ID: 1090408847

View in Genome Browser
Species Human (GRCh38)
Location 11:126493782-126493804
Sequence CTGGGCAAACACATGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 164}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090408830_1090408847 28 Left 1090408830 11:126493731-126493753 CCCTCACCCACAGCAGCCTGCAT 0: 1
1: 0
2: 2
3: 47
4: 385
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408829_1090408847 29 Left 1090408829 11:126493730-126493752 CCCCTCACCCACAGCAGCCTGCA 0: 1
1: 1
2: 6
3: 73
4: 543
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408832_1090408847 22 Left 1090408832 11:126493737-126493759 CCCACAGCAGCCTGCATCTTCTA 0: 1
1: 0
2: 2
3: 22
4: 281
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408834_1090408847 12 Left 1090408834 11:126493747-126493769 CCTGCATCTTCTACTCTGCCCCC 0: 1
1: 0
2: 3
3: 35
4: 326
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408828_1090408847 30 Left 1090408828 11:126493729-126493751 CCCCCTCACCCACAGCAGCCTGC 0: 1
1: 0
2: 5
3: 86
4: 771
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408833_1090408847 21 Left 1090408833 11:126493738-126493760 CCACAGCAGCCTGCATCTTCTAC 0: 1
1: 0
2: 1
3: 35
4: 251
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408839_1090408847 -7 Left 1090408839 11:126493766-126493788 CCCCAGCTGGCCCCGCCTGGGCA 0: 1
1: 1
2: 2
3: 47
4: 416
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408831_1090408847 27 Left 1090408831 11:126493732-126493754 CCTCACCCACAGCAGCCTGCATC 0: 1
1: 1
2: 6
3: 75
4: 551
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408840_1090408847 -8 Left 1090408840 11:126493767-126493789 CCCAGCTGGCCCCGCCTGGGCAA 0: 1
1: 0
2: 2
3: 21
4: 194
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408841_1090408847 -9 Left 1090408841 11:126493768-126493790 CCAGCTGGCCCCGCCTGGGCAAA 0: 1
1: 0
2: 0
3: 21
4: 167
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164
1090408838_1090408847 -6 Left 1090408838 11:126493765-126493787 CCCCCAGCTGGCCCCGCCTGGGC 0: 1
1: 0
2: 7
3: 42
4: 443
Right 1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG 0: 1
1: 0
2: 0
3: 20
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090408847 Original CRISPR CTGGGCAAACACATGGTGAC AGG Intronic
900962791 1:5936291-5936313 GTGGGCAAATACATGGCGACTGG - Intronic
901679775 1:10906287-10906309 CTGGGCACCCACTTGGTGCCAGG - Intergenic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902733177 1:18383394-18383416 CTGGCCAAACACATGGCCGCTGG + Intergenic
902845391 1:19106477-19106499 CAGTGCAGACACATGGTGAGGGG + Intronic
902941858 1:19806082-19806104 CTGGGGAAAAACAGGGTGAAAGG - Intergenic
904254270 1:29244582-29244604 CTAGACAAACACATATTGACAGG - Intronic
904459051 1:30664576-30664598 CTGGGCAAACACCCCGTTACTGG - Intergenic
906746203 1:48223786-48223808 TTGGGCTAACAGATGGTCACTGG + Intronic
909589899 1:77335933-77335955 CTGTGCACTCACATGGTGAAAGG + Intronic
910287375 1:85570699-85570721 CTGATCAAACCGATGGTGACAGG + Intronic
918039968 1:180908028-180908050 CTGGGCAAAGGCAAGGAGACAGG + Intergenic
920558319 1:206920514-206920536 ATGGGCAAAGACATGGTGGCAGG + Intronic
921128189 1:212196475-212196497 CAGGGGAATCACATGGTGAAAGG - Intergenic
1062862640 10:822475-822497 CTGGGCCCACTGATGGTGACTGG - Intronic
1063979711 10:11443810-11443832 CTGGCCCAGCACATGGTGAGTGG - Intergenic
1067512343 10:46906447-46906469 CTGAGCAATCTCATGGTGAGAGG + Intergenic
1067649900 10:48145375-48145397 CTGAGCAATCTCATGGTGAGAGG - Intergenic
1067766165 10:49089042-49089064 TTTGGCAAACACATGCTCACAGG + Intronic
1068486624 10:57667161-57667183 CAGGGAAAACTCATGGAGACAGG - Intergenic
1068520391 10:58071049-58071071 CTTGGCAAACAAATGGATACAGG - Intergenic
1070874635 10:79791789-79791811 AAGGGCAAACACATGTTGACTGG - Intergenic
1071564558 10:86665089-86665111 CTGTGCAAACACAGGGGCACAGG + Intronic
1071641559 10:87313952-87313974 AAGGGCAAACACATGTTGACTGG - Intergenic
1075465381 10:122646900-122646922 CAGGGCAGACTCATGGTCACAGG - Intergenic
1076025744 10:127111540-127111562 CTTGGAAAACACCTGGTGAGTGG - Intronic
1076751834 10:132547185-132547207 CTGGGCACAGACAGGCTGACAGG - Intronic
1076919838 10:133445856-133445878 CTGGGCAAAGGCATGGACACAGG + Intergenic
1078017145 11:7624567-7624589 TTGGGCCAACACATGGGGAAGGG + Intronic
1079011307 11:16830684-16830706 CTTGGTAAATACATGGTGAATGG - Intronic
1080493813 11:32796056-32796078 CTGGGCAAACGCTTGGAGAAAGG - Intergenic
1081740002 11:45432332-45432354 CTGGGCCAGCACATGGGGTCAGG - Intergenic
1082606400 11:55238763-55238785 CTCGGGAAGCACATGGTGTCAGG - Intergenic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1085913736 11:80859728-80859750 CTGAACAAATACAGGGTGACAGG - Intergenic
1089982230 11:122781673-122781695 CAGGGCAAAGACATGGTGGCCGG - Intronic
1090408847 11:126493782-126493804 CTGGGCAAACACATGGTGACAGG + Intronic
1090604562 11:128407761-128407783 CTGGGGTAAGACATGGTGAGAGG - Intergenic
1093391981 12:18634732-18634754 CTGGGCAATGACAGGGTGACAGG + Intronic
1096071218 12:48776440-48776462 CTGGCCAACCACATGGAGGCAGG - Exonic
1096837823 12:54362318-54362340 GTGAGCATGCACATGGTGACAGG + Intergenic
1097239328 12:57564231-57564253 CTGGGCATTCAGATGGGGACTGG + Intronic
1098391366 12:69972966-69972988 CTGGGAAAACACATGGATTCTGG + Intergenic
1101194085 12:102364949-102364971 CTGGTCAGTCACATGGTGGCTGG + Intergenic
1101569636 12:105941246-105941268 CTGGGAACACACATGGTTATAGG + Intergenic
1104402860 12:128491115-128491137 GTGGCCAAACAGAAGGTGACAGG + Intronic
1105235223 13:18544962-18544984 CTGGGCAAAGACATTGTGAATGG + Intergenic
1113352586 13:109543981-109544003 CTGGGCAGAGAAATGCTGACAGG - Intergenic
1114367707 14:22047767-22047789 CTAGGCACACACATGGAGAATGG + Intergenic
1118884640 14:69856192-69856214 CTGGGCAAAGACAGGGTTCCTGG + Intronic
1121024638 14:90606335-90606357 CTGGAGAAACACATGGCAACGGG + Intronic
1121088921 14:91167902-91167924 CTGGGAAAGCAGATGATGACAGG - Intronic
1122443393 14:101750188-101750210 CTGGGGAAACACAAGGGGTCAGG - Intergenic
1122774926 14:104112917-104112939 CTGGGCAAAGGCAGGGTGGCAGG - Exonic
1126146757 15:45481561-45481583 CTGGGAAAACAGATTATGACAGG - Exonic
1126981460 15:54248861-54248883 CTGGGAAAACACAGAGTGAGAGG + Intronic
1129160466 15:73744835-73744857 CTCGGCAAACACATTGAGACAGG - Intronic
1129272957 15:74428997-74429019 CTGGCCATACACCTGGTGGCTGG + Intronic
1131157651 15:90084899-90084921 CTGGGCAAACCTATGGGGATGGG + Exonic
1132462567 16:62696-62718 CTGAGCAAACACATGAGGTCAGG + Intronic
1132651297 16:1022518-1022540 CTGGGGAAAGACAGCGTGACTGG + Intergenic
1134106865 16:11491738-11491760 CTGGGCAAACACCTCCTCACTGG + Exonic
1135816308 16:25637285-25637307 TTGGCCAGACACATGGTGAGGGG - Intergenic
1140725443 16:77807421-77807443 CTGAACAAAGACATGGGGACTGG - Intronic
1145308972 17:21691131-21691153 ATGAGTGAACACATGGTGACTGG - Intergenic
1146812069 17:35911722-35911744 CTAGGCAAAGGCATGGTTACAGG - Intergenic
1147337579 17:39736916-39736938 CTGGGCAAACACAGGGTACTTGG - Intergenic
1148173714 17:45546497-45546519 CTAGGCAAACGCATGGCTACAGG - Intergenic
1148275555 17:46298951-46298973 CTAGGCAAACGCATGGCTACAGG + Intronic
1148297663 17:46516519-46516541 CTAGGCAAACGCATGGCTACAGG + Intronic
1150404923 17:64893421-64893443 CTAGGCAAACGCATGGCTACAGG - Intronic
1151764951 17:76128434-76128456 CATGGCAATCACATGGTGTCTGG + Intergenic
1154251167 18:12746416-12746438 CTGGACAGACACAGGGTGAGGGG + Intergenic
1154514316 18:15145045-15145067 CTGGGCAAAGACATTGTGAATGG - Intergenic
1158174701 18:54641983-54642005 CTGGACATAGACATAGTGACTGG - Intergenic
1158626891 18:59079373-59079395 CTGAGCAAGCACAGGGTGGCTGG - Intergenic
1160895402 19:1399939-1399961 CTGGGCAGACACAGGGCGCCTGG + Intronic
1161761040 19:6173035-6173057 CTGGGAAAAGACATGGAGAAGGG - Intronic
1162608767 19:11732886-11732908 AAGAGCAAACACATGATGACAGG - Intronic
1162957332 19:14106797-14106819 CTGGTGAAACACAAGGAGACCGG - Exonic
1165256421 19:34579374-34579396 CTGGCCAAACACATGGGTAGGGG + Intergenic
925335792 2:3098352-3098374 CTCAGCAAACCCATGGAGACAGG + Intergenic
925779822 2:7371979-7372001 CTGGGAAGACAAATGGAGACTGG + Intergenic
926617382 2:15010615-15010637 CTGGGGATTCACATGGTTACTGG - Intergenic
927229420 2:20806425-20806447 CTTGGAAAATATATGGTGACTGG + Intronic
927481502 2:23457514-23457536 CTCGGGGAACACAAGGTGACGGG - Intronic
928523716 2:32117337-32117359 CTGGGAAAACTCATTGTGTCAGG - Intronic
930551158 2:52836378-52836400 CTGAGCAAATACTTGGTGCCAGG + Intergenic
933440926 2:82312802-82312824 TTGGGCAAACACATGGTGTTTGG - Intergenic
935666343 2:105516223-105516245 CTGGCCAAGGAGATGGTGACAGG + Intergenic
938514558 2:131989655-131989677 CTGGGCAAAGACATTGTGAATGG - Intergenic
939096354 2:137837413-137837435 CTGGAAAAATACATGGGGACAGG + Intergenic
941234389 2:162951656-162951678 CTGGGTAAAAGCATAGTGACTGG + Intergenic
944194132 2:197034714-197034736 CCTGGCAAACACATGGTGGTTGG - Intronic
946005369 2:216520285-216520307 CTCAGCAAAGACTTGGTGACAGG + Intronic
946248808 2:218401042-218401064 CAGGGCAAACAGATGGCCACTGG + Intronic
948141834 2:235678937-235678959 CTGGGCATCCAGATGGTGAGTGG + Intronic
948541931 2:238697409-238697431 GTGGGGAAACCCATGGTGAGGGG - Intergenic
1169221741 20:3827187-3827209 CTGGGACAACAGATGATGACAGG + Exonic
1171363911 20:24610766-24610788 CTGGGCAAATACACAGTGCCTGG - Intronic
1172099987 20:32479617-32479639 CTGGCCAGTCACATGGGGACTGG - Intronic
1172293434 20:33791747-33791769 CTGGGCAGAGCCATGGTGGCAGG + Exonic
1175200301 20:57272372-57272394 ATGAGCACAGACATGGTGACAGG + Intergenic
1176779215 21:13173245-13173267 CTGGGCAAAGACATTGTGAATGG + Intergenic
1177976860 21:27862283-27862305 CTGGGCAAAGACATTGTGAATGG + Intergenic
1181429877 22:22872808-22872830 CTGGGTACAGACATGGAGACAGG + Intronic
1183050331 22:35255733-35255755 CTGGGGAAACACATGGAAATGGG + Intergenic
1183147615 22:36009152-36009174 CATGGCAAACACATGATGACTGG - Intronic
1184959480 22:47918602-47918624 CTGGCCCCACAGATGGTGACTGG + Intergenic
949535751 3:4995164-4995186 CTGGGGAAAAACGTGGTGACTGG + Intergenic
950723738 3:14902389-14902411 CTGGGCAAAGACATGGAGGTTGG + Intronic
955292972 3:57709642-57709664 CTGGGCAAACTAATGGAGTCTGG + Intergenic
959585315 3:108020246-108020268 CTGAACAAACACATGGGGGCAGG + Intergenic
964998183 3:162914589-162914611 CTGGCCAAACACAAGGTAGCTGG - Intergenic
965599116 3:170437943-170437965 TTGTGCATAGACATGGTGACTGG + Intronic
966775688 3:183541026-183541048 CTGGACAATGACATGGTCACAGG - Intronic
969601234 4:8177740-8177762 CTGGGCAGACCCCTGGTGTCAGG + Intergenic
970484163 4:16507671-16507693 ATGGCCAAACACCTGGTGATAGG + Intronic
973340205 4:48995699-48995721 CTGGGCAAACTCTTGGTCTCAGG - Intronic
975990923 4:80259238-80259260 TTGGGCAAACACCTGTTGTCTGG - Intergenic
977081321 4:92532223-92532245 CTGTGAAAACTCATTGTGACAGG + Intronic
979486434 4:121275808-121275830 GGGGGCAAACACAGGGTGATGGG - Intergenic
979871128 4:125823498-125823520 CTGTGTAATCACATGGTGAAAGG + Intergenic
983619092 4:169741274-169741296 ATGGGCAGACAAATGGTGAGAGG + Intronic
990782822 5:59385591-59385613 CTGGAGAAACACATGCTGAGGGG - Intronic
992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG + Intergenic
994249729 5:97521817-97521839 CTGTGGAAACACAAGGTGATAGG + Intergenic
994789666 5:104207122-104207144 CTGGGCTGTTACATGGTGACAGG + Intergenic
997171277 5:131723904-131723926 CAGTGAAAACACATGGTCACAGG - Intronic
997237290 5:132280207-132280229 CTGGGAAGGCACAGGGTGACAGG - Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
997657278 5:135564635-135564657 ATGGGCAGACACATGGAGAGAGG + Intergenic
998595472 5:143525380-143525402 GACGGCAAACAGATGGTGACTGG - Intergenic
1000217854 5:159181051-159181073 CTGGGGGAACACATGGTGTTTGG - Intronic
1000290009 5:159861294-159861316 CTGGGTAAACACATCTTGAGGGG + Intergenic
1005097165 6:22129694-22129716 CTGGGCAGACACATGGTAGTGGG + Intergenic
1005156338 6:22811242-22811264 CAAGGCAAACACATTTTGACTGG - Intergenic
1005227438 6:23658930-23658952 GCTGGTAAACACATGGTGACTGG + Intergenic
1005804759 6:29463833-29463855 CTGTGCCCACACATGGTGAAAGG + Exonic
1005821806 6:29604945-29604967 CTGGACAGAATCATGGTGACAGG + Exonic
1008412742 6:51199694-51199716 CTGTGCAAATACAAGGTGTCAGG - Intergenic
1008734336 6:54524219-54524241 CAGGGGAAAGACATAGTGACCGG + Intergenic
1009441670 6:63687691-63687713 CTGGGCAAACTCCTGAAGACTGG - Intronic
1010212656 6:73374349-73374371 CTGGGCAAACACATGGGAGTGGG - Intronic
1012310084 6:97712958-97712980 CATGTCAAACACAGGGTGACAGG - Intergenic
1012746938 6:103103353-103103375 CTGGCTAACAACATGGTGACAGG - Intergenic
1013821471 6:114158067-114158089 CTGTGCAAACTCATTGTGTCTGG + Intronic
1015262586 6:131255523-131255545 GTGGGCAAACACATTTTTACTGG - Intronic
1016115335 6:140275945-140275967 TTGGTCAAACAGCTGGTGACTGG - Intergenic
1018710304 6:166493995-166494017 CTGGGGAGACCCTTGGTGACAGG + Intronic
1022809199 7:33852214-33852236 CTGGCCAGACACATGATGCCTGG + Intergenic
1029096765 7:98091277-98091299 GTAGGCAAACCCATGGAGACAGG - Intergenic
1029157168 7:98525569-98525591 CTTGGCCAACACTTGGTGACAGG + Intergenic
1029601786 7:101568862-101568884 CTGGGCTACAAGATGGTGACAGG - Intergenic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1033232816 7:139614921-139614943 CTGTGCTGACACATGGTGACAGG + Intronic
1035272398 7:157728128-157728150 CTGGGCAGACACATGCAGCCCGG + Intronic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1041552179 8:59115665-59115687 CTGGACAGACACATGGAGGCTGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1047051483 8:121117842-121117864 CTGGACAAAGCCATGGGGACAGG + Intergenic
1047434771 8:124827138-124827160 CTGGGCAGACCCTTAGTGACAGG - Intergenic
1048049744 8:130805961-130805983 CTGGGGAAAGACAGGGTCACTGG - Intronic
1048259345 8:132932378-132932400 CTGGGCAAATACAGGGGGAAGGG + Intronic
1049344753 8:142132881-142132903 CTGGGCAGAGGCTTGGTGACAGG + Intergenic
1051958130 9:22723540-22723562 CTGGGAAAACTCATGTTGAATGG + Intergenic
1056701863 9:88917824-88917846 CTGGCCACACAGATGGTTACTGG - Intergenic
1057759537 9:97861179-97861201 CAGGGCAAATTCATGATGACAGG - Intergenic
1060371047 9:123071857-123071879 CTGGGGAAACACTTGGTGTATGG + Intronic
1061187561 9:129063587-129063609 GTGGGCCGACAGATGGTGACAGG + Exonic
1061864274 9:133484564-133484586 CTGGGCACACAAAGGGTGTCTGG + Intergenic
1186042360 X:5494968-5494990 CTGGAGAAACACATGATCACTGG + Intergenic
1186893656 X:13984951-13984973 TCGGGCAAAAAGATGGTGACAGG + Intergenic
1187319219 X:18225681-18225703 GTTGGCATGCACATGGTGACAGG - Intergenic
1187712527 X:22068301-22068323 CTGGTCAAAAATAGGGTGACAGG + Intronic
1188399061 X:29722019-29722041 GTGGGCAAAAAGATGGTAACAGG - Intronic
1188590117 X:31823270-31823292 CTGGAAAGACACATGCTGACAGG - Intronic
1188781166 X:34287254-34287276 CAGGGCCCACACATAGTGACTGG - Intergenic
1189074271 X:37899585-37899607 ATGGACAAATAAATGGTGACTGG - Intronic
1190217121 X:48487340-48487362 CTGGGGTCACACATGGTAACTGG - Intergenic
1190584394 X:51923782-51923804 CTGGGCAAACAGCTGGCGAGTGG - Intergenic
1191830224 X:65407660-65407682 CTGGGCAAACAAATCCAGACGGG - Intronic
1199646332 X:149916888-149916910 CTGGGGAAACCCAAGATGACAGG - Intergenic
1199850284 X:151721286-151721308 ATGGGGAATCACATGGTGCCTGG - Intronic
1200000467 X:153057191-153057213 CTGGGCAGATACAGGGTGATTGG + Exonic