ID: 1090407685

View in Genome Browser
Species Human (GRCh38)
Location 11:126486965-126486987
Sequence TATGAGGCTCGTTGAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090407685_1090407690 1 Left 1090407685 11:126486965-126486987 CCACCTCCTCAACGAGCCTCATA 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1090407690 11:126486989-126487011 TTTCAGTAAGGACGAAAATGAGG 0: 1
1: 0
2: 0
3: 20
4: 242
1090407685_1090407691 6 Left 1090407685 11:126486965-126486987 CCACCTCCTCAACGAGCCTCATA 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1090407691 11:126486994-126487016 GTAAGGACGAAAATGAGGCCAGG 0: 1
1: 0
2: 3
3: 33
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090407685 Original CRISPR TATGAGGCTCGTTGAGGAGG TGG (reversed) Intronic
900228128 1:1542357-1542379 TGTGAGGGTCGGTGGGGAGGTGG - Intronic
901406157 1:9047558-9047580 TGTGAGGGTCGTCAAGGAGGAGG - Intronic
902375500 1:16028356-16028378 TTTGAGGCTCAGTGAGGGGGTGG - Intronic
905447145 1:38034810-38034832 TGTGAGGCTGGGTGTGGAGGTGG + Intergenic
907372179 1:54010690-54010712 AAGGAGGCTCTTTGTGGAGGGGG - Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
911863866 1:102991156-102991178 TATGGTGCTTGTGGAGGAGGTGG + Intronic
914872174 1:151484322-151484344 TATGATGCTTGTGGAGGAAGGGG - Intergenic
915005086 1:152628419-152628441 GAGGAGGCTCTTTGATGAGGTGG - Intergenic
915940885 1:160117549-160117571 TAAGAGGCTGGGTGAGGTGGGGG + Intronic
917018259 1:170558983-170559005 GATGAGGCTTTTTGGGGAGGCGG - Intergenic
920918733 1:210280087-210280109 AATGAGGCTTGGTGAGAAGGGGG + Intergenic
1063171549 10:3514267-3514289 TATGAGGCTCTTTCAGGGAGAGG + Intergenic
1063641938 10:7838753-7838775 TAGGAGGCTGGGTGTGGAGGAGG - Intronic
1075331558 10:121577861-121577883 GAAGAGGCTGGTGGAGGAGGAGG - Intronic
1081856215 11:46305358-46305380 TATGAGGCGGGTGGAGGAGGCGG - Intronic
1089064524 11:115652388-115652410 CATGAGGCTCCTGGAGCAGGAGG + Intergenic
1090407685 11:126486965-126486987 TATGAGGCTCGTTGAGGAGGTGG - Intronic
1092491447 12:8949460-8949482 TGTGAGGGGCGTGGAGGAGGAGG - Intronic
1096231261 12:49898092-49898114 TGTGTGGCACGTGGAGGAGGAGG + Intronic
1096500372 12:52060917-52060939 ACTGAGGCTCGGTGAGGAGGAGG - Intergenic
1096828148 12:54294956-54294978 ACTGAGGAACGTTGAGGAGGAGG - Intronic
1102244719 12:111348063-111348085 CATGAGGCCTGGTGAGGAGGCGG - Exonic
1105795530 13:23848655-23848677 GATGAGGCTCCTAGAAGAGGGGG + Intronic
1114314539 14:21497456-21497478 TACGTAGCTGGTTGAGGAGGAGG - Exonic
1120202447 14:81552796-81552818 CATGAACCTCTTTGAGGAGGAGG - Intergenic
1125205934 15:37153602-37153624 GATCAAGCTCCTTGAGGAGGTGG + Intergenic
1129005165 15:72366751-72366773 CAGGAGGGTGGTTGAGGAGGAGG - Intronic
1129693831 15:77729343-77729365 ACTGAGGGTCCTTGAGGAGGAGG + Intronic
1130555248 15:84918150-84918172 TCTGAGGGTCGTTGTGAAGGTGG - Intronic
1133510130 16:6450077-6450099 TTTGTGCCTCTTTGAGGAGGTGG + Intronic
1133564693 16:6982474-6982496 CATGAGAGTCGTTGACGAGGTGG + Intronic
1137908571 16:52351895-52351917 TTTGTGACTCATTGAGGAGGAGG - Intergenic
1138142584 16:54581574-54581596 TTAGAGTCTCATTGAGGAGGTGG + Intergenic
1141763030 16:86041268-86041290 CATGAGGCTCCTTGAGCAAGGGG - Intergenic
1142408680 16:89905129-89905151 GATGAGGGTCCCTGAGGAGGGGG - Intronic
1152900394 17:82937760-82937782 TCTGTGGCTCCTTGAGGTGGGGG + Intronic
1153755744 18:8281102-8281124 TATGATGTTCATTGAGCAGGGGG - Intronic
1155169276 18:23255130-23255152 TGTGAGGCCCATGGAGGAGGTGG + Intronic
1158753148 18:60289786-60289808 TCTGATCCTCTTTGAGGAGGGGG - Intergenic
1158863225 18:61613497-61613519 AATGAGGGTCTTTGAGAAGGTGG - Intergenic
1162856940 19:13475972-13475994 TATGAGGCTATATAAGGAGGCGG + Intronic
1168468557 19:56622919-56622941 TCTGAGGCTCAGTAAGGAGGGGG - Exonic
925695080 2:6568063-6568085 TTTGAGGCTGGTTGAGAAGAGGG - Intergenic
928435738 2:31253482-31253504 TATGAGGCTCAGTGAGCAGAAGG - Intronic
929654240 2:43714775-43714797 TATGAGGCTCTCTGAGGAATGGG - Intronic
929803091 2:45121024-45121046 GATGAGGGTCATTGAGGAGAAGG + Intergenic
931781524 2:65582805-65582827 TAGAAGGCGCGTTGAAGAGGAGG + Intergenic
932788477 2:74630487-74630509 ACTGGGGCCCGTTGAGGAGGCGG - Intronic
932906112 2:75754012-75754034 GTTGAGGGTCATTGAGGAGGAGG - Intergenic
932937287 2:76119305-76119327 TATAAGTCCCGTTGAGGAGATGG + Intergenic
935171203 2:100612593-100612615 GGTGAGGCTGGTTGGGGAGGAGG + Intergenic
946370817 2:219280240-219280262 AAAGAGGCTCTATGAGGAGGAGG + Intronic
1168979038 20:1989388-1989410 ACTGAGGCTTGTGGAGGAGGTGG - Intronic
1175327476 20:58139930-58139952 CATGAGGCTTGGTGAGGACGTGG + Intergenic
1183248967 22:36714799-36714821 AATGAGGCTCCGTGAGGGGGAGG - Intergenic
1184710416 22:46246368-46246390 TCTGAGGCTCATGGAGGAGCTGG - Intronic
1185391086 22:50562185-50562207 GGTGAGGCTGGGTGAGGAGGCGG + Intronic
949411559 3:3771018-3771040 GATGAGGCTCGATGGGGATGTGG + Intronic
950488261 3:13285482-13285504 GCTGAGGCTCTTTGAGGAAGAGG - Intergenic
952871228 3:37903041-37903063 TTTGAGGCTCTTTGAGATGGTGG + Intronic
955581690 3:60429833-60429855 TAAGAGGCTAAGTGAGGAGGTGG + Intronic
960040902 3:113148973-113148995 TGGGAGGCTGGTGGAGGAGGAGG - Intergenic
962587470 3:136856935-136856957 GATGAGGCTAGTTGTGGATGGGG - Intergenic
967858557 3:194135259-194135281 TCTGCGGCGCGTTGAGGTGGCGG - Intergenic
968049444 3:195644125-195644147 TATGAGAGTCGTTGAGCTGGAGG + Intergenic
968097959 3:195945501-195945523 TATGAGATTCGTTGAGCTGGAGG - Intergenic
968305174 3:197645807-197645829 TATGAGAGTCGTTGAGCTGGAGG - Intergenic
978618284 4:110616390-110616412 TAGGAGGGTCGTTGTGGAGGTGG - Intergenic
985506107 5:281389-281411 TATGAGAGTCGTTGAGCTGGAGG + Intronic
986977297 5:13409455-13409477 AATGAGGCAGGTGGAGGAGGTGG - Intergenic
988065790 5:26228085-26228107 TATGAGAGTCGTTGAGCTGGAGG - Intergenic
989002925 5:36779936-36779958 TATTAGGCAGGTTGAGGATGGGG - Intergenic
991562201 5:67965614-67965636 TATAAGACTCTTTGGGGAGGTGG - Intergenic
992370152 5:76135418-76135440 TATGGGGCTGGTGGTGGAGGAGG + Intronic
998083013 5:139292637-139292659 CAGGAGGGTCGTTGAGGCGGAGG - Intronic
999249313 5:150172652-150172674 TAAGAGGCTGGGGGAGGAGGGGG + Intronic
1001753736 5:174150557-174150579 TAGAAGGCTGGCTGAGGAGGTGG + Intronic
1005336812 6:24805122-24805144 TGTGATGCTCTTTGAGGTGGAGG - Exonic
1006654031 6:35575193-35575215 AAGGAGGCTGGCTGAGGAGGGGG + Exonic
1006919745 6:37619552-37619574 ACTGAGGCTCCTTGAGGATGGGG - Intergenic
1016691790 6:146946332-146946354 TATGAAGCTCTTTATGGAGGTGG + Intergenic
1019165261 6:170094251-170094273 CATGAGGCTGGTTCAGGGGGAGG - Intergenic
1020728688 7:11851144-11851166 TGTGATGCTGGATGAGGAGGGGG + Intergenic
1022055177 7:26723539-26723561 TGTGAGGGTGGGTGAGGAGGGGG + Intronic
1023643272 7:42282944-42282966 TATGAGGCTCTCTGAGCAGCTGG + Intergenic
1024095140 7:45976934-45976956 TGTGGGGCTCCTTGAGGATGGGG + Intergenic
1024275648 7:47674586-47674608 TATGGGGCACGGTGAGGAGCTGG + Intergenic
1028455146 7:91030522-91030544 TATGGGGCTCTTGGAAGAGGTGG - Intronic
1028470397 7:91200032-91200054 ATTGAGGCTCCTTGAGAAGGGGG - Intronic
1032908718 7:136404336-136404358 TATGGGGCTCCTGGAGGGGGTGG + Intergenic
1033408388 7:141092877-141092899 TATGGGGCTCTCTGAGGAAGAGG + Intronic
1033918122 7:146353222-146353244 CATGAGACTCAGTGAGGAGGAGG - Intronic
1044455601 8:92389325-92389347 TATGAGGCTTGTAGAGGCAGGGG + Intergenic
1048283311 8:133121317-133121339 CCTGAGCCTCTTTGAGGAGGGGG + Intronic
1049415796 8:142494482-142494504 TATGTGGCTGGAAGAGGAGGTGG - Intronic
1051864997 9:21670171-21670193 TATGATTTTCGTTGAAGAGGGGG + Intergenic
1057185637 9:93056150-93056172 TCTGAGGCTGGTTCTGGAGGTGG - Intergenic
1058769310 9:108215035-108215057 CAGTAGGCTCGATGAGGAGGTGG - Intergenic
1061861964 9:133472789-133472811 GATGAGGCACGGTGGGGAGGTGG + Intronic
1062317252 9:135974029-135974051 AGGGAGCCTCGTTGAGGAGGAGG - Intergenic
1062634045 9:137480682-137480704 GCTGAGGCTCGTTGAGGGGCAGG + Intronic
1190303289 X:49068435-49068457 AAAGAGGCTCGTTAAAGAGGTGG - Intronic
1191952551 X:66608834-66608856 TATCAGGCACTTTGGGGAGGGGG + Intronic
1198212984 X:134532445-134532467 CATGATGCCCGTTGAGTAGGTGG + Intergenic
1199282335 X:146016528-146016550 TGTGAGGCTAGATGAGAAGGAGG + Intergenic
1199874651 X:151920629-151920651 TATGAGGCTGGTTGGGGGGTTGG - Intronic
1201751419 Y:17436141-17436163 TATGAGTGTCAGTGAGGAGGTGG + Intergenic