:126453237-126453259 GACCAAGGTTTCATCTCGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 64
1090401670_1090401681 22 Left 1090401670 11:126453219-126453241 CCAGGTTGTCCTCAAATAGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1090401681 11:126453264-126453286 GCCACATCCCGCTATCTGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 54
1090401670_1090401679 0 Left 1090401670 11:126453219-126453241 CCAGGTTGTCCTCAAATAGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1090401679 11:126453242-126453264 AGGTTTCATCTCGTGTGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1090401670_1090401680 21 Left 1090401670 11:126453219-126453241 CCAGGTTGTCCTCAAATAGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1090401680 11:126453263-126453285 GGCCACATCCCGCTATCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 72
1090401670_1090401683 23 Left 1090401670 11:126453219-126453241 CCAGGTTGTCCTCAAATAGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1090401683 11:126453265-126453287 CCACATCCCGCTATCTGCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 90
1090401670_1090401676 -3 Left 1090401670 11:126453219-126453241 CCAGGTTGTCCTCAAATAGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1090401676 11:126453239-126453261 CCAAGGTTTCATCTCGTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 46
1090401670_1090401677 -2 Left 1090401670 11:126453219-126453241 CCAGGTTGTCCTCAAATAGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1090401677 11:126453240-126453262 CAAGGTTTCATCTCGTGTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1090401670_1090401678 -1 Left 1090401670 11:126453219-126453241 CCAGGTTGTCCTCAAATAGACCA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1090401678 11:126453241-126453263 AAGGTTTCATCTCGTGTGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090401670 Original CRISPR TGGTCTATTTGAGGACAACC TGG (reversed) Intronic
901659520 1:10789726-10789748 TGGAATAATTGAGGACAACCAGG - Intronic
908923330 1:69222819-69222841 TGGTCTATTAGCGGTCAAGCAGG + Intergenic
911970076 1:104422769-104422791 TGGTCTATTTCTAGACAAACTGG - Intergenic
1063864164 10:10345724-10345746 GGCTCTCTTTCAGGACAACCCGG + Intergenic
1067918204 10:50423412-50423434 TGGTCTATACTAGGACCACCTGG + Intronic
1074430575 10:113390738-113390760 GTGTCTCTTTGAGGACTACCAGG + Intergenic
1082292869 11:50400518-50400540 TGGTAAATTTGAGGTCAAACCGG + Intergenic
1090401670 11:126453219-126453241 TGGTCTATTTGAGGACAACCTGG - Intronic
1096822572 12:54248478-54248500 TGGTATCTTTGGGGACCACCCGG - Intronic
1100506621 12:95227202-95227224 TGTTCTATTGGAGGCCAGCCTGG - Intronic
1100526857 12:95427613-95427635 TGGTATGTTTGAGGACAGCAAGG - Intergenic
1100822750 12:98446966-98446988 TGGTCCATTTGGAGACAAGCAGG + Intergenic
1101582259 12:106052067-106052089 TGGTCTATTTGAGAACGATGAGG - Intergenic
1105207948 13:18238795-18238817 CGGTATATCTGAGGACACCCAGG - Intergenic
1107291262 13:38856786-38856808 TGTTCATTTTGAGGAAAACCTGG - Intronic
1108362708 13:49682196-49682218 TGGTCTCTTTCAGAACTACCAGG + Intronic
1108463450 13:50691158-50691180 TGGTCTCTGTGAGGAAAATCAGG - Intronic
1111150611 13:84249498-84249520 TGGTGTATTGGAGGAAAAACAGG + Intergenic
1114139359 14:19893765-19893787 TGGTGTATTTGTGGGCAAGCAGG - Intergenic
1114763438 14:25343995-25344017 TGGTAAATTTGAGGTCAGCCCGG - Intergenic
1114848378 14:26351729-26351751 TTGTCTAATTGAGGGCAACTTGG - Intergenic
1115088073 14:29541038-29541060 AGGGCTATTTAAGGATAACCAGG + Intergenic
1116978679 14:51144002-51144024 TGATCTATTTTAGGACAAAAGGG + Intergenic
1117056621 14:51918311-51918333 ATGTCTACATGAGGACAACCAGG - Intronic
1120361697 14:83512721-83512743 TGGTATATTTTTGGAAAACCAGG + Intergenic
1120440204 14:84527326-84527348 TGGTCTCTTTGAAGTCAGCCTGG + Intergenic
1126793488 15:52241681-52241703 TGGTCTCTTTGGGGCCAACTGGG + Intronic
1129425935 15:75462860-75462882 TGGTTTAAGTGAGGACAGCCTGG + Intergenic
1132348479 15:101122526-101122548 TGGTCTGGTTGAGGACATCCTGG + Intergenic
1134043387 16:11084505-11084527 TGGTCTATTTTTGGAAAACAAGG - Intronic
1135381426 16:21999362-21999384 TGCTGTGTTTGGGGACAACCAGG + Intronic
1136297377 16:29311420-29311442 TGGTCAACCTGAGGACAACCCGG + Intergenic
1138186920 16:54983988-54984010 TGGTCTATTTGATCCCAGCCTGG + Intergenic
1138224154 16:55278180-55278202 AGGTCTTTTTGAGGACAAAATGG + Intergenic
1138668908 16:58597065-58597087 TGGTCTATTCAAGCTCAACCAGG + Intronic
1142058931 16:88017497-88017519 TGGTCAACCTGAGGACAACCCGG + Intronic
1142974321 17:3634598-3634620 TGCTCTATTTCAGGAGAAACTGG + Intronic
1148009239 17:44462251-44462273 TCTTCTATTCGAGGACACCCAGG - Intronic
1156471852 18:37382045-37382067 AGGTCAATTTAAGGACCACCAGG - Intronic
1160058245 18:75506685-75506707 TCGTCTATTTGAGAACCAGCAGG - Intergenic
1160215999 18:76932211-76932233 TGGCTTCTTTGAGGACATCCTGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
927765985 2:25808772-25808794 TGGTCTCTTTGGGGCCAACTGGG - Intronic
933006959 2:77006676-77006698 TGGAATATTTGAAGAAAACCGGG + Intronic
934974030 2:98787798-98787820 AGGTTCATGTGAGGACAACCAGG - Intergenic
937685485 2:124691712-124691734 TGGTCTAATTGAAGAAAACTGGG - Intronic
939862204 2:147433917-147433939 TGGTTTATTTGAGGTCACACTGG + Intergenic
940591865 2:155739264-155739286 TGGTCTATGTGATGACAGGCAGG - Intergenic
944787470 2:203087805-203087827 TGGTCTATTTGAAGGCAAGCAGG + Intronic
945560116 2:211329420-211329442 TGGTCTACTTGATGGCCACCAGG - Intergenic
948175929 2:235942875-235942897 TTGTCAATTTGAGACCAACCTGG + Intronic
1169601212 20:7262952-7262974 TGATCTAGCTGATGACAACCTGG + Intergenic
1171357586 20:24561340-24561362 TGGCAAATTGGAGGACAACCAGG - Intronic
1173957329 20:47043964-47043986 TAGTCTATTACTGGACAACCTGG - Intronic
1180758513 22:18180680-18180702 TGGTATGTCTGAGGACACCCAGG - Intergenic
1180768800 22:18364472-18364494 TGGTATGTCTGAGGACACCCAGG - Intergenic
1180777512 22:18497923-18497945 TGGTATGTCTGAGGACACCCAGG + Intergenic
1180810234 22:18755233-18755255 TGGTATGTCTGAGGACACCCAGG + Intergenic
1180826675 22:18867696-18867718 TGGTATGTCTGAGGACACCCAGG - Intergenic
1181196376 22:21189485-21189507 TGGTATGTCTGAGGACACCCAGG + Intergenic
1181213151 22:21303639-21303661 TGGTATGTCTGAGGACACCCAGG - Intergenic
1181523794 22:23466626-23466648 TGGTATGTCTGAGGACACCCAGG - Intergenic
1182452024 22:30427329-30427351 TGGTCCACTTGCGGACAGCCAGG - Exonic
1182952984 22:34395202-34395224 TGATCTATTTGAGGTGAACCTGG - Intergenic
1203230422 22_KI270731v1_random:105356-105378 TGGTATGTCTGAGGACACCCAGG - Intergenic
1203276818 22_KI270734v1_random:93606-93628 TGGTATGTCTGAGGACACCCAGG - Intergenic
949382252 3:3459535-3459557 TGGTGTATTTGAGGTCAATATGG + Intergenic
951360891 3:21722922-21722944 GGAACTAATTGAGGACAACCAGG - Intronic
952015157 3:28948080-28948102 TGGTCTATTTCAGAAAACCCGGG - Intergenic
953722149 3:45365763-45365785 GGCTCAATTTGAGGAAAACCAGG + Intergenic
955831087 3:63004893-63004915 TGGTGTAGTTGAGGAGAAGCAGG - Intergenic
956028600 3:65011335-65011357 TGATCTGTTTGAGTATAACCAGG + Intergenic
964397988 3:156267509-156267531 TGGACTTGTTGAGGACAGCCTGG - Intronic
969439505 4:7208872-7208894 TGGTCTGTGTGACGCCAACCTGG + Intronic
969983677 4:11184949-11184971 TGGTTAATTGGAGGAAAACCAGG - Intergenic
971573502 4:28244929-28244951 TGGTTTATTTGTGGAAATCCTGG + Intergenic
974468026 4:62282710-62282732 TGATGTATTTGAGGAAAACAAGG - Intergenic
980536911 4:134136982-134137004 TGGTCTATTTTAGAACAAATGGG + Intergenic
985260535 4:188110743-188110765 TGGTCTATTTGAAGAAAGCTGGG - Intergenic
986684450 5:10263961-10263983 TGCTAAATTTGAGCACAACCAGG - Intronic
987599799 5:20052977-20052999 GAGTTTATTTGAGGACAAACTGG - Intronic
987843470 5:23252081-23252103 TACTCAACTTGAGGACAACCAGG + Intergenic
1001466224 5:171968883-171968905 TGGTATATTAGAGGACAATCAGG - Intronic
1002405624 5:179027889-179027911 TGGGCTCCTAGAGGACAACCAGG - Intronic
1004815591 6:19308815-19308837 TGGTCTATATTGGGACAACTGGG + Intergenic
1007966560 6:46008784-46008806 TGGTTTATTTGAGGTCAATCTGG + Intronic
1014921875 6:127222998-127223020 TGGGCTATTTGAGGTGACCCAGG - Intergenic
1015965771 6:138693663-138693685 CGTTCTATTTGAGGTCCACCCGG - Intergenic
1017200657 6:151750895-151750917 AGGATTATTTGAGGAGAACCTGG + Intronic
1017382806 6:153849746-153849768 TCATCTATTGGAGGACATCCTGG - Intergenic
1020554476 7:9653642-9653664 AGGACTATTTGAGCACAGCCTGG - Intergenic
1027223431 7:76228850-76228872 TGGGCTATATCAGGAGAACCTGG + Intronic
1029732093 7:102445202-102445224 TGGTCTGTCTGAGGCCATCCAGG + Intronic
1038884192 8:31645673-31645695 TGGTCTTCTTCAGGAGAACCAGG + Intronic
1039427895 8:37501856-37501878 TGGCATAAATGAGGACAACCTGG + Intergenic
1040942068 8:52844222-52844244 TGGTCACAGTGAGGACAACCGGG - Intergenic
1050701398 9:8343632-8343654 AGGGGTATTTGAGGGCAACCAGG - Intronic
1052135756 9:24907989-24908011 TGGTCTGCTTGATGGCAACCAGG - Intergenic
1052915469 9:33921914-33921936 TGTTCTATATGAAGACAAACAGG + Exonic
1058274797 9:103026407-103026429 TCCTGCATTTGAGGACAACCAGG - Intergenic
1059202011 9:112426611-112426633 TGGTCTCTTTGGGGCCAACTGGG + Intronic
1186076245 X:5882522-5882544 TGGGGAATTTTAGGACAACCAGG + Intronic
1188584323 X:31754289-31754311 TGGCCTATATGCAGACAACCAGG + Intronic
1198149567 X:133895127-133895149 TAGTCTATTTGAGTAGAATCTGG - Intronic
1200909268 Y:8516220-8516242 TGGTCAGTTTGAGGACCTCCTGG - Intergenic
1201326412 Y:12765233-12765255 TGCTCAATGTGAAGACAACCAGG - Intronic
1201518996 Y:14851579-14851601 TGGGGAATTTTAGGACAACCAGG - Intergenic