ID: 1090404144

View in Genome Browser
Species Human (GRCh38)
Location 11:126467174-126467196
Sequence CCTGGGGCCCCGCAGAGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090404144_1090404151 15 Left 1090404144 11:126467174-126467196 CCGTGACTCTGCGGGGCCCCAGG 0: 1
1: 0
2: 2
3: 18
4: 247
Right 1090404151 11:126467212-126467234 GCCTGCTCAGGTGCCGCCTCAGG 0: 1
1: 0
2: 2
3: 19
4: 175
1090404144_1090404153 16 Left 1090404144 11:126467174-126467196 CCGTGACTCTGCGGGGCCCCAGG 0: 1
1: 0
2: 2
3: 18
4: 247
Right 1090404153 11:126467213-126467235 CCTGCTCAGGTGCCGCCTCAGGG 0: 1
1: 1
2: 4
3: 22
4: 210
1090404144_1090404150 3 Left 1090404144 11:126467174-126467196 CCGTGACTCTGCGGGGCCCCAGG 0: 1
1: 0
2: 2
3: 18
4: 247
Right 1090404150 11:126467200-126467222 TCTCTGGACGCTGCCTGCTCAGG 0: 1
1: 0
2: 3
3: 21
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090404144 Original CRISPR CCTGGGGCCCCGCAGAGTCA CGG (reversed) Intronic
900032387 1:381071-381093 CCTGGAGCTCTGCAGAGGCAAGG + Intergenic
900052937 1:609257-609279 CCTGGAGCTCTGCAGAGGCAAGG + Intergenic
900205578 1:1430783-1430805 CCTGAGGCCCCGCACCGCCAGGG + Intergenic
900270187 1:1783022-1783044 CCTGGCACCCCGCAGACTGAGGG - Intergenic
901146575 1:7069070-7069092 CCGGGGGCCCAGCAGGGTCAAGG - Intronic
901212150 1:7532873-7532895 CCTGGGGCCCCAAAGAGTTCAGG + Intronic
901401003 1:9015055-9015077 CCGGGGGCCAGGCAGAGACACGG - Intronic
901653126 1:10754524-10754546 CCTGGGGTCCAGTAGGGTCAGGG - Intronic
901941648 1:12666743-12666765 CCTGGGGCCCCGAGGAGGAAGGG + Exonic
902760169 1:18575749-18575771 ACTGGGGGCCAGCAGAGTCAAGG - Intergenic
903036209 1:20494273-20494295 GCTGTGGCCCCCCAGAGTCATGG + Intergenic
903374861 1:22859385-22859407 CCAGGGGCCCTGCAGAGTTTGGG + Intronic
904464344 1:30699010-30699032 CCTGGGGCCCTGCAGGCTCTGGG - Intergenic
904927779 1:34062173-34062195 CCTGGGTCCCAGCAAGGTCAAGG - Intronic
905749130 1:40446639-40446661 CCAGGGGCCACGGAGTGTCATGG - Intergenic
905885317 1:41488569-41488591 CCTGGGGCCACTCAGCCTCAGGG + Intergenic
911056396 1:93712058-93712080 ACTGGGGCTCAGCAGAGTGAAGG - Intronic
912208217 1:107531613-107531635 CCTGGGGATGCGCAGAGTCATGG - Intergenic
912518103 1:110228400-110228422 CCTGAGGCCAGGGAGAGTCAAGG + Intronic
915064934 1:153217180-153217202 CCTGGGGCCTCTCTGGGTCAAGG - Intergenic
915647730 1:157285884-157285906 CCTCAGGCCACGCATAGTCAAGG + Intergenic
915691471 1:157695349-157695371 CTGGGGGCCCAGCACAGTCATGG - Exonic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916172290 1:162010222-162010244 CCTTGGGCCAGGCAGAGCCAAGG + Intronic
919643524 1:200068233-200068255 CCTGGGGCAGAGCAGTGTCAGGG + Intronic
923091914 1:230747500-230747522 CCTGGGGCCCGGTAGAGGTAAGG - Exonic
923147835 1:231210233-231210255 GCTGGGGCCCAGCGAAGTCAAGG - Intronic
924123154 1:240823399-240823421 ACTTGGGCCCGGCAGAGGCAGGG + Intronic
1064855969 10:19767416-19767438 CATGGGCCACCGCAGTGTCACGG + Intronic
1066429476 10:35337351-35337373 CCCGGGGCCCCGCAGCCTCTGGG + Intronic
1067279343 10:44859546-44859568 CCTGAGGCCACGCAGAGAGAAGG + Intergenic
1068218072 10:54009687-54009709 CCTGGGGTGGCACAGAGTCAGGG + Intronic
1069249025 10:66245333-66245355 CCTGGGAGCTCCCAGAGTCAGGG - Intronic
1069658511 10:70107888-70107910 GCCTGGGCCCCACAGAGTCAGGG - Intronic
1069965150 10:72109153-72109175 CCTGGGGCACCTCAGATCCAAGG + Intronic
1071427242 10:85571404-85571426 CCTGAGTCCCAGCAGTGTCAAGG + Intergenic
1072485220 10:95848211-95848233 CCTGGGGACAGGCAGAGACAAGG - Intronic
1073250959 10:102120128-102120150 CTGGGGGCCCAGCCGAGTCACGG + Exonic
1073266401 10:102230767-102230789 CCTGGGGCCCTGCAGGGCCTGGG - Exonic
1075450252 10:122546357-122546379 CCTGGGGGCCAGCAGAGGCATGG + Intergenic
1076539715 10:131206382-131206404 CCTGGGGCCCCAGACAGCCAAGG + Intronic
1077014086 11:392378-392400 CCTGGGGCCCTGCAGGGGCCAGG - Intergenic
1078507662 11:11964753-11964775 CTGGGAGCCCCACAGAGTCAGGG - Intronic
1078553841 11:12301684-12301706 GCTGGGGCTCAGTAGAGTCAGGG + Intronic
1081484322 11:43516147-43516169 CCTGGGGCCTCTCAGAGCAAGGG + Intergenic
1081807148 11:45896841-45896863 CCTGGGGCCCCGCAGCCCCCCGG + Intronic
1082790548 11:57343868-57343890 CCTGGGGCCCTGCAGAGTGAAGG - Intronic
1084599168 11:70134749-70134771 CCTGGGGCCCGGCACAGTGTGGG - Intronic
1084731108 11:71074187-71074209 CCCGGTGCCCCCCAGGGTCAGGG + Intronic
1084949275 11:72655877-72655899 CCTCGGGCCCCCCAGAGTGGGGG + Intronic
1085316022 11:75545338-75545360 CCTGGGGACCCTCTGAGACATGG - Intergenic
1085756126 11:79202654-79202676 CCTGGGGACTCTGAGAGTCAAGG + Intronic
1089528987 11:119114334-119114356 CCTGGAGACCCGCAGCCTCAAGG + Exonic
1090225323 11:125068213-125068235 ACTGGGGCTCAGCAAAGTCAAGG - Intronic
1090404144 11:126467174-126467196 CCTGGGGCCCCGCAGAGTCACGG - Intronic
1091372656 11:135073826-135073848 CCTGGGGCTTCTCAGAGGCAAGG - Intergenic
1091438705 12:495712-495734 CCCTGAGCCCAGCAGAGTCAGGG - Intronic
1091959853 12:4684423-4684445 GCTGGGGCCCCACAGAGTCCTGG - Intronic
1096491585 12:52015637-52015659 CCTGGGGGCCCGCTGGGTCATGG - Exonic
1097154461 12:57002757-57002779 ACTGGGTCCCGGCAGAGCCACGG - Exonic
1097309126 12:58099655-58099677 TCTGGGGCACTGCTGAGTCATGG + Intergenic
1102078280 12:110077229-110077251 CATGGGACCCAGGAGAGTCATGG - Intergenic
1102426075 12:112845360-112845382 CTTTGGGCCCCACAAAGTCATGG - Intronic
1103649498 12:122422201-122422223 CCTGGGGCGGCGCAGGGGCAAGG + Intronic
1104812757 12:131628551-131628573 CTCGGGGTCCCGCAGACTCAGGG + Intergenic
1105851592 13:24340448-24340470 CCTGGGGTCCCGCAGCGCCTGGG + Intergenic
1106031663 13:26010473-26010495 CCTGGGGCCAGGCAGGGTGAGGG + Intronic
1108746167 13:53396801-53396823 ACTGGGGTCCCGCAGAGCAAAGG - Intergenic
1113759113 13:112835412-112835434 CCAGGAGCCCCGCCGAATCAAGG - Intronic
1113922343 13:113920147-113920169 CATGGGGCCCAGCACACTCAGGG - Intergenic
1113922357 13:113920210-113920232 CATGGGGCCCAGCACACTCAGGG - Intergenic
1114582533 14:23775562-23775584 CCTGAGGCCCCGCAGTGCCATGG + Intergenic
1122346925 14:101066570-101066592 CCTGTGGGCCCCCAGAGGCATGG + Intergenic
1122767240 14:104081113-104081135 CCTGAGGCCCCCCAGCCTCAGGG + Intergenic
1122800144 14:104225307-104225329 CCTGGGGCAGCTCAGAGTGAAGG + Intergenic
1122800211 14:104225587-104225609 CCTGGGGCAGCTCAGAGTGAAGG + Intergenic
1122945628 14:105007373-105007395 CCAGGGGCACAGCAGAGTGAGGG + Intronic
1123735540 15:23179883-23179905 CCACGGGCCCCGCAGAGCCAGGG + Intergenic
1124127072 15:26945775-26945797 CCTGGGACTCAGCATAGTCACGG - Intronic
1124286255 15:28402866-28402888 CCACGGGCCCCGCAGAGCCAGGG + Intergenic
1124296448 15:28508770-28508792 CCACGGGCCCCGCAGAGCCAGGG - Intergenic
1125241636 15:37582886-37582908 CCTTGGGGCCCCCAGAGCCAGGG + Intergenic
1127267655 15:57374791-57374813 CCTAGGAACCAGCAGAGTCATGG - Intergenic
1129407482 15:75328888-75328910 CCTGGGGTCCAGGAAAGTCAAGG - Intergenic
1132632771 16:927889-927911 TCTGGGGCCCCGCACACGCACGG + Intronic
1132663551 16:1071915-1071937 CCTGGGTCGGCACAGAGTCAGGG + Intergenic
1132672896 16:1108953-1108975 TGTGGGGCCCCACAGAGACAGGG + Intergenic
1132761189 16:1509341-1509363 CCTGGGGCCCCGGGGAGCCTTGG - Intronic
1132809666 16:1791484-1791506 CCTGCGGCCCCGCACCTTCAAGG - Exonic
1133000708 16:2850108-2850130 CCTGTTGCCCTGCAGAGGCAGGG + Intergenic
1134128480 16:11632519-11632541 GCTCTGGGCCCGCAGAGTCAGGG - Intronic
1136364137 16:29801089-29801111 GCTGGCTCCCCGGAGAGTCATGG - Intronic
1137702640 16:50507930-50507952 CCTGGGGCGCAGCAGGGTGAAGG + Intergenic
1138519906 16:57565070-57565092 CTGGGGGCCCAGCTGAGTCATGG + Exonic
1141557896 16:84848099-84848121 CGGGGGGCCATGCAGAGTCAGGG - Intronic
1141709345 16:85688934-85688956 CCTCGGGCCCCTCAGCGTCCCGG + Exonic
1142984578 17:3688207-3688229 CCTGGGGCTGCTGAGAGTCAGGG - Intronic
1144339394 17:14299750-14299772 CCTCTGGCCCCGCAGAGGCTGGG + Intergenic
1144568271 17:16378758-16378780 CCTGGTGCCTGGCACAGTCACGG - Intergenic
1145118321 17:20232404-20232426 CCTGGTGCCCACCAGACTCACGG - Exonic
1147700052 17:42388213-42388235 CCGGGGGCTCCGCAGCGGCAGGG - Intronic
1148000687 17:44385422-44385444 CCCAGGGCCCCGCCGACTCAAGG - Intronic
1148822000 17:50365188-50365210 CCTGGGTTCCCTCTGAGTCAGGG + Intergenic
1151627088 17:75283670-75283692 CCTGGGCCCCAGCCGGGTCACGG - Intronic
1151725007 17:75878545-75878567 CCTGGGCGGCCGCGGAGTCATGG - Exonic
1152360747 17:79832117-79832139 CCTGGCGCCCCGCACAGACCCGG + Intergenic
1152523458 17:80873834-80873856 CCTGAGGCCACGCTGAGTCATGG - Intronic
1152705874 17:81843396-81843418 CCTGGGGCCCGGCACAGGCCTGG - Exonic
1152947540 17:83206043-83206065 CCTGGAGCTCTGCAGAGGCAAGG - Intergenic
1157473559 18:48007753-48007775 CATGGGACCCAGCAGAGTGAGGG + Intergenic
1160191199 18:76715204-76715226 CCTAGGACCCCGCAGTGTCCTGG - Intergenic
1160464913 18:79068828-79068850 CGTGGGGCCCCACACAGCCATGG + Intergenic
1160700890 19:506805-506827 CCGGGGGCCCTGGAGAGCCATGG + Intergenic
1160909961 19:1469798-1469820 CGTGGAGCCCCGCAGTGGCAGGG - Exonic
1160963289 19:1734289-1734311 CCTCGAGCCCCGCAGAGTGGGGG + Intergenic
1161066671 19:2242006-2242028 CCTGGGCCCCCATAGAGTAAGGG + Intronic
1162558036 19:11399869-11399891 CCTGGGGCCCTGGAGAGGCCGGG + Exonic
1163170096 19:15525314-15525336 CCTGGGGACACACAGGGTCAGGG - Exonic
1163827957 19:19534115-19534137 GCTGGGGCCACGCAGAATCAGGG + Intronic
1164842609 19:31404469-31404491 CCTGTGGCCCCGCACAGTGTTGG + Intergenic
1165161698 19:33820420-33820442 CCCGGGTCCCCGCAGGGCCAAGG + Intergenic
1165358264 19:35317495-35317517 CCTGGGGCCCAGCATAGGCCTGG - Intergenic
1166094429 19:40530386-40530408 CCTGGGGCCCCGCAAAGAGGCGG + Intronic
1166170918 19:41027207-41027229 CCTGGGGCCCCGGCGGGTCGTGG - Intergenic
1166299411 19:41905698-41905720 CCTGGGGGGCCGCAGGGGCAGGG - Intronic
1166299419 19:41905705-41905727 CCTGCGGCCCCCCAGGGCCAGGG + Intronic
1166311953 19:41967813-41967835 CCTGCCACCCCGCAGAGACAGGG + Intronic
1166718317 19:44983247-44983269 CCTGGGGCCAGGGAGAGACAGGG - Intronic
1167006990 19:46782628-46782650 ACTGGGACCCAGCAGAGACAAGG + Intronic
1168292557 19:55363608-55363630 CCTGGGGCCCCGCACTGCCTAGG + Intergenic
925020380 2:563473-563495 CCTGGGGGCCCGCAGTGCCTGGG - Intergenic
926905821 2:17804730-17804752 CCAGGGACCCCGCAGGGACATGG + Intergenic
927030866 2:19119354-19119376 ACTGGGACCCAGCAGAGACATGG + Intergenic
927516047 2:23672225-23672247 CCTGGGCCCCCACAGTGACATGG + Intronic
927702622 2:25277460-25277482 CCCGGAGCCCCGCCGCGTCAGGG - Intronic
927847060 2:26477104-26477126 TCTGGGGCCCCTCAGGATCAGGG - Intronic
928355583 2:30611535-30611557 CATGGGGCAGAGCAGAGTCAGGG - Intronic
928448015 2:31350097-31350119 CCTGGGGCCCCCCAAAGCCCCGG + Exonic
929414896 2:41737336-41737358 CCAGGAGACCCGCAGAGTCTGGG + Intergenic
931111254 2:59113872-59113894 CCTGTAGCCCCGCAAAGGCAGGG - Intergenic
937114914 2:119398011-119398033 CCTTGGTCCCCGCAGAAGCAGGG + Intergenic
938152824 2:128901657-128901679 CCTGGGTCCCCTGAGGGTCACGG - Intergenic
938308339 2:130269078-130269100 CCATGGGCCCCCCAGAGACAGGG + Intergenic
938446990 2:131387758-131387780 CCATGGGCCCCCCAGAGACAGGG - Intergenic
948781437 2:240324171-240324193 CCTGGGGCCCCGAAGGGCCGAGG - Intergenic
1168956249 20:1836472-1836494 GCTAGGGCCACGCAGAGTGAAGG - Intergenic
1170562666 20:17570265-17570287 TCTGGGGCGCCGCGGAGTCGGGG + Intronic
1170600167 20:17835813-17835835 CCTCAGGCCCAGCTGAGTCAAGG + Intergenic
1172163662 20:32885719-32885741 CCTGGAGCCAGGCAGATTCATGG + Intronic
1172836979 20:37879295-37879317 CCTGGGGCCCAGGAGAGCCTGGG + Intergenic
1173594167 20:44247959-44247981 CCTGGGGGCCTGCAGTGTCCGGG - Intronic
1173601986 20:44302024-44302046 CCAGAGGCCCTGGAGAGTCAGGG - Intergenic
1174430081 20:50461147-50461169 ACTGAGGCCCAGGAGAGTCATGG - Intergenic
1174578857 20:51556772-51556794 CCCGGAGCCCCGGAGTGTCAGGG + Intronic
1175653731 20:60750854-60750876 CCTGGGGACCTCCACAGTCAGGG + Intergenic
1175861431 20:62152160-62152182 CCTGGGGCTCCGCTGCCTCATGG + Intronic
1175875769 20:62228521-62228543 CCTGGAGTCCCGCAGATCCAGGG + Intergenic
1175979802 20:62732819-62732841 CCTGGAGCCACGCAGGGACACGG - Intronic
1176096447 20:63346629-63346651 CGTGTGGCCCCACAGAGTCCAGG + Exonic
1180142262 21:45899807-45899829 CCTCAGGCCACGCAGAGCCAGGG - Intronic
1180252047 21:46596409-46596431 CCTGGGGCCCTGCAGAGGTGGGG + Intergenic
1180255022 21:46621025-46621047 CCTGGGCATTCGCAGAGTCATGG - Intergenic
1180801639 22:18634653-18634675 CCTGGGGCCCCGCAAGGTGGCGG + Intergenic
1180852883 22:19030192-19030214 CCTGGGGCCCCGCAAGGTGGCGG + Intergenic
1181174622 22:21028584-21028606 CCTGGGACCACCCTGAGTCAGGG - Exonic
1181220084 22:21360608-21360630 CCTGGGGCCCCGCAAGGTGGCGG - Intergenic
1182648463 22:31829783-31829805 CCTGCTGCCCAGCAGAGACAGGG + Intronic
1182739409 22:32556552-32556574 CCTGGAGCGCCACAGACTCATGG - Intronic
1183676033 22:39299375-39299397 CCTGGAGCCGTGCAGAGCCATGG - Intergenic
1184278081 22:43421639-43421661 CCTGGTGCCCAGCAGAGGCTTGG - Intronic
1185320959 22:50200133-50200155 GCTGGGGTCACGCAGAGTCTCGG + Intergenic
1185322956 22:50210321-50210343 CCTGGGGCCCAGCAAAGTGCAGG + Intronic
1185415227 22:50705818-50705840 CCTGGGAACCCCCAGAATCAGGG - Intergenic
951536371 3:23744279-23744301 CCTGGAGCCCCACATAGGCAGGG + Intergenic
953722232 3:45366491-45366513 CCTGGGGCCCCACCAATTCAAGG + Intergenic
954144776 3:48629080-48629102 CCTGGAGCCCAGCAGAGACCCGG - Intronic
954420952 3:50418775-50418797 GGTGGGGCCCCTCAGAGGCATGG + Intronic
961432086 3:126890494-126890516 CCAGGGGCCTCGCAGAGTCCTGG - Intronic
962850156 3:139302228-139302250 CCTGAAGCCCCTCAGACTCAGGG + Intronic
966851004 3:184164988-184165010 CCAGGGGCCCCGCATCCTCAGGG - Intronic
967965380 3:194956470-194956492 CCTGGGGCCCAGGAGAGGAATGG - Intergenic
968540810 4:1167431-1167453 CCTGGGGCCCCCCGGAGCCATGG - Exonic
969172981 4:5378921-5378943 CCTGGGGTCTCACAGAGGCAGGG - Intronic
969313417 4:6367428-6367450 CCTGTGTCCGCGCAGAGCCAGGG - Intronic
969532186 4:7736209-7736231 CCTGGGGCCCGGCAGGGGCTTGG + Intronic
969603151 4:8188872-8188894 CCTGGGACACCGGAGAGACAGGG - Intronic
973636909 4:52869279-52869301 CCTGGAGCCCGGCAGAATCCAGG - Intergenic
986721889 5:10565494-10565516 GCCGGGGCTCCCCAGAGTCAGGG + Intronic
998095981 5:139395697-139395719 CCTGAGGCCCTGAGGAGTCAGGG - Exonic
999799506 5:155019823-155019845 CCTGGGGCCCCGGAGGGTGCAGG + Intergenic
1000296349 5:159916425-159916447 CCTAGTGCCGCGCGGAGTCAGGG + Intergenic
1001043026 5:168350461-168350483 CCTGGGGACCAGCAGAGGAAGGG - Intronic
1001431609 5:171666981-171667003 CGTGGTGCCCCACAGAGGCAGGG + Intergenic
1001522334 5:172403472-172403494 CCTGGGGCCCAGCGGGGTCCTGG + Intronic
1002106134 5:176880204-176880226 CCAGGGGCCCCGCATACACACGG + Exonic
1002643087 5:180639914-180639936 CCTGAGGCCCCGCAAAGCCCTGG + Intronic
1002741433 5:181437797-181437819 CCTGGAGCTCTGCAGAGGCAAGG - Intergenic
1005136059 6:22570463-22570485 CCTGGGGCCCGGCAGGGCAAAGG - Exonic
1005321907 6:24663736-24663758 CCTGAGGCCCAGCAGAGGCTGGG + Intronic
1005957890 6:30677197-30677219 CCTGGAGCCCGGAAGATTCAGGG - Exonic
1006420602 6:33931508-33931530 CCTGGGGCTTCCCAGAGACAGGG - Intergenic
1006961439 6:37934580-37934602 CCTGGGGCCTCCCAAAGTCCTGG - Intronic
1009972450 6:70639242-70639264 ACTGGGGCCTCACAGATTCATGG + Intergenic
1013345310 6:109254385-109254407 CTTGGGGCCCAGCAGAGCGACGG - Intergenic
1013479502 6:110541862-110541884 CCTGGGGCCTGGCAGTGCCAGGG + Intergenic
1013710611 6:112892940-112892962 ACTGAGGCTCCCCAGAGTCAAGG - Intergenic
1017978486 6:159377843-159377865 CCTGGGGACCAGCAGAGGCCAGG + Intergenic
1018028346 6:159822723-159822745 GCTGGGGCCCGGCACTGTCACGG - Intergenic
1019130474 6:169869407-169869429 CCTGGGGCCCTGGAGAGGCACGG + Intergenic
1019187917 6:170231736-170231758 CCTGGGGCCCCGCACTATCTGGG - Intergenic
1019246567 6:170713562-170713584 CCTGGAGCTCTGCAGAGGCAAGG - Intergenic
1019273625 7:164479-164501 CCTGGAGCTCAGCAGAGTGAGGG - Intergenic
1019338247 7:495110-495132 CCTGGGGTGGGGCAGAGTCAAGG + Intergenic
1019352536 7:561760-561782 TCTGGGGCCCGGCAAAGGCACGG + Intronic
1019639980 7:2098182-2098204 CCTGGGGCCTCAAAGACTCAAGG - Intronic
1019735564 7:2648350-2648372 CCTGGGGCCACCCAGAGACCAGG + Intronic
1020089816 7:5332835-5332857 CTTGGGGCCCCGCAGCTTCCGGG + Exonic
1020111643 7:5451210-5451232 CCTGGGGCCCCACACAGTGGGGG - Intronic
1020292173 7:6730276-6730298 CCTGGGGCTCCCCAGAGGCCGGG - Intergenic
1023966975 7:44967821-44967843 CCTGGGGCCCCAGAGACTCTGGG - Intronic
1026965998 7:74440585-74440607 CCTGGGGACCTGCTGAGCCAGGG - Intergenic
1029158729 7:98535841-98535863 CCTGGAGCCCTCCAAAGTCAAGG + Intergenic
1029688749 7:102166398-102166420 CCTGTGTCCCTGCAGAGACAGGG - Intronic
1030087965 7:105833173-105833195 CCTGGGGACCAGCAGATCCAAGG - Intronic
1032491847 7:132329721-132329743 CCTGAGGGCCCCCAGAGACAAGG - Intronic
1034213243 7:149383256-149383278 CCTGGGGCCCTGCAAAGTCAAGG + Intergenic
1034946260 7:155263675-155263697 CCTGGCGCCCCGCAGTGGCGTGG + Intergenic
1035501572 8:94399-94421 CCTGGAGCTCTGCAGAGGCAAGG + Intergenic
1037752772 8:21693466-21693488 CCTGGGACCCGGCAGAGAAACGG + Intronic
1040022533 8:42753824-42753846 CCTGGTGACCCACGGAGTCAGGG - Intronic
1040373002 8:46795485-46795507 ACTGGGGCCCCAGAGTGTCATGG + Intergenic
1040543485 8:48379925-48379947 CCCGGGGCCGCGCACAGGCACGG - Intergenic
1040806148 8:51398355-51398377 CTTGGGGCCCCCCACAGTCCTGG + Intronic
1041437605 8:57859882-57859904 CCTGGACTCCGGCAGAGTCATGG + Intergenic
1047082484 8:121478623-121478645 CCTGCAGCCCTGCAGAGTCTAGG - Intergenic
1047208244 8:122820314-122820336 CCTTGGGCCCCTCAGAGGCGAGG + Intronic
1048330257 8:133466198-133466220 CCGGGGGCCCAGCAGAGAGAAGG - Intronic
1049543876 8:143220686-143220708 CCTGAGGCGCTGCAGGGTCAAGG - Intergenic
1049675217 8:143886183-143886205 CCTGGGGCCCAGCACAGTGGTGG - Intergenic
1056103910 9:83328023-83328045 CCTGGGGCCATGCAGGGACAAGG + Intronic
1057266003 9:93618283-93618305 ACTGGGGCCCCCCAGGGGCAAGG + Intronic
1060213000 9:121721913-121721935 GATGGGGCCCCGCCCAGTCATGG + Intronic
1060224620 9:121783370-121783392 CCTGGGGCCCAGCACACCCAGGG + Intronic
1060402444 9:123356506-123356528 CGTGGAGCCCCACAGAGTCTGGG - Intronic
1060995486 9:127873132-127873154 CCTGGGGCCCAGCACAGGCCTGG - Intronic
1061315847 9:129795342-129795364 CCTAAGGCCCTGCAGAGTAAGGG - Intergenic
1061920265 9:133778733-133778755 CCTGGGGCCCGGGAGGGTCGAGG - Intronic
1062046259 9:134425804-134425826 GCAGGGCCCCCCCAGAGTCACGG - Intronic
1062055954 9:134469915-134469937 CCTGGGGCCCTCCTAAGTCAGGG + Intergenic
1062056113 9:134470471-134470493 CCTGGGGTCCTCCTGAGTCAGGG + Intergenic
1062056221 9:134470875-134470897 CCTGGGGTCCTCCTGAGTCAGGG + Intergenic
1062056295 9:134471152-134471174 CCTGGGGCCCTCCTGAGTCAGGG + Intergenic
1062056531 9:134471986-134472008 CCTGGGACCCTCCTGAGTCAGGG + Intergenic
1062494028 9:136823185-136823207 CCTGGTGACCCTCAGGGTCAGGG - Intronic
1062543935 9:137053517-137053539 CCTGGGGGCCCGCACAGGCCTGG + Intronic
1203607344 Un_KI270748v1:69013-69035 CCTGGAGCTCTGCAGAGGCAAGG - Intergenic
1189351482 X:40278995-40279017 CCTGGGGCCCGGCAGAGTTTGGG + Intergenic
1190561585 X:51691211-51691233 GCTGGGGGCCCGCAGTCTCAGGG - Intergenic
1190562706 X:51702104-51702126 GCTGGGGGCCCGCAGTCTCAGGG + Intergenic
1191110354 X:56799291-56799313 GCTGGGGCCACGCAGGGACAGGG - Intergenic
1192266852 X:69544421-69544443 CCTGGGTCCCTGCAGTGCCAGGG - Intergenic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1194434166 X:93849307-93849329 CCTGGGGCCCAGCAGTGATAGGG - Intergenic
1195687735 X:107601428-107601450 GCTGGGGCTCTGCAGAGCCATGG - Exonic
1195935903 X:110125560-110125582 GCTGGGGGCCCCCAGAGTCCTGG + Intronic
1197772484 X:130098096-130098118 CCTGGAGCCCCCCTGAGCCATGG + Intronic
1200097773 X:153672220-153672242 CCTGTGGGCCAACAGAGTCAAGG + Intronic
1200120839 X:153789824-153789846 CCTGAGGCACGGCAGGGTCAGGG + Exonic