ID: 1090415586

View in Genome Browser
Species Human (GRCh38)
Location 11:126538103-126538125
Sequence CCACCCATGCAGGTTTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090415586_1090415593 9 Left 1090415586 11:126538103-126538125 CCATTAGAAACCTGCATGGGTGG 0: 1
1: 0
2: 2
3: 11
4: 108
Right 1090415593 11:126538135-126538157 CAGTGGGTGAGCCCTCCCATTGG 0: 2
1: 0
2: 1
3: 16
4: 210
1090415586_1090415591 -8 Left 1090415586 11:126538103-126538125 CCATTAGAAACCTGCATGGGTGG 0: 1
1: 0
2: 2
3: 11
4: 108
Right 1090415591 11:126538118-126538140 ATGGGTGGTGCGGGAGACAGTGG 0: 1
1: 1
2: 2
3: 28
4: 322
1090415586_1090415592 -7 Left 1090415586 11:126538103-126538125 CCATTAGAAACCTGCATGGGTGG 0: 1
1: 0
2: 2
3: 11
4: 108
Right 1090415592 11:126538119-126538141 TGGGTGGTGCGGGAGACAGTGGG 0: 1
1: 1
2: 0
3: 21
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090415586 Original CRISPR CCACCCATGCAGGTTTCTAA TGG (reversed) Intronic
901188430 1:7389566-7389588 CCACTCATGTCTGTTTCTAAGGG - Intronic
901327932 1:8380121-8380143 CCACCCATGCATGTTTATGCTGG + Intronic
910417526 1:87016331-87016353 TCTCCCATCCAGGTTTCTAATGG - Intronic
911744059 1:101419581-101419603 CCACCCCTGCAGGTCTGGAAGGG + Intergenic
917061311 1:171044140-171044162 CCATCTATGCAGTTTTTTAAGGG + Intronic
917328103 1:173854013-173854035 TCACCCAGGCAGGTGTCTACTGG + Intronic
918424782 1:184397284-184397306 CCAGCCATACAGTTTTTTAACGG - Intronic
920005988 1:202834116-202834138 TCACCCATGCTGGTGTGTAATGG - Intergenic
921324408 1:213977036-213977058 CCACCAAAGCAGGGTTCTAAAGG + Intergenic
923142580 1:231173492-231173514 CCAGCCTTGCAGGATTCTGAAGG + Intronic
1065116157 10:22485338-22485360 CCACCCATGGAGGTTTTTATGGG + Intergenic
1065916654 10:30358803-30358825 CCACCCAGGCAGGCTTGGAAAGG - Intronic
1070498929 10:77052257-77052279 CCACCCATGGACTTTCCTAACGG + Intronic
1079750188 11:24187066-24187088 CCACTCATGCAGATTTCCTAAGG + Intergenic
1081548856 11:44094166-44094188 CCACCCATCCAGTTCTCAAATGG + Intergenic
1085017566 11:73185436-73185458 CCACCCATCCACGTTGCTGATGG - Intergenic
1085304637 11:75478087-75478109 GAAGCCATGCAGGTTTCTAAGGG - Intronic
1087657395 11:100941098-100941120 CAAGTCATGCAGGTATCTAAAGG + Intronic
1090415560 11:126537940-126537962 CCACCCATGCAGCATTCTAATGG - Intronic
1090415586 11:126538103-126538125 CCACCCATGCAGGTTTCTAATGG - Intronic
1093304832 12:17502482-17502504 CCAACTAAGCAGGTTTCTTAGGG + Intergenic
1099788556 12:87299631-87299653 CCACCAAGACAGGTTTCTGAAGG + Intergenic
1100012098 12:89965968-89965990 CCTCCCATGCAGGTTTCTCAAGG - Intergenic
1102060711 12:109928764-109928786 CCACCTGTGCAGGTTCCTAGGGG - Intronic
1102232848 12:111275523-111275545 CCAGCGATGCAGGTTTCTGTTGG - Intronic
1103068453 12:117919728-117919750 CCTCCCATGCTGGTTCTTAAAGG - Intronic
1112595808 13:100805953-100805975 CTTCCCCTGCAGGTTTCAAAGGG - Intergenic
1114017549 14:18445007-18445029 ACACACATGCAGGGTTCTGATGG - Intergenic
1118287837 14:64492711-64492733 CCACCCATACAGGAATCTTATGG + Intronic
1123891645 15:24786409-24786431 TTACACATGCAGGTTTCTCATGG + Intergenic
1124370620 15:29103052-29103074 ATACCCATCCAGGTTTCGAAGGG - Intronic
1127464995 15:59235242-59235264 CAAACCATGCAAGTTTCTAAAGG + Intronic
1127656844 15:61063616-61063638 ACACCCTTGAAAGTTTCTAAAGG + Intronic
1129681404 15:77660412-77660434 CCACCCTTGCAGGCATCTCATGG + Intronic
1129858421 15:78841522-78841544 CCACCCCTGCAGGGATCTAGTGG + Intronic
1130258708 15:82337909-82337931 CCACCCAGGCAGGCTTGGAAAGG - Intergenic
1130269977 15:82441175-82441197 CCACCCAGGCAGGCTTGGAAAGG + Intergenic
1130490361 15:84426297-84426319 CCACCCAGGCAGGCTTGGAAAGG - Intergenic
1133111399 16:3550169-3550191 CCACCCATGCTGGCTTCTCAAGG + Intronic
1134030141 16:10985399-10985421 CCATCAATGCACGTTTCTACGGG + Intronic
1139351921 16:66342421-66342443 CCACCCATCCAGGTGTCTGTGGG - Intergenic
1141535076 16:84673468-84673490 CCACTCTTGCAGGCATCTAAAGG + Intergenic
1143872310 17:9965829-9965851 CCACCCATCCAGGTCTCCAAGGG + Intronic
1144621029 17:16818661-16818683 CCACCCAAGGAGGTTCCCAAGGG + Intergenic
1146290438 17:31602883-31602905 GCACCCAGGCTGGTTTCTGAGGG + Intergenic
1147386186 17:40083756-40083778 CCAACCATGCAGTTTACTAGGGG - Intronic
1150794945 17:68229442-68229464 CCAGCCAGACAGGTTTCTCAGGG - Intergenic
1151185182 17:72358989-72359011 ACAGCCAAGCAGGATTCTAAGGG + Intergenic
1151298043 17:73200061-73200083 CCACCCATGCAGCCTTGTACGGG + Intronic
1155115797 18:22765322-22765344 CCACCCATTCTGGTTTGTCATGG + Intergenic
1155945603 18:31846534-31846556 CCACCCAGGCTGGTTTGCAATGG - Intronic
1157398989 18:47370911-47370933 ACACCCATCCAGGTTTACAAGGG + Intergenic
1158548849 18:58417820-58417842 CCACCCAGGCAGGTTTCTGTGGG - Intergenic
1159412424 18:68096928-68096950 CTACCCATGCATGTTTTTAGAGG - Intergenic
1165659771 19:37567069-37567091 CAAGCCATGCAGGTATCTAGAGG - Intronic
1166101065 19:40571686-40571708 CCACTCATGGAGCTTTCTCAAGG - Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
927895741 2:26780639-26780661 CCTCCCATGCAGGTCTCTGTGGG + Exonic
932656720 2:73616949-73616971 CCACCCAGGCAGGTGTGTGATGG - Intergenic
933231587 2:79813920-79813942 CCTCCCCTGCAGGTTTCAGAGGG - Intronic
934953032 2:98592296-98592318 CCACCCCTGCAGGTTCCACAGGG - Intronic
935672338 2:105566528-105566550 CCTCCCATGCAGGTGCCTAGTGG - Intergenic
939017728 2:136920957-136920979 CAACCCCTGCAGGCTTCAAAGGG - Intronic
939861710 2:147428819-147428841 CCACCAATGCAAGATTCTACAGG + Intergenic
940065870 2:149628337-149628359 CCATTAATGCAGGTGTCTAAAGG + Intergenic
940174052 2:150859521-150859543 CTATCCAAGCAGGTTTCAAATGG - Intergenic
941192825 2:162407621-162407643 GAACCCATTAAGGTTTCTAAGGG + Intronic
942475522 2:176315818-176315840 CAAGCCATGCAGATATCTAAGGG - Intronic
946916713 2:224530379-224530401 CCAACTATGCAGGTTTCTTGTGG - Intronic
1178189864 21:30267963-30267985 CTACCCTTGCATGTTTCTATAGG - Intergenic
1180442054 22:15375876-15375898 ACACACATGCAGGGTTCTGATGG - Intergenic
1182064037 22:27417772-27417794 CCACCCAGGAAGGTCTCTCAGGG - Intergenic
950270975 3:11614601-11614623 CCAGCCATCCAGGTTTCCCACGG + Intronic
952687117 3:36162866-36162888 CCATCCCTGCAGGTTTCTCCAGG + Intergenic
955499472 3:59569931-59569953 ACACCCTTGCAGGTTTCAGAGGG - Intergenic
962398058 3:135034829-135034851 ACACCCAGGAAGGTTTCAAAAGG - Intronic
963672696 3:148271829-148271851 CAACCCATGCAGGCATCTGAAGG - Intergenic
969056336 4:4405124-4405146 TCTCCCCTGCAGGTTTCCAAGGG - Intronic
971325124 4:25637316-25637338 CCACCCATCCAGGTTTGCCAAGG + Intergenic
974653920 4:64793657-64793679 CCACCCAAGAAGATATCTAATGG + Intergenic
975102573 4:70531235-70531257 CCACCCCTGCAGGCATCCAAAGG + Exonic
978597229 4:110391348-110391370 TCAGCCATGCATGTTTTTAAGGG - Intronic
988656503 5:33217658-33217680 ACATCAATGCAAGTTTCTAAAGG - Intergenic
992005830 5:72476542-72476564 CCACCCACCCAGGATACTAATGG + Intronic
993491679 5:88559307-88559329 TCACACATGAAGGTTTTTAATGG + Intergenic
995602052 5:113808025-113808047 CCACTCATGCAATTTTGTAAAGG + Intergenic
995607015 5:113867663-113867685 CTACCCAAGCAGGTTTCCCAAGG - Intergenic
997498290 5:134349755-134349777 CCAGCAATGCAGGTACCTAAAGG + Intronic
999295133 5:150454733-150454755 CCAGCCTTGCAGGTATCTAAGGG + Intergenic
1004381960 6:15140145-15140167 CCAACTTTGCAGATTTCTAACGG + Intergenic
1007153329 6:39717417-39717439 CCAGCCATTCAAGTATCTAAGGG - Intronic
1007507458 6:42346950-42346972 TCAACCATGGAGGTTTCCAAAGG + Intronic
1007704467 6:43782526-43782548 CCAGCCATGCAGACTTCAAAGGG - Intronic
1014535836 6:122611358-122611380 TCACGCATGCACTTTTCTAAAGG - Intronic
1015597553 6:134880204-134880226 CCACCAGTGGAGATTTCTAAGGG - Intergenic
1015705054 6:136078954-136078976 CCACACATGCAATTTTATAATGG + Intronic
1016900104 6:149092682-149092704 CCATCCAAGCAGGTTTTTAAAGG + Intergenic
1018481993 6:164200293-164200315 CCACCAATGCAGTTTTCTGTTGG - Intergenic
1018843961 6:167541223-167541245 CCACCTATGCAGAAATCTAAGGG + Intergenic
1021959475 7:25857908-25857930 CTCCCCATGCAGATCTCTAAAGG - Intergenic
1025089550 7:56051274-56051296 CCAGTCCTGCAGCTTTCTAAAGG + Exonic
1025901721 7:65750530-65750552 CCAGTCCTGCAGCTTTCTAAAGG + Intergenic
1032755160 7:134883481-134883503 CCAGCCTGGCAGGTTTTTAAGGG - Intronic
1032943557 7:136823791-136823813 CCACCCATGCAGAATTTGAAAGG - Intergenic
1034021974 7:147654681-147654703 CCTCCCATGAATGTTTTTAATGG + Intronic
1034991698 7:155551575-155551597 CCACCCCTCCAGGTTTCAGAGGG + Intergenic
1037308148 8:17527579-17527601 CCTCCCCTGCAGGTTTCAGAAGG - Intronic
1039196010 8:35032580-35032602 CCAGCAATGAAGGTTTCCAAGGG - Intergenic
1041256726 8:55985141-55985163 CCAGCAGTGCAGCTTTCTAATGG - Intronic
1042076109 8:64997063-64997085 CCACCCAAGCAGGTGTGTAGTGG + Intergenic
1042231954 8:66566673-66566695 TCAGACATGCAGGTTTGTAAAGG - Exonic
1044964388 8:97561066-97561088 CCACCTCTCCAGGTTTCTAGAGG + Intergenic
1048840852 8:138564618-138564640 ACACCCATGCAGGGCTCTACTGG - Intergenic
1049589117 8:143447831-143447853 CCATCCCTGCCGGTTACTAATGG - Intronic
1060581932 9:124756661-124756683 GAACCCATGCAGATTTCTAAAGG + Intronic
1189056041 X:37700505-37700527 CCACCCATTCAGCTCTCTATGGG - Intronic
1192502809 X:71664683-71664705 CCACCCAGGCAGGTATCCCATGG - Intergenic
1195930184 X:110066649-110066671 CCACAGCTGCAGGTTTCCAAAGG + Intronic
1202367865 Y:24179265-24179287 CCACCCAGGCAGGCTTGGAAAGG + Intergenic
1202376975 Y:24246643-24246665 CCACCCAGGCAGGCTTGGAAAGG - Intergenic
1202493805 Y:25423478-25423500 CCACCCAGGCAGGCTTGGAAAGG + Intergenic
1202502918 Y:25490852-25490874 CCACCCAGGCAGGCTTGGAAAGG - Intergenic