ID: 1090402571

View in Genome Browser
Species Human (GRCh38)
Location 11:126458493-126458515
Sequence CTTGGGCACCAGCAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 325}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090402571_1090402579 6 Left 1090402571 11:126458493-126458515 CCCTCTTCCTGCTGGTGCCCAAG 0: 1
1: 0
2: 2
3: 38
4: 325
Right 1090402579 11:126458522-126458544 CTGCCTCCCTGCCTAGTGCCAGG 0: 1
1: 0
2: 1
3: 55
4: 478
1090402571_1090402583 12 Left 1090402571 11:126458493-126458515 CCCTCTTCCTGCTGGTGCCCAAG 0: 1
1: 0
2: 2
3: 38
4: 325
Right 1090402583 11:126458528-126458550 CCCTGCCTAGTGCCAGGCACGGG 0: 1
1: 0
2: 4
3: 75
4: 553
1090402571_1090402588 30 Left 1090402571 11:126458493-126458515 CCCTCTTCCTGCTGGTGCCCAAG 0: 1
1: 0
2: 2
3: 38
4: 325
Right 1090402588 11:126458546-126458568 ACGGGAGCTGGCCTGAGAGATGG 0: 1
1: 0
2: 1
3: 20
4: 246
1090402571_1090402586 18 Left 1090402571 11:126458493-126458515 CCCTCTTCCTGCTGGTGCCCAAG 0: 1
1: 0
2: 2
3: 38
4: 325
Right 1090402586 11:126458534-126458556 CTAGTGCCAGGCACGGGAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 174
1090402571_1090402581 11 Left 1090402571 11:126458493-126458515 CCCTCTTCCTGCTGGTGCCCAAG 0: 1
1: 0
2: 2
3: 38
4: 325
Right 1090402581 11:126458527-126458549 TCCCTGCCTAGTGCCAGGCACGG 0: 1
1: 0
2: 1
3: 39
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090402571 Original CRISPR CTTGGGCACCAGCAGGAAGA GGG (reversed) Intronic
900429371 1:2594606-2594628 CTTGGGCCCCAGAAAGCAGAGGG + Intronic
900596858 1:3483888-3483910 GTTGGGCAACAGCAGGAACTAGG - Intergenic
901199717 1:7459771-7459793 CTTGGGTCACAGCCGGAAGAAGG + Intronic
902275576 1:15337121-15337143 CATGGCCACCAGGAGGAAGGGGG + Intronic
902848951 1:19138061-19138083 ACTGGGCACCAGGAGGGAGATGG - Exonic
902960912 1:19962247-19962269 CATGGGCATCAGCAGGTAGAGGG + Intergenic
903059701 1:20661347-20661369 CTTCGGCAGGAGGAGGAAGATGG - Exonic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903662294 1:24985507-24985529 CATGGGGAGAAGCAGGAAGAGGG - Intergenic
904680226 1:32223893-32223915 CTTGGGAAACAGCAGGGAGCTGG - Intronic
904988483 1:34572577-34572599 CTTGTGGGCCAGGAGGAAGAAGG + Intergenic
905043171 1:34976851-34976873 CGCGAGCACCAGCAGGAAGGCGG + Intergenic
905205944 1:36342905-36342927 CTTGGGCACCAGGCAGCAGAGGG - Intronic
905363282 1:37434813-37434835 CTTGGGCAGCTGTTGGAAGATGG - Intergenic
905773758 1:40654938-40654960 CCTGGGCACCAGGAGGATGGAGG - Intronic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
906591003 1:47023980-47024002 CTTGGGCACCAGAAGGTAGATGG + Exonic
907894366 1:58671414-58671436 ATGGGGCATCTGCAGGAAGAGGG + Intronic
908268020 1:62397344-62397366 CTTGGGGGCCAGGAGGAAGGAGG + Intergenic
909585088 1:77281060-77281082 CTTGGGAGCTAGGAGGAAGATGG + Intergenic
912436614 1:109666619-109666641 CCTGGACACCAGCTGGCAGAAGG - Intronic
912438673 1:109681085-109681107 CCTGGACACCAGCTGGCAGAAGG - Intronic
912441194 1:109699530-109699552 CCTGGACACCAGCTGGCAGAAGG - Intronic
912839614 1:113027542-113027564 TTTGGGCACCAGGAGGACAAAGG + Intergenic
913111849 1:115664166-115664188 CCTGAGCTCCAGCAGGACGATGG - Exonic
913148210 1:116013217-116013239 CTTGGGGAACAACAGGGAGAAGG - Intronic
913195040 1:116449234-116449256 CTGGGGTACCTGCAGGAAGTGGG - Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
916387983 1:164298578-164298600 GTATGGCCCCAGCAGGAAGAGGG + Intergenic
917630162 1:176883709-176883731 TGTGGTCACCAGCAGGATGATGG - Intronic
920099637 1:203508788-203508810 CTTTGTCACCCGCAGGGAGAAGG - Exonic
920202084 1:204265901-204265923 GTTGGGCCCCAGCTGGAAGCAGG + Intronic
921173169 1:212566805-212566827 CTTGGGCACCAATAGGAACCAGG - Intronic
922067679 1:222159600-222159622 GGTGGTCACCACCAGGAAGAAGG - Intergenic
922153200 1:223022357-223022379 CCTGGGCAGCAGAAGGAAGGTGG + Intergenic
922367332 1:224878289-224878311 CTTGGGAATAAGGAGGAAGAGGG - Intergenic
922954599 1:229588441-229588463 CTTGGGCACCAGCGGGAATTTGG - Intergenic
923028225 1:230224138-230224160 GGTGGGCACCAGGAGGCAGAGGG + Intronic
923104486 1:230843725-230843747 CCTGGGCCCCACCAGGAAGGAGG - Exonic
923757831 1:236809364-236809386 CTTGGGCACCAGCTGGTAGGAGG + Intronic
924816987 1:247451338-247451360 CAGGGGCACCAACACGAAGAAGG + Exonic
924886954 1:248229213-248229235 CTAGGGAACCAGCAGGAGCAGGG + Intergenic
1065620344 10:27574710-27574732 CATGATCTCCAGCAGGAAGATGG - Intergenic
1066623900 10:37386041-37386063 CTGGGGCATGAGCAGGGAGAGGG - Intergenic
1067067465 10:43112032-43112054 CTTGGGCACTAGCTGGACGCTGG + Intronic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1067666618 10:48284825-48284847 CTTGGACACAAACAGGAGGAGGG - Intergenic
1067697576 10:48547125-48547147 AATGGGCACAAACAGGAAGATGG + Intronic
1068531716 10:58196204-58196226 CTTGGCAACCAGTGGGAAGATGG + Exonic
1069742502 10:70693995-70694017 CTTGGGGACAGGCAGGAAGAAGG - Intronic
1069839939 10:71333504-71333526 CTTAGGGACCATCAGGAAGAGGG - Intronic
1070050536 10:72885101-72885123 CTTAGGCCAAAGCAGGAAGATGG - Intronic
1071114881 10:82206408-82206430 CTTGGGCAGTAGCAGGCAGTAGG + Intronic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1072639568 10:97201793-97201815 CTTGGGCAACAGCATGCAAACGG - Intronic
1076251106 10:128984471-128984493 TGTGGGCACAGGCAGGAAGAAGG - Intergenic
1076379796 10:130017199-130017221 CTTGGGAAGCAGCCGGAAGCTGG + Intergenic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077046999 11:551117-551139 CCTGGGCACCTGCAGGGGGAGGG - Exonic
1077198417 11:1293139-1293161 CTGGAGCACCAGCAGCACGAGGG + Intronic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1078740702 11:14063775-14063797 GTTGGGAATCAGCAGGATGATGG - Intronic
1079030634 11:16983722-16983744 CTTGGGAATGAGCAGGGAGAAGG - Intronic
1080451664 11:32383253-32383275 GTTGGGCTCCAGGAGAAAGAAGG - Intergenic
1080463542 11:32476218-32476240 TTTGGGCACCAGCTGAAACAGGG - Intergenic
1081674922 11:44963203-44963225 CTTGGGGCCCAGCAGGAAGCTGG - Intergenic
1083475452 11:62912410-62912432 CTGGGGCAAAAGCAGGAAGCAGG + Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1083862008 11:65425357-65425379 CTTGGCCACCAGGAGGAAGCTGG - Intergenic
1083884006 11:65562166-65562188 CTCCGGCACCAGGAGGAGGAGGG - Intergenic
1084173188 11:67410301-67410323 CTTTTGCACCTGCAGGAGGAGGG + Intronic
1085022318 11:73217576-73217598 CTAGGACAGCAGCAGGAAGAAGG + Intergenic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085394935 11:76202467-76202489 CATGGGCACCAGCATGAGGTGGG - Intronic
1085534361 11:77209141-77209163 CATAGGCACCTGCAGGAAGCCGG + Intronic
1085666665 11:78420236-78420258 GATGGGCACTAGCAGCAAGAGGG - Intergenic
1087800587 11:102499024-102499046 ATCTTGCACCAGCAGGAAGAAGG - Intergenic
1089170822 11:116510367-116510389 CTGGGACACCAGCAGGCAGTAGG - Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089611798 11:119673388-119673410 CTAGGGTCCCAGCTGGAAGAGGG - Intronic
1090402571 11:126458493-126458515 CTTGGGCACCAGCAGGAAGAGGG - Intronic
1090925599 11:131247363-131247385 CTTTGTCAACAGAAGGAAGAAGG - Intergenic
1091282343 11:134389335-134389357 GCTGGGCAGCAGCAAGAAGAGGG + Exonic
1091399911 12:175402-175424 CTTGGGCAGCAGCATGAGGCTGG + Exonic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1096448157 12:51713533-51713555 CATTGCCACCGGCAGGAAGAGGG - Intronic
1096684354 12:53277938-53277960 CTTTGCCACCAGCTGGTAGAGGG - Exonic
1097086637 12:56473538-56473560 ATTGGGTACCACCAGGAGGATGG + Exonic
1097763802 12:63499831-63499853 ATTGGGCACCAGCATCTAGATGG + Intergenic
1098981383 12:76960514-76960536 CATTTGCACCAGGAGGAAGATGG + Intergenic
1101781628 12:107843627-107843649 GTTTGGCTCCAGGAGGAAGAAGG - Intergenic
1101889900 12:108703853-108703875 CTTGGGAGCCAGGAGGAACAAGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1103329496 12:120144344-120144366 CTGGGGCAGCAGCAGGGCGATGG + Exonic
1103725885 12:122997179-122997201 TTTGGGCACCTCCAGGTAGAAGG + Intronic
1104610805 12:130226179-130226201 CTGGGGGACCAGCAGGACGTGGG - Intergenic
1105274553 13:18906954-18906976 CCCAGGCACCAGCAGGAGGAGGG - Intergenic
1105690750 13:22837148-22837170 CTTGGCAACCAGTGGGAAGATGG + Intergenic
1106304416 13:28496613-28496635 CTGGGGGACCAGCAAGGAGAAGG - Intergenic
1107275937 13:38679183-38679205 ATAGGGCACCAGCATGAACAAGG + Intergenic
1108315034 13:49228505-49228527 CTGGGGCAGGAGCCGGAAGATGG + Intergenic
1108558533 13:51620489-51620511 CTAGGGCAAGAGCAGGATGAAGG - Intronic
1109305059 13:60629434-60629456 CTAGGGTACTAGAAGGAAGATGG - Intergenic
1110279926 13:73681332-73681354 CTTGGGTACAAGCATGAAAAAGG - Intergenic
1110792054 13:79597284-79597306 CTTTGCCAAAAGCAGGAAGAGGG + Intergenic
1112571757 13:100599582-100599604 CTTGGGGACCAGAAGAAAAAAGG + Intergenic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1114651948 14:24290892-24290914 CTTGGGCACACGGAGGAAGGAGG + Exonic
1119323502 14:73745251-73745273 CTTGTGGGCCAGCAGGGAGAAGG - Intronic
1121111731 14:91317460-91317482 CTTCAGCACCAGCAGGAGGCAGG - Intronic
1121454191 14:94027851-94027873 CTTGGGCACCAAGTGGAAGCAGG - Intronic
1121608519 14:95259375-95259397 CTTGGGCACCAGAACGGAGAAGG + Intronic
1121730649 14:96184859-96184881 CTTGGGCACCAGGGAGCAGATGG - Intergenic
1121791760 14:96704394-96704416 CTTGGCCAGAGGCAGGAAGATGG + Intergenic
1122728144 14:103773922-103773944 CTTGGGCACCATATGGAAAACGG + Intronic
1122837092 14:104435692-104435714 CCTGGTCACCAGCAGTGAGAAGG + Intergenic
1122918987 14:104871861-104871883 CTTGGACCACAGCAGGTAGACGG + Intronic
1123164773 14:106315675-106315697 CCTGGGAAGCAGCAGGGAGAGGG - Intergenic
1123519026 15:21054967-21054989 CCAGAGCCCCAGCAGGAAGAGGG + Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1129294505 15:74592498-74592520 CTTGGGGACCAGAAGGAAACTGG + Intronic
1130887326 15:88104777-88104799 CATTGGCATCAGCAGGGAGATGG + Intronic
1131574975 15:93579598-93579620 CTTGGGGTCCAGGAGGAATAGGG + Intergenic
1132328534 15:100993834-100993856 CTAGGAAACCAGCAGGAATAAGG - Intronic
1132623725 16:880198-880220 GTTGGGGACCAGCAGGAATGGGG + Intronic
1132639347 16:970651-970673 CCCGGGCCCCAGCAGGAAGGAGG + Intronic
1132702142 16:1226465-1226487 CTGGGGCACAGGCAGAAAGACGG - Intergenic
1132706178 16:1244403-1244425 CTGGGGCACAGGCAGAAAGACGG + Intergenic
1136254721 16:29030326-29030348 CTTGGACACCTGCAGGGAGCTGG - Intergenic
1136631601 16:31492244-31492266 CTTGGGGCCCTGCAGGGAGATGG - Exonic
1137645658 16:50071060-50071082 CCTTGGCCCCAGGAGGAAGAAGG + Intronic
1137751308 16:50863073-50863095 CTTGGGCTCCCGGAGGAACAAGG - Intergenic
1138512681 16:57517721-57517743 CATGGTCACCAGCAAGAAGAGGG - Intronic
1139318953 16:66097470-66097492 TCTGGGCAGCAGCTGGAAGATGG + Intergenic
1139510876 16:67427980-67428002 CCTGGCCACTGGCAGGAAGAGGG + Intergenic
1139589252 16:67924324-67924346 CTTGGGGAGCAGCGGGGAGAGGG + Intronic
1140235070 16:73151625-73151647 CTCGGGCACCTGCAGAATGAAGG - Intergenic
1140321311 16:73954443-73954465 GTTGGGAACCTGCGGGAAGATGG - Intergenic
1140388196 16:74561148-74561170 CTCTGACACCAGCAGGAGGAAGG - Intronic
1140477072 16:75244360-75244382 CTTGGGCAGAAACAGGAAGCAGG + Intronic
1141178895 16:81739092-81739114 CTTGGGCCCCTGGAGGGAGAAGG - Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144519696 17:15945493-15945515 CGTGAGCACCAGCACGAAGCAGG - Exonic
1144638605 17:16925816-16925838 CTTGGGCACCCTCAGGCACATGG + Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144792331 17:17867357-17867379 GGTGGGCACCAGCAGGAGGAAGG + Intronic
1145193197 17:20866283-20866305 CTCAGGCACCAGCAGGAGGAGGG + Intronic
1145273279 17:21415815-21415837 CTGGGCCACCACCATGAAGACGG - Exonic
1145298819 17:21614804-21614826 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145311468 17:21703259-21703281 CTGGGCCACCACCATGAAGACGG - Exonic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145723300 17:27091542-27091564 CTCAGGCACCAGCAGGAGGAGGG - Intergenic
1145904991 17:28511427-28511449 CGAGCGCACCAGCAGGACGAGGG + Intronic
1146380072 17:32321713-32321735 CTGGGGCTCCAGTAAGAAGAGGG + Exonic
1146721806 17:35129303-35129325 CCTGGGCCCCAGCAGGAGCAGGG + Intronic
1146945775 17:36872459-36872481 CTTGTCCACCAGCTGGAAGTGGG + Intergenic
1148219074 17:45849650-45849672 CTAGGGAACCAGCAGGGGGAGGG - Intergenic
1148794806 17:50191823-50191845 CTCGGGGACCAGCAGGACCAGGG + Exonic
1148852060 17:50560304-50560326 TTTGGGCAGCAGCCGGAGGACGG - Intergenic
1148860196 17:50600608-50600630 CTTGGGCCCCAGGTGGGAGAGGG + Intronic
1149644319 17:58228729-58228751 GTTAGTCACCAGGAGGAAGATGG - Intronic
1150149669 17:62798891-62798913 GCTGGGTACCAGCAGGAAGAGGG + Intronic
1150905391 17:69330708-69330730 ATTGTTCACCAGCAGGAGGAGGG - Intergenic
1151204791 17:72498371-72498393 CTTGGGCACCAGTAGCTTGAGGG - Intergenic
1152199701 17:78938191-78938213 CTTGGGAACCAGTAGCAAGGGGG + Intergenic
1152557335 17:81059968-81059990 CATGGGCACAAGGAGGAGGAGGG + Intronic
1154466238 18:14644203-14644225 CCCAGGCACCAGCAGGAGGAGGG - Intergenic
1155505186 18:26526248-26526270 TTTGGGGAGCAGCAGGAGGAGGG + Intronic
1157775159 18:50388772-50388794 CTTGAGCATCAGCAAGAGGAAGG - Intronic
1158017674 18:52803966-52803988 CTTGGGCACCAGCATGGTGGTGG + Intronic
1158425927 18:57339565-57339587 CCTGGGCTTCAGGAGGAAGATGG + Intergenic
1160665404 19:325830-325852 ACTGGGCATCAGCAGGTAGACGG - Intronic
1162080070 19:8212489-8212511 CTTGGGAGACAGCAGAAAGAGGG + Intronic
1162798831 19:13100044-13100066 CTTGGGCACAATCAGAATGAGGG - Intronic
1162917268 19:13881232-13881254 CTTGGGCAGGAGCAGAAGGATGG + Intergenic
1163219835 19:15910702-15910724 CTTGGCAACCAGTGGGAAGATGG + Intergenic
1163382489 19:16978205-16978227 CATGGGCAACAGGAGGAAGTGGG + Intronic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1164723694 19:30451207-30451229 CTTGGGCCCCAGCGGAAAGGTGG - Intronic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1166340369 19:42133431-42133453 CTCGGGCACCAAGAGGAAGAGGG - Intronic
1166593916 19:44027602-44027624 CAGGGGCATCAGCAGGGAGAAGG - Intronic
1167050142 19:47072896-47072918 CTCGGGGACCAGCTGGTAGAGGG + Intronic
1167468522 19:49662894-49662916 CTTGGGCCTCAGCAGGATCAAGG + Intronic
1167752052 19:51387375-51387397 CATGGCCACCACCAGGAGGATGG + Exonic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168663641 19:58185928-58185950 CAGGGGCACCAGTAGGAAAAGGG + Intronic
925367106 2:3318050-3318072 CCTGGGACCCAGCAGGAAGCAGG - Intronic
925680346 2:6414452-6414474 CTTGGGCAGGAGCATGAAGAGGG + Intergenic
925942673 2:8835853-8835875 CTTGAGCAAAAGCAGGAAGAAGG + Intronic
926170405 2:10549612-10549634 TTGGGGTACCAGCTGGAAGAAGG + Intergenic
927552359 2:24010808-24010830 CCTGGGCACGAGCAGGGAGCAGG - Intronic
927633496 2:24793984-24794006 TTTGGGCAGCAGCAGGAAGGAGG - Intronic
928332627 2:30369287-30369309 ATGGGGCACCGGCTGGAAGAGGG + Intergenic
928722848 2:34140658-34140680 CTTGGCCAACAGCATGAAGAGGG + Intergenic
929810797 2:45187970-45187992 CTTGCAAAGCAGCAGGAAGAAGG - Intergenic
931640855 2:64379940-64379962 CTTGGGTTCCCGCAGAAAGAAGG + Intergenic
932416659 2:71577717-71577739 TCTGGGTCCCAGCAGGAAGACGG - Intronic
935377150 2:102411201-102411223 ACTGGACAGCAGCAGGAAGAAGG - Intergenic
936111924 2:109671570-109671592 TTCAGGCACCAGCAGGAGGAGGG - Intergenic
936946025 2:117931760-117931782 ATTGTCTACCAGCAGGAAGATGG - Intronic
937428079 2:121816409-121816431 CCTGGCCACCATCAGGGAGAAGG + Intergenic
938312657 2:130302944-130302966 CTCAGGCACTAGCAGGAGGAGGG - Intergenic
939847900 2:147269793-147269815 CTTTGTCAGCAGCATGAAGACGG - Intergenic
943209550 2:184945604-184945626 CTTAGGCACTAGCAAGACGATGG - Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
946302636 2:218833207-218833229 AATCCGCACCAGCAGGAAGAGGG + Intergenic
947535630 2:230939167-230939189 CTTTGCCCCCAGCAGGCAGAAGG + Intronic
947799006 2:232915607-232915629 AGTGGGACCCAGCAGGAAGATGG - Intronic
948800760 2:240432477-240432499 CTTGGGCAGCAGCCTGAAGGAGG - Intergenic
948994673 2:241572394-241572416 CTCTGGCAGCAGCACGAAGAAGG - Exonic
949044137 2:241863167-241863189 CGTGGCCACCAGCAGGGAGGTGG - Intergenic
1168850005 20:969972-969994 ATGGGGCACCAATAGGAAGAGGG - Intronic
1170012165 20:11736084-11736106 CTTGGGAAGCAGGTGGAAGAGGG - Intergenic
1170484604 20:16803761-16803783 GCTTGGCACCAGCAGGCAGAAGG + Intergenic
1170577159 20:17672973-17672995 GATGGGCAGCAGCTGGAAGAGGG + Intronic
1170602194 20:17849451-17849473 CTTGGCCACCCTCAGGACGAGGG - Intergenic
1170615399 20:17945009-17945031 CTTGAGCACCAGCAGAAGGTTGG - Intronic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1173167536 20:40696154-40696176 CCTTGGCATCAGGAGGAAGAAGG - Intergenic
1173908933 20:46649896-46649918 CTTGGGCACATGGAGTAAGAAGG - Intronic
1175101079 20:56579261-56579283 CCTGTTCATCAGCAGGAAGAAGG - Intergenic
1175256039 20:57647814-57647836 CTTGTGCACCAGGAGCCAGAGGG + Intergenic
1176078978 20:63262283-63262305 CCTGGGCTCTGGCAGGAAGAGGG - Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176294293 21:5062794-5062816 CTGTGGCACGAGCAGGTAGACGG - Intergenic
1176516163 21:7785122-7785144 TCTGGGCACCAACAGGAAGATGG + Intergenic
1176808350 21:13514393-13514415 CCCAGGCACCAGCAGGAGGAGGG + Intergenic
1178077419 21:29024695-29024717 ATTCGTCACCAGGAGGAAGACGG + Exonic
1178535071 21:33403896-33403918 GCTGGGCAGCAGCAGGAAGACGG + Intronic
1178650191 21:34415134-34415156 TCTGGGCACCAACAGGAAGATGG + Intergenic
1178887179 21:36493598-36493620 CTGGGGCACGAGGAGGAGGAGGG + Intronic
1179862967 21:44200854-44200876 CTGTGGCACGAGCAGGTAGACGG + Intergenic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1181089123 22:20460010-20460032 CTGGGGCACAAGCCAGAAGAAGG + Intronic
1182431950 22:30304467-30304489 CTTGGGGAGGAGGAGGAAGAGGG - Intronic
1183365574 22:37404969-37404991 CTTGATCACCAGCAGGTAGCTGG - Intronic
1183717727 22:39543666-39543688 CTTTGAGCCCAGCAGGAAGATGG - Intergenic
1184249143 22:43250402-43250424 CTTGGGTTCCAGCAGGGACAGGG - Intronic
1184403265 22:44286118-44286140 CAGGGGCACCTGCAGGAAGGAGG - Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184892102 22:47386349-47386371 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184892332 22:47387607-47387629 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184979426 22:48085471-48085493 CTCAGACACCACCAGGAAGATGG + Intergenic
949890842 3:8732906-8732928 CCTGGGCTCCAGCAGCATGAAGG - Intronic
950425909 3:12924652-12924674 CTTGCGCTGCAGCAGGAAGTGGG + Exonic
951607492 3:24452304-24452326 CTTGGGCACCAAACGGAAGGGGG - Intronic
951615772 3:24542080-24542102 CCTCAGCACCAGCAGCAAGAAGG + Intergenic
951804701 3:26631426-26631448 CTTTGGCACAGGCAGGTAGATGG + Intronic
951891998 3:27576102-27576124 CCTGGTCACCAGAAGGAACAAGG - Intergenic
952493795 3:33898197-33898219 CTTTCCCACCAGCAGGAAGGAGG + Intergenic
953184001 3:40621317-40621339 CTTGGGCAGCAGTGGGAAGAGGG + Intergenic
953259632 3:41325013-41325035 CATCTACACCAGCAGGAAGATGG + Intronic
953531260 3:43741551-43741573 CCTGGGCATCATTAGGAAGAGGG + Intergenic
953546813 3:43869596-43869618 CTTGAGCCCCAGCAGAAAGCTGG - Intergenic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954873846 3:53787725-53787747 CATGAGGACCAGCAGGAAGAGGG + Intronic
955354315 3:58217750-58217772 CGTGGGAACCAGCAGGGAGCTGG + Intergenic
956210854 3:66799767-66799789 CTATGGGGCCAGCAGGAAGAAGG - Intergenic
958158252 3:89783799-89783821 CTTGAGCAGCAGCATTAAGAAGG + Intergenic
959086364 3:101854581-101854603 CTTGGGCAACAGCAATATGAAGG - Exonic
963831303 3:150012401-150012423 CATGGGCACCTTCAGCAAGAGGG + Intronic
964636203 3:158860425-158860447 CTTGGGCACCAGTGGGAGGAAGG + Intergenic
967010510 3:185428708-185428730 CTCGAGGACCAGCAGGAAAAGGG + Exonic
969308432 4:6338710-6338732 CTAGGGGCCCAGCAGGAAGGGGG - Intronic
969470277 4:7383497-7383519 GCTGGGCACCAGCAGGGAGGGGG + Intronic
969693302 4:8719737-8719759 CGTGGGCTCCAGGAGGGAGAGGG + Intergenic
970652875 4:18197842-18197864 CTTAGGCAAAACCAGGAAGAAGG + Intergenic
970889869 4:21031072-21031094 CTTGGAGACCAGATGGAAGATGG - Intronic
971234281 4:24827348-24827370 CTTGGGGAGCAGCAGCAAGAGGG - Intronic
972066589 4:34953423-34953445 TTTGGGCGCCAGCAGGAGCATGG - Intergenic
977176735 4:93828407-93828429 CTTGGGCACCAGCCGAGAGCCGG + Intergenic
978729859 4:112013096-112013118 CTGGGACACCTGTAGGAAGAAGG + Intergenic
981153317 4:141404023-141404045 CGTGGGCAGCTGCAGGAGGAGGG - Intergenic
984620206 4:181944191-181944213 CTGGGGCTCCAGCTGGCAGATGG - Intergenic
985049226 4:185972788-185972810 CTGGGGCTCCATCAGGAAGAGGG + Intergenic
985546606 5:513086-513108 CCTGGGCACCAGGAGGGTGAGGG + Intronic
985992352 5:3573959-3573981 CTTGTGCTGCAGCAGGCAGAAGG + Intergenic
986013458 5:3737692-3737714 TTTAGGCACCAGCAGGGTGAGGG + Intergenic
986412463 5:7494200-7494222 ATAGGGCAACAGCAGGAAGCAGG - Intronic
987186500 5:15425826-15425848 CTTGGGCTCCAGCTGAAAGGTGG + Intergenic
991018903 5:61959718-61959740 CTTGGGGATTAGCAGCAAGATGG - Intergenic
992483781 5:77176499-77176521 CATGGGCATGAGCAGGAGGAGGG + Intergenic
993708201 5:91195520-91195542 TTTGGGGACCAGCAGGAATGCGG + Intergenic
996777077 5:127143928-127143950 CTTGGGCTCCAGCATGGTGACGG - Intergenic
997335692 5:133107517-133107539 TTTTGGTACCTGCAGGAAGAGGG + Intergenic
997767540 5:136519963-136519985 CTTGGCCACCAGCAGCAGGTGGG + Intergenic
997800660 5:136857732-136857754 TTTGAGCACCAGTAGGAATAAGG - Intergenic
998474394 5:142408342-142408364 TTTGGACATCACCAGGAAGAGGG - Intergenic
998501919 5:142640591-142640613 CTTGGATAACAGCTGGAAGAAGG - Intronic
999730841 5:154475897-154475919 CTTTGGCAGCAGCAGCACGAAGG - Exonic
1001628880 5:173159987-173160009 CATGGGGATCAGCAGGATGATGG + Exonic
1001852500 5:174981700-174981722 CTTTAGCAGCAGGAGGAAGAGGG - Intergenic
1002102094 5:176862684-176862706 CTCGGGCTCCACCAGGAAGTGGG - Exonic
1003111145 6:3253112-3253134 CCTGGTCATCAGCAGGAAGAGGG - Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1005572387 6:27157780-27157802 CTTTGGCAACAAAAGGAAGAGGG - Intergenic
1006508941 6:34511371-34511393 CCTGGGCACCACCTGGAAGCTGG - Intronic
1006746642 6:36347331-36347353 CCTGCCCTCCAGCAGGAAGAGGG - Intergenic
1007505992 6:42335827-42335849 CATGGGAAGCAACAGGAAGATGG - Intronic
1018013471 6:159692847-159692869 CTTCAGCACCAGCAGGCAGCTGG - Exonic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1019801146 7:3089312-3089334 TCTGGGGACCAGCAGGAAGCAGG + Intergenic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1022437801 7:30406821-30406843 CTTGGGCATCATCAGCCAGACGG - Intronic
1022794659 7:33722530-33722552 CTGGGGCAGCAGCAGGCAGAAGG - Intergenic
1023966099 7:44963768-44963790 GTTGGGCACAAGTTGGAAGAGGG + Intronic
1023983598 7:45082932-45082954 GTTGAGAACCAGCAGGAAGGAGG - Exonic
1025245437 7:57313197-57313219 TTTGGGAACCAGAAGGAAGCGGG - Intergenic
1025276109 7:57581922-57581944 CTCAGGCACAAGCAGGAGGAGGG - Intergenic
1027671506 7:81105042-81105064 CTTGGGCAACTATAGGAAGAGGG - Intergenic
1028624358 7:92861885-92861907 CTTTGGCACCAGCTGAGAGAGGG + Intergenic
1028686329 7:93592320-93592342 CTTGGTGAGCAGGAGGAAGATGG - Intronic
1029526463 7:101097607-101097629 CTTAGGGACCAGATGGAAGAGGG + Intergenic
1029681719 7:102116093-102116115 CGTGGGCATCGGCAAGAAGACGG + Intronic
1031000164 7:116405707-116405729 CCTGTGCTCCAGCAGCAAGAAGG + Intronic
1031969458 7:128053737-128053759 TTTGAGGACCAGCAGGAAAAAGG - Intronic
1032839163 7:135700480-135700502 CTTCGGCCCCACTAGGAAGATGG - Intronic
1033563595 7:142557774-142557796 CTAGGGAACCAGGAGGAAAACGG - Intergenic
1035726244 8:1825527-1825549 CTTGGGCACCAGCGGGCTGTGGG - Intronic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1037326351 8:17694959-17694981 CTTGGTCACCAGCAGAATCAAGG + Intronic
1037809711 8:22080317-22080339 CTTGGGCACCCTCAGGGAGCGGG + Intronic
1038004136 8:23415924-23415946 CTGGGGCTCCTGCAGGAGGAAGG - Intronic
1038864005 8:31419067-31419089 CCAGGGCAACAGCTGGAAGAGGG - Intergenic
1043500757 8:80852685-80852707 CTTGGGAATTAGTAGGAAGAGGG - Intronic
1044540047 8:93398637-93398659 CTTGGGAAGCAGCAGGAAAGAGG - Intergenic
1045525963 8:102941525-102941547 CTTGGGCAGCTGGAGGAAGATGG - Intronic
1047937472 8:129797012-129797034 CTTGACCACCAGCAGGGAGGTGG + Intergenic
1048572484 8:135667295-135667317 ACTGAGCACCAGCAGGAGGAGGG - Intergenic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049351600 8:142167549-142167571 CTTGGCCACCACCGGGGAGAAGG + Intergenic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1052339813 9:27354046-27354068 CTTGGTCTCCAGCAGGGAGGGGG - Intronic
1055570943 9:77616494-77616516 CTAAGTCAGCAGCAGGAAGATGG + Intronic
1057146215 9:92761020-92761042 CCTGGGCAGCTGCAGGAAGTGGG - Intronic
1057379026 9:94552905-94552927 CTCAGGCGCCAGCAGGAGGAGGG + Intergenic
1058805792 9:108590378-108590400 ATTGAGCAACAGCATGAAGAAGG - Intergenic
1059091249 9:111360963-111360985 CATGGGCAACAGAAGGAAGGAGG + Exonic
1061675388 9:132212702-132212724 CTTGGGCACTAGAGGGAAGGAGG - Intronic
1061869810 9:133514711-133514733 CTTGGGCAGCAGCAGAACAAAGG + Exonic
1062048014 9:134433294-134433316 CTGGGGCACCAGCAGGACCTGGG + Intronic
1062317829 9:135977222-135977244 CCTGGGCCCCGGGAGGAAGAGGG + Intergenic
1203627289 Un_KI270750v1:35411-35433 CTCAGGCACCGGCAGGAGGAGGG - Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1185734857 X:2488911-2488933 CTTGGGCAGCAGGGGGAAGAGGG + Exonic
1185747895 X:2586092-2586114 CTTTGCCGTCAGCAGGAAGAGGG - Intergenic
1187399911 X:18950496-18950518 CCTGGGCACCAGCAGGGTAAAGG - Intronic
1187901451 X:24030113-24030135 CTAGGGCAGAAGCAGGGAGATGG + Intergenic
1189261492 X:39682136-39682158 CTTGGTGACCTGCAGGAAGCAGG - Intergenic
1191846303 X:65550361-65550383 GTGGAGCACCAGCAGGAGGAAGG + Intergenic
1191955665 X:66640025-66640047 TTTGGGGGCCAGTAGGAAGAAGG + Intergenic
1194148597 X:90294873-90294895 CGTGAGCAGAAGCAGGAAGATGG + Intergenic
1194314681 X:92361817-92361839 CTTGGGTACCAGGAGGAATGGGG - Intronic
1194524766 X:94966019-94966041 TTTTGCCACCAGCAGGAAAATGG + Intergenic
1195678195 X:107523399-107523421 CTGGGCCACCTGCAGGAAGATGG + Intronic
1198327307 X:135586574-135586596 CGGGGGCACCAGCAGGCTGAAGG - Intergenic
1198427192 X:136532055-136532077 GTTGGGCACCTGCAGGAATGAGG - Intergenic
1200622736 Y:5473334-5473356 CTTGGGTACCAGGAGGAATGGGG - Intronic