ID: 1090409369

View in Genome Browser
Species Human (GRCh38)
Location 11:126497026-126497048
Sequence TAGCCAGAGCAGCTGCATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090409363_1090409369 12 Left 1090409363 11:126496991-126497013 CCTGGGAATCCTGTCAGGGAGTG 0: 1
1: 0
2: 3
3: 14
4: 163
Right 1090409369 11:126497026-126497048 TAGCCAGAGCAGCTGCATACAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1090409367_1090409369 3 Left 1090409367 11:126497000-126497022 CCTGTCAGGGAGTGGGGTCCAGT 0: 1
1: 0
2: 5
3: 30
4: 305
Right 1090409369 11:126497026-126497048 TAGCCAGAGCAGCTGCATACAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1090409359_1090409369 17 Left 1090409359 11:126496986-126497008 CCCAGCCTGGGAATCCTGTCAGG 0: 1
1: 0
2: 2
3: 17
4: 169
Right 1090409369 11:126497026-126497048 TAGCCAGAGCAGCTGCATACAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1090409358_1090409369 18 Left 1090409358 11:126496985-126497007 CCCCAGCCTGGGAATCCTGTCAG 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1090409369 11:126497026-126497048 TAGCCAGAGCAGCTGCATACAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1090409361_1090409369 16 Left 1090409361 11:126496987-126497009 CCAGCCTGGGAATCCTGTCAGGG 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1090409369 11:126497026-126497048 TAGCCAGAGCAGCTGCATACAGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090409369 Original CRISPR TAGCCAGAGCAGCTGCATAC AGG Intronic
901925449 1:12563356-12563378 GAGCTAGAGCAGCTGGATGCAGG - Intergenic
910287994 1:85576262-85576284 AAGCCAGAGCAGCTCCTTTCAGG - Intronic
916810924 1:168305066-168305088 GAGGCAGAGGAGCGGCATACTGG - Exonic
924159411 1:241215570-241215592 CAGCCAGAGCAGCTGGAAACTGG - Intronic
1063342481 10:5280231-5280253 TGGCCAGATCAGCTACAGACAGG + Intergenic
1063367428 10:5499673-5499695 GGGCCAGATCAGCTGCAGACAGG + Intergenic
1064470233 10:15628225-15628247 TAGGCAGAGCGGCAGCATATGGG - Intronic
1067580107 10:47439405-47439427 TACACAGAGCAGCAGCATCCTGG - Intergenic
1068769230 10:60802260-60802282 AAGCCAAAGAAGCTGCAAACTGG + Intergenic
1072268366 10:93752002-93752024 TAGCCAGCCCAGTTGCATGCTGG + Intergenic
1073137560 10:101228356-101228378 CAGCCTGAGCAGCTGCTTATGGG - Intronic
1074105769 10:110388755-110388777 TTTCCAGAGCAGCTGGATACAGG - Intergenic
1074452520 10:113570738-113570760 TAGCCAGCAAAGCTGCATGCAGG + Intronic
1078459859 11:11506180-11506202 TTGCCAGAGGAGCTGTATGCTGG - Intronic
1086371486 11:86159685-86159707 TTTCCAGAGCAGCTGCATCCTGG - Intergenic
1090409369 11:126497026-126497048 TAGCCAGAGCAGCTGCATACAGG + Intronic
1091059875 11:132451470-132451492 AAGCCAGACCAGCTGCATAAAGG - Intronic
1091912856 12:4245701-4245723 TTGGCAGAGCACCTGCACACAGG + Intergenic
1095459011 12:42421821-42421843 AAGCCAGAGGAGCAGTATACTGG + Intronic
1096030695 12:48411459-48411481 GAGCCACAGCAGCTTCAAACTGG - Intergenic
1097190943 12:57219397-57219419 TTGCCAAAGCAGCTGCCTACTGG + Intronic
1098093845 12:66933256-66933278 TTCCCAGAGGAGCTGCATAGAGG + Intergenic
1100483098 12:94998474-94998496 TAGCCAGAGCAATTGGATAAAGG + Intronic
1102628019 12:114251761-114251783 GAGCCAGAGCTGCAGCATACTGG + Intergenic
1103843181 12:123882000-123882022 TAGCCAGAGCATCTAAGTACAGG + Intronic
1106221816 13:27752476-27752498 TAACCAGTGCAGCTGCATTTAGG + Intergenic
1108050602 13:46433628-46433650 TAGCCAGAGTAGCTGGGGACAGG + Intronic
1108283963 13:48887292-48887314 TAGCCAGAGCAGGGCCCTACTGG + Intergenic
1109543179 13:63807247-63807269 TAGCCAGAGTAGCTGGGGACAGG + Intergenic
1111116142 13:83780031-83780053 TATGCAGAGCAGCAGCATCCTGG + Intergenic
1125916734 15:43494144-43494166 TAGCCAGAGCAGCTGTCAATAGG + Intronic
1126375215 15:47990868-47990890 AGCCCAGAGCAGCTGCATAGTGG + Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1129257863 15:74344274-74344296 TGGGCAGAGCAGTTGCATCCTGG - Intronic
1134638378 16:15809797-15809819 CCTCCAGAGTAGCTGCATACAGG - Intronic
1135205277 16:20478651-20478673 TAGCCAGAGAAGATGCCTATAGG - Exonic
1135213626 16:20545161-20545183 TAGCCAGAGAAGATGCCTATAGG + Exonic
1135828092 16:25748159-25748181 TCCCCAGAGCTGCTGCATCCTGG + Intronic
1138100257 16:54246602-54246624 TGGCCAGAGCAGGTACACACAGG - Intronic
1138217987 16:55222293-55222315 CAGCCAGAGCAGCTGGCTGCTGG - Intergenic
1139936629 16:70576317-70576339 CCGCCAGAGATGCTGCATACGGG - Exonic
1140037487 16:71382352-71382374 AAGTCAGAGCAGTTGTATACAGG + Intronic
1142011969 16:87720053-87720075 GAGCCAAAGCAGCTGCATTGAGG - Intronic
1143806740 17:9434752-9434774 TGTCCAGAGCAGCAGCATATGGG + Intronic
1143973850 17:10815526-10815548 AGGCCAGAGCAGCTGCTTTCAGG - Intergenic
1145248646 17:21285477-21285499 TAGCCAGAGCACCCGCATAGGGG - Intronic
1146560761 17:33867711-33867733 TTGCCAGAGCAGCTGAAACCAGG - Intronic
1147925174 17:43941492-43941514 TACGGAGATCAGCTGCATACTGG + Exonic
1147975833 17:44247696-44247718 TAGCCAGGGCAGCTGCCAAAGGG - Intergenic
1148693414 17:49545632-49545654 TAGCCAGAGCAGCTGGTGAGAGG - Intergenic
1151236795 17:72726186-72726208 TTGCAAGAGCAGCTGCATGGAGG + Intronic
1154934920 18:21044567-21044589 TAGGCACAGCAACTGCACACAGG + Intronic
927120861 2:19961471-19961493 CACCCAGATCAGCTGCACACAGG + Intronic
927446766 2:23169475-23169497 TACCCACAGCAGCTGGATGCAGG + Intergenic
935682388 2:105649049-105649071 TATGGAGAGCAGATGCATACAGG - Intergenic
938272795 2:129990089-129990111 CTGCCAGAGAAGCTGCATGCTGG + Intergenic
938443438 2:131356028-131356050 CTGCCAGAGAAGCTGCATGCTGG - Intergenic
938983961 2:136554857-136554879 TAGCCAGGGCTGCAGCAAACAGG + Intergenic
938991361 2:136633027-136633049 CACCCAGTGCAGCTGCACACAGG - Intergenic
940368621 2:152876539-152876561 GAGACAGACCAGCTGCCTACTGG - Intergenic
948019178 2:234716086-234716108 TGGCCAGAGCATCTGCTTCCCGG + Intergenic
948378682 2:237538705-237538727 TATTCAGAGAAGCTGCAGACGGG - Intronic
1173081391 20:39871276-39871298 TGGCCAAAGCAGCTGCATATTGG + Intergenic
1175160666 20:57005386-57005408 CAGCCTGAGCAGGTGCATCCTGG + Intergenic
1176711513 21:10154314-10154336 TGGCCAGAGCAGCAGCAAGCAGG + Intergenic
1178514607 21:33236217-33236239 GAGCCAGAGCAGATTCACACAGG + Intronic
1178929799 21:36807399-36807421 AAGCGAGAGCATCTCCATACGGG + Intronic
1179006115 21:37516923-37516945 CAGGTACAGCAGCTGCATACTGG - Intronic
1185053180 22:48564297-48564319 AAGCCAGAGCAGCTACCTAAGGG + Intronic
949142326 3:649834-649856 TGACCACAGCAGCTGCATAACGG + Intergenic
950206510 3:11085036-11085058 TAGCCAGTCCAGCTGCCCACAGG + Intergenic
952877540 3:37959170-37959192 TGACCAGAGCAGCTGCATCTGGG + Intronic
953782784 3:45886286-45886308 TAGACAGCACAGCTGCTTACAGG - Intronic
962314059 3:134347695-134347717 CGGGCAGAGCAGCTGCAAACTGG - Intergenic
962384941 3:134925356-134925378 AGGCCAGAGAAGCTGCATAATGG + Intronic
962834599 3:139176998-139177020 TAGCCAAAGCAGCATGATACTGG - Intronic
967377781 3:188824995-188825017 GACCAAGAGCAGCTGCATAATGG + Intronic
980094275 4:128473448-128473470 TATCCAAAGCTGCTGCCTACTGG + Intergenic
986463594 5:7998171-7998193 CAGCCTGAGCAGGTGTATACAGG - Intergenic
989440272 5:41463176-41463198 TAGCCAGAACTGATGAATACAGG - Intronic
996811480 5:127520331-127520353 CAGACAGAGCAGATGCAGACAGG - Intronic
997599830 5:135131681-135131703 TAGCCAGAGCAGCTGGGGACTGG - Intronic
1006044859 6:31286602-31286624 TGGGCAGAGCAGCTGCATGTGGG - Intronic
1012586074 6:100923996-100924018 CAGCCAGAGCAGCTTCTTTCCGG - Intergenic
1015777815 6:136832294-136832316 GAGCTAGAGCAGCTGGATGCAGG + Intronic
1016739517 6:147512662-147512684 CAGTCAGAGAAGCTACATACAGG - Intronic
1019923762 7:4179363-4179385 TAGCAGGAGCTGCTGCATAGTGG + Intronic
1022179845 7:27908587-27908609 TAGCCTGAGCAACTCCATTCTGG - Intronic
1022601743 7:31767432-31767454 TTGCCAGAGCAGCAGGAAACAGG - Intronic
1022807000 7:33832281-33832303 TAGCCAGAGAAGTTCCATCCCGG - Intergenic
1034338326 7:150337488-150337510 CAGCCGGAGCAGCTCCATCCTGG + Exonic
1034481358 7:151322261-151322283 CAGCCAGGGAAGCTGCTTACAGG + Intergenic
1044408185 8:91854717-91854739 TGGCCCAAGCAGCTGCATTCAGG - Intergenic
1048267114 8:132997522-132997544 TAGGAAGAGCAGCTGGAGACAGG + Intronic
1049033067 8:140051296-140051318 TGGACAGAGCAGCTCCACACTGG + Intronic
1050932490 9:11348175-11348197 CAGCCACAGCATCTGCATAATGG + Intergenic
1051157079 9:14160005-14160027 GAGGCAGAGCAGCTGCTTAATGG + Intronic
1053867159 9:42451409-42451431 TTTACAGAGCAGCTGCTTACAGG + Intergenic
1055304616 9:74916545-74916567 TAGCCAAAACAGCATCATACTGG + Intergenic
1057385648 9:94603823-94603845 GAGACAGACCACCTGCATACTGG + Intronic
1062153217 9:135032150-135032172 GAGCCAGAGCAGATGCACCCTGG + Intergenic
1062153391 9:135032937-135032959 GAGCCAGAGCAGATGCACCCTGG - Intergenic
1202796267 9_KI270719v1_random:123303-123325 TGGCCAGAGCAGCAGCAAGCAGG + Intergenic
1188135412 X:26488519-26488541 TAGCCAGGGAAGCTTCATGCCGG + Intergenic
1198102504 X:133434297-133434319 AGGCCAGAGCAGCTGCTTAAGGG + Intergenic
1198675831 X:139129044-139129066 CAGCCAGAGTAGCTGCACAGAGG - Intronic
1199248143 X:145630859-145630881 CAGCCAGCACAGCTGCATCCAGG - Intergenic
1199545722 X:149005706-149005728 TAGCCAAAGCTGCTTCATCCGGG + Intergenic