ID: 1090418211

View in Genome Browser
Species Human (GRCh38)
Location 11:126555568-126555590
Sequence CAGGGTAGACACAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 459}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090418201_1090418211 15 Left 1090418201 11:126555530-126555552 CCAGGTGAAGGGTTTGGGGATGG 0: 1
1: 0
2: 2
3: 28
4: 349
Right 1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG 0: 1
1: 0
2: 1
3: 37
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090418211 Original CRISPR CAGGGTAGACACAGGGAGCA GGG Intronic
900348678 1:2224597-2224619 CACTGTAGACACTGGGATCAGGG - Intergenic
900439240 1:2645118-2645140 CAGGCCTCACACAGGGAGCAGGG + Intronic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900718540 1:4160404-4160426 CAGGGCTGGCACAGGGACCATGG + Intergenic
900734959 1:4293767-4293789 CAGGGCAGTGGCAGGGAGCACGG + Intergenic
900912977 1:5615208-5615230 GAGGGTAGAGACAGGGAGCTGGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
901880251 1:12189617-12189639 CTGGGAATACACAGAGAGCAGGG + Intronic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
902385308 1:16072785-16072807 CAGGTCAGACACAGAGAGAAAGG + Intronic
902697351 1:18149287-18149309 CAGGGGAGACCATGGGAGCAGGG + Intronic
902711360 1:18242162-18242184 CAGAGATGACACAGGCAGCACGG + Intronic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
903263142 1:22142175-22142197 TAGGCTAGACACGGGGAGCTGGG + Intronic
903269201 1:22177232-22177254 CAGGGGAGGGACAAGGAGCAAGG + Intergenic
904751465 1:32743242-32743264 GAGGGTAAACACAGGCAGAATGG - Intronic
904773565 1:32893965-32893987 CAGGGCAGACCCGGGGAGAAGGG - Exonic
906698891 1:47843283-47843305 CAGGGCAGACGCAGGGACCCTGG + Intronic
909222805 1:72984321-72984343 AAGAGTAGAGACAGGGAGAAAGG + Intergenic
909774105 1:79462875-79462897 CTGAGTAGACACAGAGAGAATGG - Intergenic
910502224 1:87905844-87905866 CAGGCTAGCCACAGGGAATATGG + Intergenic
910649692 1:89552725-89552747 CCTGGTGAACACAGGGAGCAGGG - Intronic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912762744 1:112383467-112383489 CAAGGTGGGAACAGGGAGCAGGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
914402617 1:147337434-147337456 CAGAGTGGACCCTGGGAGCACGG + Intergenic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
917599086 1:176557301-176557323 CGGGTTAGACATAGGGAGCGAGG + Intronic
918109134 1:181440545-181440567 CAGGGTAGGCAGAGGCAGAAAGG + Intronic
918956851 1:191218733-191218755 CAGGAGAGACACAGAGAGAAAGG + Intergenic
918983791 1:191596674-191596696 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
919918248 1:202152473-202152495 CAGGAGAGACCCAGGGGGCAGGG + Intronic
920340585 1:205272917-205272939 CAGGGAAGACACTGGGGGCACGG - Exonic
920437708 1:205958769-205958791 CAGGGCAGACCCAGGGGGCTGGG - Intergenic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
1062858043 10:789311-789333 CAGTGTGGACGCAGGGGGCAAGG + Intergenic
1063163389 10:3437507-3437529 CAGGGAAGAAACAGGGAGATGGG - Intergenic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1066437517 10:35407769-35407791 AAGGGTAGAGACACGGAGAAGGG + Intronic
1067347366 10:45446326-45446348 CAGGGTAGAGACAGGAACCAAGG - Intergenic
1068100045 10:52541417-52541439 CAGGAAAGGCACAGAGAGCAAGG + Intergenic
1068137595 10:52965770-52965792 CAAAGTGGACACTGGGAGCAGGG + Intergenic
1069854582 10:71432904-71432926 CAGGGGAGACTCTGGGAGCTGGG - Intronic
1070409965 10:76130632-76130654 CTGGGTAGACACAGAAGGCAGGG - Intronic
1070821239 10:79355933-79355955 CAAGGAGGACACAAGGAGCATGG + Intergenic
1070969575 10:80552419-80552441 CAGGGGAGAGACAGGAAGCTAGG - Intronic
1073180286 10:101579254-101579276 CTGGGCAGACACTGGGAGCCGGG + Exonic
1073180291 10:101579272-101579294 CCGGGCAGACACTGGGAGCCGGG + Exonic
1073260819 10:102188858-102188880 CAGAGTGGGCACCGGGAGCAGGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075093290 10:119455161-119455183 CAGGGGAGACCCCGGGAGCCGGG + Exonic
1075121623 10:119668836-119668858 CAAGATAGGCACAGGGACCACGG + Intronic
1075230333 10:120671191-120671213 CCTGGGAGCCACAGGGAGCAAGG + Intergenic
1075734952 10:124658856-124658878 CAGTGGGGGCACAGGGAGCAGGG - Intronic
1076799500 10:132814052-132814074 CAGGGCAGACCCAGGGAGCCGGG + Intronic
1076883623 10:133251614-133251636 CTGGGGAGCCACAGGGAGCTCGG - Intergenic
1077811416 11:5641756-5641778 AATGGTAGACACAAGGAACAAGG - Intronic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1079279372 11:19073656-19073678 CAGGGTGGCGACAGGGACCAGGG + Intergenic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080281736 11:30565101-30565123 CAGGGGAGACACAGGCTGCACGG - Intronic
1080847149 11:36036423-36036445 CTGTGTAGACACAGGGATCTTGG + Intronic
1083627951 11:64081589-64081611 CAGGCCAAAGACAGGGAGCAAGG + Intronic
1083676671 11:64329734-64329756 CAGGGCAGGGACAGGGAGCCAGG + Intergenic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1085934107 11:81123021-81123043 AAGGGTAGAGACACGGAGAAGGG - Intergenic
1086004863 11:82026390-82026412 AAGGGTAGAGACATGGAGAAGGG - Intergenic
1086125456 11:83344612-83344634 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1086268326 11:85028669-85028691 CAGAGTGGACACCGGGAACAGGG + Intronic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1088551675 11:111019664-111019686 CAGGGAAGCCACAGAGCGCATGG - Intergenic
1089389967 11:118094703-118094725 CAACGTAGACTCAGGGAGAAGGG + Intronic
1089491073 11:118884611-118884633 CAGGCTGGAGTCAGGGAGCAGGG + Intronic
1090107751 11:123870113-123870135 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1090212987 11:124935937-124935959 GAAGGTAGACAAAAGGAGCAAGG + Exonic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090643691 11:128750199-128750221 CAGGGCAGCCACAGGGAACTTGG + Intronic
1090934881 11:131332675-131332697 AATGGCAGACACAGGGAGCAGGG + Intergenic
1091347962 11:134867959-134867981 CAGAGCCCACACAGGGAGCATGG + Intergenic
1091675776 12:2488343-2488365 CATGGTAGACAAAGAAAGCATGG + Intronic
1092524070 12:9298864-9298886 CACGGTAGCCACCGGGACCATGG + Intergenic
1094075371 12:26466754-26466776 CAGAGAAAACACAGGGTGCAGGG + Intronic
1094361259 12:29633838-29633860 CCAGGTAGACACAGGGACAATGG + Intronic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1094509819 12:31089487-31089509 CACGGTAGCCACTGGGACCATGG + Exonic
1095601343 12:44016422-44016444 CAGGTGGGACACAGGGAGAAAGG - Intronic
1096800127 12:54105055-54105077 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1096918521 12:55059161-55059183 CAGGATAGAGACTGGGAGTAGGG + Intergenic
1098630182 12:72713396-72713418 AAGTGTAGAGACAGGGAGAAGGG + Intergenic
1098818994 12:75207125-75207147 CAGGGTAAACCCAGGGACCCCGG - Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099055144 12:77830569-77830591 TAGAGTAAACACAGGAAGCAGGG - Intergenic
1099738455 12:86600903-86600925 CAGAGCAGGCACTGGGAGCAGGG - Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1100821815 12:98438920-98438942 CAGGGTCCAGTCAGGGAGCAGGG + Intergenic
1101177877 12:102174967-102174989 GAGGGAAGAGACAGGGAGGAAGG - Intronic
1101201467 12:102440566-102440588 CAGCGGAAACACAGGTAGCAAGG - Intronic
1101302472 12:103495883-103495905 CCAGGTAGACGCAGGGAGCGCGG - Exonic
1101580970 12:106040493-106040515 CAGGGTGGGCACCAGGAGCAGGG + Intergenic
1101600318 12:106204047-106204069 CAAGGGAGAGACAGAGAGCAAGG - Intergenic
1102587547 12:113933635-113933657 CAATGTAGACCCAGGAAGCAGGG + Intronic
1102703647 12:114862422-114862444 CAGGGTAGAGAAAGGCTGCATGG + Intergenic
1103219555 12:119232258-119232280 CAGGGAAGACACAGTGAACTAGG - Intergenic
1103926606 12:124426867-124426889 CAGGGAAGACACAGAGGGGACGG + Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104410492 12:128553851-128553873 CAGGGAAGAGGCAGGGAGCCAGG + Intronic
1104962221 12:132493702-132493724 CAGGGTACACAAAGGGGGCGGGG - Intronic
1105961816 13:25348768-25348790 AAGGGTAGACAAAGAAAGCAGGG - Intronic
1107655417 13:42588282-42588304 CAGGGGAGACCCAGGGAAGAAGG + Intronic
1107683292 13:42871918-42871940 AAGAGTAGAGACAGGGAGAAGGG + Intergenic
1108002282 13:45915311-45915333 CAGAGTGGGTACAGGGAGCAGGG - Intergenic
1109102853 13:58208452-58208474 CAGGGGAGAGTCAGGGAGAATGG + Intergenic
1109478759 13:62919738-62919760 CAGAGCAGACACCAGGAGCAGGG + Intergenic
1109901607 13:68780208-68780230 GAGGGTGGACAGTGGGAGCAGGG + Intergenic
1111752734 13:92355545-92355567 AAGGGGAAAAACAGGGAGCATGG - Intronic
1112563077 13:100530853-100530875 CAGGGCAGTCACAAGGAGCTTGG + Exonic
1112994746 13:105560018-105560040 AAGAGTAGAGACAGGGTGCAGGG - Intergenic
1113207999 13:107940819-107940841 CATGATAGAAGCAGGGAGCAAGG + Intergenic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1116629363 14:47310367-47310389 CCAGGTAGAGACAGGGAACATGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117733942 14:58750987-58751009 CAGAGTAGGTGCAGGGAGCAGGG - Intergenic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118947096 14:70398584-70398606 CAGAGCAGGCACTGGGAGCAGGG + Intronic
1119344361 14:73910315-73910337 CAGTGTAGTGGCAGGGAGCATGG + Intronic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1119819460 14:77602078-77602100 AAGGGTAGAGACACGGAGAAGGG - Intronic
1120618106 14:86732530-86732552 AAGGGTAGAGACATGGAGAAGGG - Intergenic
1120746255 14:88154584-88154606 CAGGGTAGACACATGGGGCGGGG + Intergenic
1120824508 14:88943276-88943298 CAGGGCAGACTCATGGAGAAGGG - Intergenic
1120970671 14:90204533-90204555 CAGGGAAGAGCCAGGGAGCAGGG - Intergenic
1121200762 14:92115562-92115584 TAGGATACACACAGGAAGCAAGG - Intergenic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1121980733 14:98451661-98451683 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1122111117 14:99503207-99503229 CAGGGATGAAACAGGCAGCAGGG - Exonic
1122115757 14:99526521-99526543 GAGGTGAGACCCAGGGAGCAAGG + Intronic
1122417543 14:101557590-101557612 CCAGGTAGAAAAAGGGAGCAGGG + Intergenic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1122896646 14:104760865-104760887 CAGGGCAGAAGCAGGGAGCCTGG - Intronic
1123038982 14:105482753-105482775 TAGGGAAGACCCTGGGAGCAGGG - Intergenic
1125796110 15:42405078-42405100 TCTGGAAGACACAGGGAGCAGGG + Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1125881927 15:43202649-43202671 CAGGGTAGACACATGGAAAGAGG + Intronic
1126651155 15:50922523-50922545 CATGGTAGACACAGACAGCATGG + Intronic
1127605380 15:60582287-60582309 AAGGGTAGAGACAGGGAATAAGG + Intronic
1128058277 15:64717036-64717058 GAGGGAATACACAGGGAACAGGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132253443 15:100352057-100352079 CAGGGTGGACACAGTGGGAAGGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132947679 16:2540928-2540950 GAGGGGAGAAGCAGGGAGCATGG + Intronic
1132968058 16:2670697-2670719 GAGGGGAGAAGCAGGGAGCATGG - Intergenic
1133610700 16:7430753-7430775 CAGGGTCCACACAGGAAGCCTGG + Intronic
1134638088 16:15807988-15808010 AAGGGCAGACGCAGGGAGCCTGG - Intronic
1135725741 16:24852665-24852687 CCAGGTACACACAGGGTGCAGGG + Intronic
1136392594 16:29974646-29974668 CAGGTGAGACACGGGGTGCAGGG + Exonic
1136543520 16:30942405-30942427 CAGGGCAGAGACAGAGAGCCAGG - Exonic
1136620812 16:31427517-31427539 CAGGTGAGAGACAGGGAGCTGGG + Intergenic
1137031525 16:35528568-35528590 CAGGGGAGACTCAGTGTGCATGG + Intergenic
1137272579 16:46912016-46912038 CAGTGAAGACCCCGGGAGCAAGG - Intronic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138111914 16:54330699-54330721 CGGGGTAGCCACAGGGACCCTGG - Intergenic
1138199373 16:55077687-55077709 CAGGGGACTCTCAGGGAGCAGGG + Intergenic
1138532025 16:57639729-57639751 CAGGGGAGAAGCGGGGAGCAGGG - Intronic
1139283810 16:65792794-65792816 CAGGGAAGACAGAGCAAGCAAGG + Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141770289 16:86085604-86085626 CAGGGTGGTCACTGGGAGCCTGG - Intergenic
1142164825 16:88580671-88580693 CCAGCTAGAGACAGGGAGCAGGG - Intronic
1142200572 16:88759383-88759405 CAGGGCAGCTACAGGGAGCCGGG + Intronic
1142525707 17:539054-539076 CTGGGTAGACACAGCGAACTGGG + Intronic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1144085762 17:11807216-11807238 CAGGAGAGAAACAGGGAGCCCGG - Intronic
1145404199 17:22571229-22571251 GAGGGTAGCAAGAGGGAGCAGGG + Intergenic
1146299104 17:31674342-31674364 CAGGATAGACACTGGAGGCATGG - Intergenic
1146390120 17:32414379-32414401 CAGGGTGGGTACAGGGAGAATGG - Intergenic
1146483798 17:33227294-33227316 CAGGGTGGCCACATGGAGAAGGG - Intronic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149565811 17:57639851-57639873 CAGGATAGACACAGGGGGATGGG - Intronic
1149869207 17:60167771-60167793 CTGGGAAGACACATGGAGCTAGG - Intronic
1151785853 17:76274636-76274658 TAGAGTAGACACTGGGAGAAGGG + Intronic
1152403559 17:80083534-80083556 CAGGGCAGACACAGGGCCCGAGG + Intronic
1152453737 17:80400732-80400754 AAGGGTAGAGACACGGAGAAGGG - Intergenic
1153543934 18:6186550-6186572 CAAGGAAGACACAGTAAGCATGG + Intronic
1154978534 18:21482778-21482800 CAGCGAAAGCACAGGGAGCATGG + Intronic
1155961794 18:32001458-32001480 AAGGGTAGAGACATGGAGAAGGG - Intergenic
1156252087 18:35360829-35360851 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1156294522 18:35777461-35777483 CAAGGTAGGGGCAGGGAGCACGG + Intergenic
1156341581 18:36214509-36214531 CAGGGAAGAGACAGGGAGGGTGG - Intronic
1156733357 18:40223149-40223171 CAGGTTTGGCACAGGGAACAGGG - Intergenic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1160559430 18:79746917-79746939 CACGGTAGGCACAGTGGGCACGG - Intronic
1160669077 19:348169-348191 CAGAGAAGAAACAGGGAGCCTGG - Intergenic
1160895402 19:1399939-1399961 CTGGGCAGACACAGGGCGCCTGG + Intronic
1161021553 19:2013811-2013833 CAGGGAGGACGCAGGGAGCAAGG + Intronic
1161043634 19:2123103-2123125 CAGGGGAGATGCAGGGGGCATGG - Intronic
1161217758 19:3102976-3102998 CAGTGCACACACCGGGAGCAAGG - Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162088211 19:8261259-8261281 CCAGGAAGACACAGGGAGCAGGG - Intronic
1163694804 19:18758736-18758758 CAGGGGAGACCCAGGAAGCTTGG - Intronic
1163871467 19:19824809-19824831 CTGGGGAGAGACAGAGAGCATGG + Intergenic
1163948805 19:20565429-20565451 CAGGGAAGACACAGGACGCCAGG + Intronic
1165072785 19:33265210-33265232 CATGGTTCACACAGGGAGCATGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166139411 19:40798137-40798159 CAGGGCACACACAGGGTTCATGG - Intronic
1166339752 19:42130597-42130619 CAGTGTAGACACAGAGATCCAGG - Intronic
1166679804 19:44759369-44759391 GAGGCTAGACCCAGAGAGCAGGG - Intronic
1166790366 19:45395599-45395621 GAGGGGGGACCCAGGGAGCATGG + Exonic
1168189203 19:54725775-54725797 CAAGGTAGACACAGGATGGAGGG - Intronic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
925079932 2:1056040-1056062 CAGAGTGGACACAGGGAGAAGGG + Intronic
925319119 2:2948606-2948628 CAGGCTAGGCAAGGGGAGCAGGG + Intergenic
925434008 2:3820416-3820438 GAGGGTAGAGACACGGAGAAGGG + Intronic
926355512 2:12037533-12037555 CAGGGTAGAGTCAGGGAGCTGGG - Intergenic
926735897 2:16073109-16073131 CAGTGGAGACACAGGCCGCATGG + Intergenic
926926827 2:17995800-17995822 CAGGGCAGTCTCAGGGACCAAGG + Intronic
927231489 2:20828366-20828388 AAGGTTAGAAACAGAGAGCAAGG + Intergenic
928584973 2:32750308-32750330 CAAGGTATACACACAGAGCATGG + Intronic
928694124 2:33831809-33831831 AAGGGAAGACAAAAGGAGCAGGG + Intergenic
928820619 2:35356443-35356465 CAGAGTGGACACCAGGAGCAGGG + Intergenic
928934763 2:36664030-36664052 CGGGGGAGGCGCAGGGAGCAGGG - Intergenic
929684691 2:44023569-44023591 AAGGGTAGAGACACGGAGAAGGG + Intergenic
930487521 2:52026632-52026654 AAGGGTAGAGACACGGAGAAGGG + Intergenic
932119922 2:69088971-69088993 CAGGATAGACTTAGGGACCAGGG + Intronic
932449196 2:71798856-71798878 CAGGGGAGAAAAAGGGACCATGG + Intergenic
933980606 2:87547305-87547327 CAGGGTAAGCATAGGAAGCACGG + Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934696613 2:96404845-96404867 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
935277994 2:101492275-101492297 CTGCGTAGAAACATGGAGCATGG - Intergenic
935327058 2:101947007-101947029 AAGGGTAGTCCCAGGGAGCCCGG + Intergenic
935862668 2:107350026-107350048 CAGAGTAGACTCAGGAGGCAAGG + Intergenic
936313221 2:111403486-111403508 CAGGGTAAGCATAGGAAGCACGG - Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
937091080 2:119206666-119206688 CAGGGTAGGTACAGGGGGCCGGG + Intergenic
937310192 2:120897286-120897308 CTGGGCAGAGCCAGGGAGCAGGG - Intronic
937745215 2:125404056-125404078 GAGGGAAGACACAGGGGTCAGGG + Intergenic
938248919 2:129798809-129798831 CAGGGAGGACACAGGGAGTAAGG - Intergenic
938321379 2:130367999-130368021 CAGGGTAGACACTAGAAGAAAGG - Intronic
938689759 2:133776854-133776876 CACTGTAGACACAAGGGGCAAGG + Intergenic
938783567 2:134606535-134606557 GCGGGTAGAGGCAGGGAGCATGG - Intronic
939865816 2:147471300-147471322 AAGGGAACACACAGGAAGCAAGG + Intergenic
940682918 2:156808427-156808449 CAGGGTAGAAGCAGGGAGAGTGG + Intergenic
943345736 2:186734920-186734942 CAGGGCTGGCACCGGGAGCAGGG + Intronic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
944909269 2:204293349-204293371 CATGGTATACACAGTGGGCATGG + Intergenic
945554543 2:211262671-211262693 GAGGGTAGAGACATGGAGAAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948328968 2:237150312-237150334 CAGGGTAGACACTGGGGCAAGGG + Intergenic
1169422643 20:5472182-5472204 CAGGGTGGGCACAGTGACCAGGG + Intergenic
1169426827 20:5503600-5503622 CAGGGTGGGCACAGTGACCAGGG - Intergenic
1170680596 20:18522137-18522159 AAGGGTAGAGACACGGAGTAGGG + Intronic
1171851916 20:30314881-30314903 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1172147008 20:32763758-32763780 CAGGGGAGGAAAAGGGAGCAGGG - Intronic
1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG + Intergenic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1172810080 20:37641201-37641223 CAGGGGAGACACAGAGAAAAGGG - Intergenic
1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG + Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174513657 20:51074994-51075016 CTGGGTAGAGGCAGGGAGCTAGG - Intergenic
1174556588 20:51399982-51400004 CAGGTGAGACACGGGGAGGAGGG - Intronic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176060798 20:63171993-63172015 CAGGGGAGACACAGAGACCGGGG + Intergenic
1176060804 20:63172034-63172056 CAGGGAAGAGACAGCGACCAGGG + Intergenic
1176060808 20:63172052-63172074 CAGGGGAGAGACAGAGACCAGGG + Intergenic
1176060811 20:63172070-63172092 CAGGGAAGAGACAGTGACCAGGG + Intergenic
1176060815 20:63172088-63172110 CAGGGGAGAGACAGAGACCAGGG + Intergenic
1176060874 20:63172437-63172459 CAGGGGAGAGACAGTGACCAGGG + Intergenic
1176104495 20:63379545-63379567 CAGAGCAGGCACTGGGAGCAGGG - Intergenic
1176152864 20:63601872-63601894 CACGGAAGCCACAGGCAGCACGG - Intronic
1177904508 21:26959123-26959145 CAAGTTGGAGACAGGGAGCAGGG + Intronic
1178001042 21:28162372-28162394 AAGGGTAGAGACACGGAGAAGGG - Intergenic
1178438257 21:32578312-32578334 CAGTGCAGAAGCAGGGAGCACGG + Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179415565 21:41195591-41195613 CAGGATTGAAACAGGGAGAATGG - Intronic
1179955407 21:44735487-44735509 CTGGGTAAACACTGGGAGCTGGG - Intergenic
1180824094 22:18851263-18851285 CTGGGTAGAGACAGGGCCCATGG - Intronic
1180834228 22:18921872-18921894 CAGGGAGGACACAGTGGGCAAGG + Intronic
1181065585 22:20304231-20304253 CAGGGAGGACACAGTGGGCAAGG - Intergenic
1181084848 22:20435137-20435159 CAGGGAAGACTCAGGGTGCAAGG - Intronic
1181490010 22:23255780-23255802 GAGGGCAGAAGCAGGGAGCAGGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181590251 22:23879794-23879816 GAGGGTAGACCCAAGAAGCATGG - Intronic
1181660200 22:24341167-24341189 CAGGGCAGATACTGGGAGGAGGG + Intronic
1181668738 22:24415777-24415799 GAGGGTGGGCACAGGGGGCATGG - Exonic
1181820073 22:25468689-25468711 CAGGGCAGCCACAGGACGCAGGG - Intergenic
1182593529 22:31400152-31400174 TAGGGTAGACACTGGGAAAAGGG - Intronic
1182881184 22:33734853-33734875 CATGGTAGCCAGAGGTAGCATGG - Intronic
1184033155 22:41906421-41906443 CAGGGTAGGCCCAGGGGGCTGGG + Exonic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184563418 22:45276612-45276634 CAGGTAAGACACAGGGAGTAGGG - Intergenic
1185082678 22:48718508-48718530 CAGGGCAGACACAGGTCGCACGG - Intronic
1185325705 22:50224995-50225017 CAGGGGAGACACATGGTCCAAGG + Intronic
1185421277 22:50735623-50735645 CAGGGTGGAAGCAGAGAGCAGGG + Intergenic
1203284317 22_KI270734v1_random:147171-147193 CAGGGAGGACACAGTGGGCAAGG + Intergenic
950149795 3:10678078-10678100 CAGTGTAGCAACTGGGAGCATGG - Intronic
951894711 3:27599917-27599939 AAGGGTAGAGACACGGAGAAGGG - Intergenic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
952296661 3:32068417-32068439 AAGGGTAGAGACACGGAGAAGGG - Intronic
952933236 3:38375843-38375865 CCAGGTAGAGACAGGGAGCTTGG - Intronic
953107493 3:39898496-39898518 CAGGCTAGAAAAAGGGGGCAGGG + Intronic
953478196 3:43224178-43224200 CTGGGTAGACACATAAAGCATGG - Intergenic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
954222599 3:49163695-49163717 CAGGGTAGACACCTGGATAAAGG + Exonic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955267787 3:57464057-57464079 CAGGGTAGAAACAGTGAGTTGGG - Intronic
958421798 3:93938954-93938976 GAGGGTAGAGACATGGAGAAGGG - Intronic
958657525 3:97021383-97021405 CAGAGTAGTCACAGGAAGTAAGG - Intronic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
959871334 3:111331810-111331832 CAGGGTAGACCCAAGGGCCATGG + Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961428865 3:126865703-126865725 CAGAGTAGACTCAGGGAAGAGGG - Intronic
961502899 3:127350255-127350277 CCGGGGAGAGACAGAGAGCAAGG - Intergenic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962334750 3:134517161-134517183 CAGTGAGGACACAGAGAGCAAGG - Intronic
962507279 3:136060544-136060566 CAGGGGAGAGACAGAGAACAAGG - Intronic
962524185 3:136222779-136222801 AAGGGTAGAGACATGGAGAAGGG + Intergenic
963319577 3:143798456-143798478 AAGGGTAGAGACATGGAGAAGGG - Intronic
963520286 3:146354753-146354775 GAGGGTAGAGACATGGAGAAGGG - Intergenic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963634426 3:147776609-147776631 CAGAGTAGAAATAGGGAGAATGG - Intergenic
963734465 3:149004157-149004179 CAGGTGAGAGACAGGGAGAAAGG - Intronic
965288877 3:166850110-166850132 CCTGGGAGCCACAGGGAGCAAGG - Intergenic
965779822 3:172273423-172273445 CGGGGAATATACAGGGAGCAGGG - Intronic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
966366627 3:179195033-179195055 CAGGGTAGAGACAGATAACAAGG + Intronic
966398607 3:179525449-179525471 GAGGGTAGAGACACGGAGAAGGG + Intergenic
966875161 3:184317398-184317420 CAGGGTAGACATGGGCAGCTGGG - Exonic
967005523 3:185379051-185379073 AAGGGTAGAGACACGGAGAAAGG + Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968459683 4:718306-718328 CAGGTTATACCCAGGGAGCTCGG - Intronic
969433294 4:7168632-7168654 CTGGGCAGCCACAGAGAGCAAGG - Intergenic
969602129 4:8182778-8182800 CATGAAAGACACAGGGTGCAGGG - Intronic
971184357 4:24359388-24359410 CAGGGTAGAGACCGGGATAAAGG - Intergenic
973637089 4:52870403-52870425 CAGGGCAGACATAGCGGGCATGG - Intergenic
975299635 4:72774872-72774894 CAGAGTGGGCACTGGGAGCAGGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
977625386 4:99184281-99184303 GAGGGTATAGACAGGGAGAAGGG - Intergenic
977893600 4:102340256-102340278 GAGGGTAGAGAGAGGCAGCAGGG + Intronic
978303390 4:107294964-107294986 GAGGGTAGAGACATGGAGAAGGG + Intergenic
980284797 4:130768552-130768574 GAGAGTAGAGACAGGGAGAAGGG - Intergenic
980582590 4:134773527-134773549 CAGAGTGGACACCAGGAGCAGGG - Intergenic
981886140 4:149675311-149675333 TAGGGAAGACAAAGGGAGAATGG + Intergenic
984364778 4:178784681-178784703 AAGGGTAGACGCAGTTAGCACGG + Intergenic
985588518 5:753045-753067 CAGGTTAAACACAGGCAGCAGGG - Intronic
985603185 5:845484-845506 CAGGTTAAACACAGGCAGCAGGG - Intronic
985606015 5:858417-858439 CAGGATAGATTCAGGGACCACGG - Intronic
986257050 5:6109349-6109371 GAGGGTAGGCACAGGGAATAGGG - Intergenic
988592926 5:32564725-32564747 CAGGGGACAAACAGGAAGCATGG + Intronic
991122713 5:63033857-63033879 CAGGGTAGTCACTGGGAACTGGG + Intergenic
991507674 5:67342433-67342455 CAGGGTAGCCACATAGAGAAGGG + Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
994109191 5:95981156-95981178 CAGAGTATACACAGGGTGCTTGG - Intergenic
994672012 5:102773593-102773615 CAGTGCAGAAACAGTGAGCAGGG + Intronic
995561542 5:113387125-113387147 CAGGCTAGATACAGGGATAATGG - Intronic
997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG + Intronic
997453100 5:133999236-133999258 AATGGTTGATACAGGGAGCAGGG + Intronic
998265246 5:140663191-140663213 CAGGGTAGACAGTGGCAGCGTGG - Intergenic
998693865 5:144615942-144615964 AAGGGTAGAGACACGGAGAAGGG + Intergenic
999199627 5:149806471-149806493 CAGGAGAGACCGAGGGAGCAGGG - Intronic
1000763587 5:165256940-165256962 AAAGGTAGACACCAGGAGCAGGG + Intergenic
1000974612 5:167751106-167751128 CAGGGTGGAGAGAGGAAGCAGGG + Intronic
1002057500 5:176606971-176606993 CAGGGTAGGGACAGAGAGCCTGG + Intronic
1002279769 5:178123476-178123498 CAGGGTAGCCAAAGGGAGTGAGG - Exonic
1002298719 5:178245949-178245971 CAGGGCAGACCCGGGGAGCCAGG - Exonic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003510971 6:6780052-6780074 GAGGGAAGACACAGAGAACAAGG + Intergenic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1004254655 6:14051829-14051851 CAGGGTGGAGTCAGGGAGCTGGG + Intergenic
1004443155 6:15672576-15672598 CAGGGTACAGTCTGGGAGCATGG + Intergenic
1005511599 6:26516834-26516856 CAGGGGACACACAGAGGGCACGG - Intergenic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007320093 6:41021946-41021968 GAGGGTAGTCACAGGCAGAAAGG + Intergenic
1007404597 6:41627236-41627258 GAGGGTAGAGAGAGGGAGCTAGG - Intergenic
1007655856 6:43450655-43450677 CAGGGTAGCAACAGGGTCCAGGG + Exonic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1010277068 6:73981107-73981129 CAGGGTAGGGAGAGGGAGCTGGG - Intergenic
1010829841 6:80514838-80514860 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1011155803 6:84329784-84329806 GGGTGTAGAGACAGGGAGCAGGG + Intergenic
1012231222 6:96762809-96762831 CAGAGTGGGCACCGGGAGCAGGG + Intergenic
1013285192 6:108675274-108675296 CAAGGGAGACACAGGGAGAGAGG - Intronic
1013612783 6:111810715-111810737 TCGGGGAGGCACAGGGAGCAGGG - Intronic
1014007773 6:116440928-116440950 CAGGGAATACACAGCGAACAGGG - Exonic
1014115502 6:117664223-117664245 AAGGGTAGAGACATGGAGAAGGG + Intergenic
1014177924 6:118350296-118350318 CAGAGAAGAAGCAGGGAGCAGGG + Intergenic
1014384639 6:120785801-120785823 CAGAGTGGGCACCGGGAGCAGGG - Intergenic
1014578830 6:123109059-123109081 CAGGCTATACACAGGAAGTATGG + Intergenic
1014949900 6:127542220-127542242 AAGGGTAGATACAGGAAACATGG - Intronic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017122690 6:151039232-151039254 CAGTGTTGGCACAGGGAGAAGGG + Intronic
1017754260 6:157516442-157516464 CATGGCAGACACACAGAGCACGG - Intronic
1018147021 6:160900798-160900820 CAGGGTACTGAGAGGGAGCATGG + Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1021081171 7:16367216-16367238 CACAGTGGGCACAGGGAGCAAGG - Intronic
1021660456 7:22914320-22914342 GAGGGTAGAGACACGGAGAAGGG - Intergenic
1022423533 7:30246336-30246358 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
1022493187 7:30836435-30836457 CAGGGTTGTGACAAGGAGCATGG + Intronic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1023664684 7:42510566-42510588 CAGGATAGACACTGAGAGCTAGG + Intergenic
1023940395 7:44765551-44765573 CAGGGTAGTCGCTGGGGGCAGGG - Exonic
1024094633 7:45974070-45974092 CAGAGGGGACACAGGGGGCAAGG - Intergenic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024412951 7:49067768-49067790 GAGGGTAGAGAATGGGAGCAGGG + Intergenic
1024481997 7:49873325-49873347 CAAGGTGGACATAGGGAGAAGGG - Intronic
1024697470 7:51871221-51871243 AAGAGTAGAGACAGGGAGAAGGG - Intergenic
1024904094 7:54356425-54356447 GAAGGTAGACACATGGACCATGG + Intergenic
1026638294 7:72103454-72103476 GAGTGTAGACACAGGTGGCAAGG + Intronic
1027158071 7:75782465-75782487 AAGGGTAGAGACATGGAGAAGGG - Intronic
1027354252 7:77340865-77340887 GAGGGTAGAGACACGGAGAAGGG - Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029608760 7:101615408-101615430 CAGGGCAGACGCAGGGTCCAGGG + Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030077109 7:105746226-105746248 CAGTGTAGACACAGGAAGGGTGG - Intronic
1030163775 7:106532940-106532962 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1030441843 7:109596550-109596572 CAGAGTAGAGACAGGGAGAAGGG + Intergenic
1031099712 7:117464517-117464539 CAGGGTTGATTCAAGGAGCAAGG + Intergenic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032658400 7:133955876-133955898 CAGAGTGGGCACTGGGAGCAGGG + Intronic
1033266077 7:139888372-139888394 CAGTGTAGACCCAGGGAACAAGG - Intronic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034345536 7:150383414-150383436 CAGGTTAGCCCCAGGGAGCGGGG - Intronic
1034359068 7:150478096-150478118 CAGGATAGACACTGTGATCAAGG + Exonic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035240621 7:157526911-157526933 CAGGAGAGCCACAGAGAGCACGG + Intergenic
1035336703 7:158133928-158133950 CAGGGAAGACTCAGGGTGCTCGG + Exonic
1036661941 8:10714580-10714602 CTCGGGAGACACAGGCAGCAGGG + Intergenic
1036943787 8:13075311-13075333 GAGGGAAGACACAGCGAGCAGGG + Intergenic
1037838204 8:22227034-22227056 CAGGGTACAAACAGAGAGCCAGG + Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1040725028 8:50371852-50371874 AATGGTAGCCAAAGGGAGCAGGG - Intronic
1040879337 8:52188650-52188672 AAGGTTAGAAACAAGGAGCATGG + Intronic
1041011887 8:53551928-53551950 CAAGATAGAGAAAGGGAGCAAGG - Intergenic
1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG + Intergenic
1041419791 8:57653730-57653752 GAGGGTAGACACAGTGAAAATGG - Intergenic
1041917694 8:63152841-63152863 AAGGGTAGAGACATGGAGAAGGG + Intergenic
1042427085 8:68661111-68661133 CAGGGCAGTCTCAGGGATCAAGG - Intronic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044118472 8:88364583-88364605 CAAGGCCGACACAGGCAGCAGGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045948968 8:107830078-107830100 AGGGGTAGACACAGGGAGGGAGG + Intergenic
1046074736 8:109302012-109302034 GAGGGTAGAGACAGGGAGAAGGG - Intronic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1049015899 8:139919850-139919872 AAGGGTAAAACCAGGGAGCATGG - Intronic
1049401655 8:142430337-142430359 CAGGGGAAACACAGGTTGCAGGG - Intergenic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1050282857 9:4069972-4069994 CAGGAGAGACCCAGGGAACATGG + Intronic
1052087358 9:24284034-24284056 CAAGATAGACACAGGGAGCTAGG - Intergenic
1053133982 9:35637856-35637878 AAAGGTAGAGACACGGAGCAGGG - Intronic
1053280789 9:36818820-36818842 CCAGATAGACACAGGGAGCGGGG - Intergenic
1053789702 9:41678135-41678157 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054155442 9:61636618-61636640 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054178040 9:61889825-61889847 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054475227 9:65567728-65567750 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054659489 9:67690999-67691021 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1055491283 9:76807639-76807661 CAAGATAGACACAGGGAGAGAGG + Intronic
1056331581 9:85525553-85525575 AAGGCTAGAGACGGGGAGCAGGG - Intergenic
1057044005 9:91870363-91870385 CAGGGTACACACCGGGATCAGGG + Intronic
1057812740 9:98270352-98270374 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1057904076 9:98971132-98971154 CAGTGTAGACACATAGACCAGGG - Intronic
1059812733 9:117874033-117874055 CAGCGTAGGCAGGGGGAGCAGGG + Intergenic
1061303765 9:129721212-129721234 GAGGGTGGACACAGGGCGCTGGG - Intronic
1062333292 9:136053879-136053901 CAGGGCTGACACAGACAGCAAGG + Intronic
1062427488 9:136512621-136512643 CAGGGTGGGCGCCGGGAGCACGG + Intronic
1186813587 X:13213807-13213829 CAGGTTGGCTACAGGGAGCAAGG + Intergenic
1187103928 X:16221336-16221358 GAGGGTAGAGACATGGAGAAGGG + Intergenic
1188478986 X:30618184-30618206 CAGTGTAGAAACAGGGAGTTGGG - Intergenic
1189612213 X:42749289-42749311 CATGGTTGACACAGGGATAAGGG - Intergenic
1190823708 X:53997679-53997701 CAGGATGGACCCAGGGACCAAGG - Intronic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1193533709 X:82686994-82687016 CTTGGGAGACACATGGAGCAAGG - Intergenic
1195017115 X:100790959-100790981 GAGGGTAGAGACATGGAGAAGGG + Intergenic
1197075317 X:122345739-122345761 CAGGAGAGAGACAGAGAGCAAGG + Intergenic
1198020831 X:132656364-132656386 CAGAGAATACTCAGGGAGCAAGG - Intronic
1198983906 X:142428062-142428084 AAGGGTAGAGACACGGAGAAGGG + Intergenic
1199308309 X:146293057-146293079 CCTGGGAGACACATGGAGCAAGG - Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1200787799 Y:7274610-7274632 CCGGGGAGACCCAGGGCGCAAGG - Intergenic
1200988693 Y:9328294-9328316 CAGGGAAGACATAGGGACCTTGG - Intergenic
1201691719 Y:16774753-16774775 AAGGGTAGAGAGAGGTAGCAAGG - Intergenic