ID: 1090403790

View in Genome Browser
Species Human (GRCh38)
Location 11:126465494-126465516
Sequence GCTCCTAGAACCCCACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090403788_1090403790 -3 Left 1090403788 11:126465474-126465496 CCACAGGGAGAAACCTGTAAGCT 0: 1
1: 0
2: 2
3: 12
4: 130
Right 1090403790 11:126465494-126465516 GCTCCTAGAACCCCACATTCTGG 0: 1
1: 1
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090403790 Original CRISPR GCTCCTAGAACCCCACATTC TGG Intronic
900277815 1:1843702-1843724 GCTCATAGAACCCCACACTAAGG + Intronic
901038633 1:6351084-6351106 GCTCCAAGAAACCCACCATCTGG + Intronic
902201060 1:14833879-14833901 GCTCTTAGACACCAACATTCTGG - Intronic
905665040 1:39758563-39758585 GCCACCAGAGCCCCACATTCAGG + Exonic
907239562 1:53074071-53074093 GCTCCAAGACCCCCAGATGCTGG - Intronic
913022468 1:114801727-114801749 GCTCCTCACTCCCCACATTCAGG - Intergenic
919838853 1:201594789-201594811 GCTCCCAGAGCCCCAGTTTCAGG - Intergenic
920035971 1:203065554-203065576 GAACCTAGAACCCCATGTTCAGG - Intronic
1063149065 10:3320528-3320550 GCTCCTTGGACCCCACAGTCTGG - Intergenic
1063402293 10:5757929-5757951 GCTCCTAGTAACACAAATTCAGG + Intronic
1068674971 10:59761442-59761464 GCTCCTAGAAGACCGCACTCAGG + Intergenic
1068879845 10:62036466-62036488 GCTGCTAGTACCTCACATTTGGG + Intronic
1071148471 10:82603243-82603265 GCTGCTAGAGCCCCACTCTCGGG + Intronic
1073111859 10:101067259-101067281 GCTCCTGGAACCTCACATCTCGG - Intronic
1076886340 10:133264380-133264402 GCTTCCAAAACCCCACATTCCGG - Intronic
1077646403 11:3929308-3929330 GCAGTTAGTACCCCACATTCTGG + Intronic
1085152101 11:74260421-74260443 GATTCTAGAACCCCAGAATCTGG + Intronic
1087745007 11:101933879-101933901 GTTCCTAGAACCCCAAGTTGAGG + Intronic
1088846583 11:113673380-113673402 GCCCCTAGAACCCCACTCTTAGG - Intergenic
1090403790 11:126465494-126465516 GCTCCTAGAACCCCACATTCTGG + Intronic
1092916270 12:13192290-13192312 CCTCCTAGTACCCCACTTTCTGG - Intergenic
1095549827 12:43421246-43421268 GCTACTTGAACCCTAAATTCTGG - Intronic
1095852026 12:46820691-46820713 GATCCTACAATCCCACTTTCTGG - Intronic
1096490139 12:52008617-52008639 GCACCTCTGACCCCACATTCTGG + Intronic
1096621912 12:52870563-52870585 GCTCCTTGACCCCCAGACTCGGG - Intergenic
1111274127 13:85925595-85925617 GCTCTTTGTACCCCACTTTCAGG + Intergenic
1124424240 15:29549804-29549826 GCTTCTAGAAACTCCCATTCAGG + Intronic
1124700569 15:31908623-31908645 GCTTCTGGAACCTCACATTCTGG - Intergenic
1127336607 15:57992443-57992465 GTGTCTAGAACCCCACCTTCTGG + Intronic
1127362131 15:58253238-58253260 ACTCCTAGAACCCCACATTCTGG - Intronic
1129468159 15:75735604-75735626 GCTCCAAGAACCCCACAGTGAGG + Intergenic
1130355276 15:83123979-83124001 GCTCCTAGAGCCCTATCTTCAGG + Intronic
1130694751 15:86119768-86119790 GCTACTAGGACCCCACAACCAGG - Intergenic
1133406708 16:5530341-5530363 GCTTCTAGAACCCCATTTTAAGG + Intergenic
1142565704 17:838835-838857 GCTCCAAGAACCCACCGTTCCGG + Intronic
1143323205 17:6081115-6081137 GTTCCCAGGACCCCCCATTCAGG + Intronic
1144212515 17:13027216-13027238 TCTCCTAGAACTCCAGAGTCAGG - Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145105674 17:20114023-20114045 GCTGCTAGAACCCTACAGTGGGG + Intronic
1147262998 17:39219643-39219665 TCTCCTTGAAGCCTACATTCTGG + Intronic
1152798972 17:82322337-82322359 CCTCCTAGAACCCCAGATGAAGG - Exonic
1158089553 18:53694497-53694519 TCTCCTACAACACCACACTCAGG + Intergenic
1158699595 18:59734272-59734294 GATCCCAGGAGCCCACATTCTGG - Intergenic
1165907613 19:39203465-39203487 GCTCCTAGACCCCCTCACCCTGG - Intronic
925249070 2:2414358-2414380 GCTACTAAAACTCCAAATTCCGG - Intergenic
926387464 2:12351215-12351237 GCTCTTAAAACTCCATATTCTGG - Intergenic
927668286 2:25047289-25047311 GCACCAAGAACCCCACAGCCTGG + Intronic
928375311 2:30768910-30768932 GTTCCTGGATCCCCACATCCTGG - Intronic
928375389 2:30769342-30769364 GGTCCTGGATCCCCACATGCTGG + Intronic
937684354 2:124679533-124679555 GATCCTAGAACCCAAAATGCTGG + Intronic
939379848 2:141420883-141420905 GCACCAAGCACCCAACATTCTGG - Intronic
939394822 2:141614893-141614915 TGTTCCAGAACCCCACATTCTGG - Intronic
939649023 2:144739383-144739405 GCTCCTGGAAGCACACATTTTGG - Intergenic
940337901 2:152547656-152547678 GCTCTTGCCACCCCACATTCTGG + Intronic
944371848 2:198993845-198993867 TCTCCTAGATCCCTAAATTCTGG - Intergenic
947647844 2:231757422-231757444 GCTCCTATAATCCCACCTACTGG - Intronic
1169912974 20:10662256-10662278 CATCCTAGAACCCCAAAATCGGG + Intronic
1170604175 20:17863559-17863581 GCTCCTAGAAAATCACATCCAGG + Intergenic
1172526739 20:35604308-35604330 GTTCCTGGAAGCCCACATTGGGG + Intergenic
1172670866 20:36633675-36633697 GCCCCGACAACCACACATTCAGG + Intronic
1172830614 20:37831049-37831071 GCCCATAGAACCCCAAATTCTGG + Intronic
1173754987 20:45508151-45508173 TGTCATAGAACCCCAGATTCAGG - Intergenic
1181904223 22:26180720-26180742 GCTCCTGGGACCCCACCTTGAGG - Intronic
1185334288 22:50264652-50264674 GCATCTAGGACCCCACAGTCAGG + Exonic
949699612 3:6741770-6741792 CCTCCTACAACCCCATTTTCAGG + Intergenic
954034989 3:47846608-47846630 GCACCTGGAAGCCCACATTCCGG - Exonic
955144434 3:56302179-56302201 GATCCCAGAAACCCAGATTCTGG - Intronic
956370569 3:68555019-68555041 GCTCAGAGAACCACAAATTCTGG - Intergenic
960804314 3:121568041-121568063 GCACTTAAAGCCCCACATTCTGG - Intergenic
961388306 3:126536841-126536863 CCACCAAGAACCCCACACTCTGG + Intronic
961733239 3:128983348-128983370 GCTCCTAGAATTCCACTTTAAGG + Intronic
962855498 3:139341069-139341091 GCTCCAAGAACCCCAGAGGCAGG - Intronic
966391681 3:179459380-179459402 GCTCTTAGAAGCCTACCTTCCGG + Intergenic
968541485 4:1170607-1170629 GGTCCGAGAAGCCCACCTTCTGG + Intronic
969588772 4:8109530-8109552 GTTCCCAGAACCCCACATCCCGG + Intronic
969861514 4:10039581-10039603 TCTCCTGGATCCCCACATTCAGG + Intronic
975807407 4:78127237-78127259 GCTCCTCCCACTCCACATTCAGG - Intronic
980113776 4:128659696-128659718 ACTCCTGGAAGCCCAAATTCTGG - Intergenic
981789857 4:148523794-148523816 TTTCCTAGAACCACAAATTCAGG + Intergenic
983132646 4:164041635-164041657 GGTGCTAGAACCACACATTAAGG - Intronic
983721201 4:170853743-170853765 GCTCCTAGAACACTACTTCCTGG - Intergenic
983800087 4:171917252-171917274 GCTTCTGGAACCCCACACTGTGG - Intronic
993753169 5:91695313-91695335 GCTCCTAGAAAAACACATTTGGG - Intergenic
997459059 5:134040007-134040029 GCTCCTGGAACCCCAAAATTGGG + Intergenic
1000863244 5:166481957-166481979 GCCCCTAATACCCCACATGCTGG - Intergenic
1004527551 6:16423511-16423533 GCCCCTAAAACCCCAAATCCCGG - Intronic
1011045145 6:83073405-83073427 GTTTCTGGAACCCCTCATTCAGG - Intronic
1013311928 6:108902709-108902731 GCTCTTAGAAGCCCACATAGAGG - Intronic
1013466855 6:110425361-110425383 GCTCCTAGGACAGCACCTTCAGG - Intronic
1015821836 6:137269696-137269718 TGTCATAGAACCCCAAATTCAGG + Intergenic
1016466884 6:144334508-144334530 TCCCCTAGAACCCCAAACTCGGG - Intronic
1019595351 7:1855881-1855903 GCTGCTGGAACCCCACAGACAGG + Intronic
1021816153 7:24449430-24449452 CCTCCAAGATCCCCACCTTCTGG + Intergenic
1023222485 7:37933681-37933703 AATCCTAGAACCCCAAATACCGG - Intronic
1024255733 7:47538706-47538728 CCTCCTAGAACACACCATTCTGG + Intronic
1028838762 7:95403226-95403248 GCTCCTATTACTCCACATCCTGG - Intergenic
1029541053 7:101182189-101182211 GTTCCTGGAATCCCACATACAGG + Intergenic
1035727222 8:1832051-1832073 GCTCCTCCAGCCCCACAGTCAGG - Intronic
1037964035 8:23119439-23119461 GCTCCCTGAAGCCCACAGTCTGG + Intergenic
1037976723 8:23219162-23219184 GCTCCCTGAAGCCCACAGTCTGG - Intronic
1038844828 8:31218956-31218978 GCAGCTAGAACCCCACAGTTGGG - Intergenic
1049153898 8:141055545-141055567 GCGCCCAGAGCCCCACACTCAGG + Intergenic
1056305209 9:85283601-85283623 CCTTCTAGGATCCCACATTCTGG - Intergenic
1061947966 9:133919440-133919462 GCTCCTGGAACCCCTCACCCAGG - Intronic
1187071611 X:15893945-15893967 TCTCCTAGATCCCCAACTTCTGG - Intergenic
1192145235 X:68677778-68677800 GCTCCTAGTTCCTCAGATTCTGG + Intronic
1194010483 X:88554552-88554574 GCTCCTGGAGACCCACATTTTGG - Intergenic
1196822109 X:119709904-119709926 GCTCCTACGACCTCCCATTCAGG + Intergenic
1198682257 X:139195211-139195233 GCTCCTAGATGCTCTCATTCCGG - Intronic
1201911997 Y:19142219-19142241 TCTTCCAGAACCCCACAATCTGG + Intergenic