ID: 1090418776

View in Genome Browser
Species Human (GRCh38)
Location 11:126559065-126559087
Sequence AGGGAAACTACCCCTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090418776 Original CRISPR AGGGAAACTACCCCTGGGGA AGG Intronic
902337604 1:15762829-15762851 CAGGAAACTGCCCCTGGAGAGGG + Intronic
902962493 1:19974784-19974806 TGGGAAACCAACCCTGGTGACGG + Intergenic
903810728 1:26033686-26033708 AGGCAAAGTCCACCTGGGGAGGG - Exonic
904833714 1:33321406-33321428 AAAGACACTTCCCCTGGGGAGGG - Intergenic
905925475 1:41746540-41746562 AGGGAAGCTATGCATGGGGATGG + Intronic
906282881 1:44566124-44566146 AGGGTCCCTGCCCCTGGGGAAGG - Intronic
907398281 1:54207787-54207809 AGGGATACTACATCTGGGGGTGG - Intronic
908197939 1:61763946-61763968 AAGGAAAATACGCCTGGGCAAGG - Intronic
910121127 1:83791641-83791663 AGGGAGACTACCCCTTAGAAAGG - Intergenic
911125156 1:94334530-94334552 AGGGAAACTACCACCTTGGAAGG + Intergenic
912754377 1:112312339-112312361 GGGAACACTAGCCCTGGGGAGGG + Intergenic
912880418 1:113406867-113406889 AGGGAAAGCATCCCTGAGGAGGG + Intronic
917561697 1:176164854-176164876 AGGGAAACTACCACTAGGCTAGG + Intronic
918689788 1:187466191-187466213 AGGGAGTCTGTCCCTGGGGAGGG - Intergenic
919522507 1:198606091-198606113 AGAGAAACTTCCTCTGGGGTTGG + Intergenic
920915114 1:210252784-210252806 AGGGAGACTACCCAGGTGGAAGG - Intergenic
922350198 1:224729014-224729036 ATGGAAAGTACCCCTGGGAGGGG + Intronic
922419047 1:225447203-225447225 AGGAATACTGCCCCTGGGAAGGG - Intergenic
922735541 1:227976501-227976523 ACGGCCCCTACCCCTGGGGATGG - Intergenic
922994559 1:229945366-229945388 AGGCTAGCTGCCCCTGGGGAGGG - Intergenic
923107378 1:230865180-230865202 AGGCAAACTACCCCTTAAGAGGG + Intronic
923322424 1:232847862-232847884 AGCAAATCTACCACTGGGGAAGG + Intergenic
924342701 1:243051419-243051441 ACGGCCCCTACCCCTGGGGATGG + Intergenic
1064193482 10:13227205-13227227 AAGGAAACCACCCCTGGGTCAGG - Intronic
1064947431 10:20806511-20806533 AGGGAAACCTTCCTTGGGGAGGG - Intronic
1066733778 10:38454135-38454157 ACGGCCCCTACCCCTGGGGATGG - Intergenic
1066937546 10:41857654-41857676 AAGGAAACAACCCCAGTGGAAGG + Intergenic
1069313286 10:67066139-67066161 AGGGAAACGAGCACTGGTGATGG - Intronic
1072138522 10:92570494-92570516 AGAGGATCTACCCCTGTGGAGGG + Intronic
1075892861 10:125969774-125969796 AGGGACACAAACACTGGGGAAGG - Intronic
1076188208 10:128464937-128464959 ATGGTAAGTACCCCTGGAGAAGG - Intergenic
1077108640 11:852684-852706 AAGGAAAGGAGCCCTGGGGAAGG - Intronic
1077303735 11:1858686-1858708 AGAGAGTCTAACCCTGGGGAAGG - Intronic
1078237518 11:9499787-9499809 AGGCAAACAACTTCTGGGGAAGG - Intronic
1080458867 11:32436778-32436800 TGGGAAACAACCCCTAGGCAAGG + Intergenic
1081867097 11:46366083-46366105 AGGGAAGCAACCCCTGAGGGAGG - Intronic
1083855656 11:65391913-65391935 AGGGAAACTGAAGCTGGGGAAGG - Intronic
1084564201 11:69920276-69920298 AGGGGAACTCACCCTGAGGAGGG - Intergenic
1087295408 11:96367423-96367445 ATGGAAACTACTCCTAGGAAAGG - Intronic
1087784757 11:102342069-102342091 AAGGGAACTACTCCTGGGGTAGG + Intergenic
1089292667 11:117447652-117447674 AGGGAAGCTACCCCTGGGGATGG - Intronic
1090143791 11:124295614-124295636 AGAGAAACTGCCCCTGGGTAAGG - Intergenic
1090263828 11:125341863-125341885 AGGAAAGCCAGCCCTGGGGAAGG - Intronic
1090418776 11:126559065-126559087 AGGGAAACTACCCCTGGGGAAGG + Intronic
1090794446 11:130122809-130122831 AGGGGAGCTCCCCTTGGGGAGGG - Intronic
1091062086 11:132473178-132473200 TGGGAATCTGCCCCTGGGAATGG - Intronic
1092114909 12:5993310-5993332 AGGGAAGCTGACCTTGGGGAGGG + Intronic
1092164886 12:6336615-6336637 AGGGAGACTTCCCTTCGGGATGG - Intronic
1094090646 12:26645329-26645351 AGGAAACCTACCACTGTGGATGG + Intronic
1096086432 12:48868221-48868243 AGGGAAACTATCCCTGGGTGGGG - Intergenic
1096708457 12:53438135-53438157 AGGGACACAAACACTGGGGAAGG + Intergenic
1097690327 12:62728780-62728802 AGGGAAGCTAGCCCTGGTTATGG + Intronic
1098138621 12:67429090-67429112 AGGAAATGTACCCCTAGGGAAGG + Intergenic
1104252044 12:127104451-127104473 AGGGAGGGTTCCCCTGGGGAGGG + Intergenic
1104610520 12:130223625-130223647 AGGGAAACTACTCAGGGAGAAGG - Intergenic
1104747987 12:131221846-131221868 GGGGACACGCCCCCTGGGGAGGG + Intergenic
1105282536 13:18976658-18976680 AGGTAGACAACCCCTGGGGTAGG + Intergenic
1106254637 13:28011398-28011420 AGGGAAGATCACCCTGGGGAAGG + Intronic
1106714268 13:32372257-32372279 AGGGAATCTAGTCCTGGCGAAGG - Intronic
1107896954 13:44974861-44974883 AGGCAATCAATCCCTGGGGAGGG + Intronic
1110123593 13:71913314-71913336 AGGGAAAGATGCCCTGGGGATGG + Intergenic
1113512973 13:110870434-110870456 AGGGGAACTTGCCCTGGGCATGG + Intergenic
1114293857 14:21311792-21311814 AAGGAAAGTACCTCTGGGAATGG - Intronic
1117993695 14:61459108-61459130 AGGGAAAATGGCCCTGGAGAAGG + Intronic
1118312898 14:64705989-64706011 TGGGTAACTTGCCCTGGGGATGG + Intronic
1118820577 14:69342843-69342865 AGGGAAAGTCTCCCTGGGAAGGG - Intronic
1118905759 14:70022066-70022088 TGTGCAACTTCCCCTGGGGAAGG - Intronic
1123030903 14:105450588-105450610 AGGGGAGGTCCCCCTGGGGAGGG + Intronic
1123854285 15:24391983-24392005 AGTGAAGCCTCCCCTGGGGAAGG - Intergenic
1123870306 15:24565190-24565212 AGTGAAGCCTCCCCTGGGGAAGG - Intergenic
1125002494 15:34786018-34786040 AAGAAAACTACCCCAAGGGAAGG - Intergenic
1129775716 15:78235018-78235040 AGGGAGCCCACCCCGGGGGAAGG + Intronic
1130335398 15:82953061-82953083 AGGGAACCGAGGCCTGGGGAGGG + Intronic
1130853260 15:87818843-87818865 ATGGAAACTACCACTGGTGCTGG + Intergenic
1133188639 16:4117008-4117030 AGGTAAACTACCCCTGGGGCGGG - Intergenic
1133697667 16:8280339-8280361 ATGTAAACTACCAATGGGGAGGG + Intergenic
1134061421 16:11201893-11201915 AGGGGACCTGGCCCTGGGGAGGG + Intergenic
1135398339 16:22148094-22148116 AGGGAAACCACCCAGGAGGAGGG + Intronic
1137428661 16:48400700-48400722 AGGGACACAAACACTGGGGAAGG - Intronic
1138297598 16:55900203-55900225 TGGGAAACTTCTCCTGGGGCAGG - Intronic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1146620324 17:34392058-34392080 AGGGTATCTAGACCTGGGGAAGG - Intergenic
1147332276 17:39706042-39706064 AGGTAAAGCACCCCTGGTGAGGG - Intronic
1148189087 17:45666416-45666438 GGGGAAACTGCCCCTGGTGAGGG + Intergenic
1148557546 17:48587469-48587491 GGGGAGACTAGCCCTGGGAAGGG + Intronic
1150409322 17:64930299-64930321 AGGGACACAACCACTGTGGAAGG + Intergenic
1153152866 18:2114541-2114563 CGGGAAACTACCTGTGGGGAAGG - Intergenic
1153394417 18:4602412-4602434 TGGGGAACATCCCCTGGGGAGGG - Intergenic
1154249290 18:12729718-12729740 ATGGAATCTACTCCTGGTGAAGG - Intergenic
1155550802 18:26962742-26962764 AAGCAAACTACCCCAGGCGATGG - Intronic
1156241864 18:35262631-35262653 TGGGAAGCTACCCATAGGGATGG - Intronic
1156326113 18:36077043-36077065 AGGGACACAAACACTGGGGAAGG - Intergenic
1158629401 18:59099188-59099210 AGGGAAAGAACCCCTGGGGCAGG - Intergenic
1160526894 18:79543623-79543645 AGGGAGACCAGGCCTGGGGAGGG + Intergenic
1162164088 19:8740273-8740295 AGGGAAACAAACACTGCGGAAGG + Intergenic
1162427371 19:10604494-10604516 AGGGAGCTTTCCCCTGGGGATGG + Intronic
1164055080 19:21615382-21615404 AGGGACACTAACACTGCGGAAGG + Intergenic
925400363 2:3568651-3568673 AGGGACACAAACACTGGGGAAGG - Intergenic
926112515 2:10192283-10192305 AGGGAAAACGCCCCTGGGGAAGG - Intronic
928687822 2:33767608-33767630 AGGGAATCTACACCAGAGGAAGG - Intergenic
930021624 2:47005143-47005165 GGGGAAGCTCTCCCTGGGGAGGG + Intronic
931191254 2:60002554-60002576 GGGGAAATTGCCCCTGGGGGAGG - Intergenic
934514942 2:94980790-94980812 AGGGAAAAAGCCCCTGGGAATGG - Intergenic
937025166 2:118691733-118691755 AGGGAAACCACCCCTGAGGCCGG + Intergenic
937986861 2:127641903-127641925 AGGGGCAGTACCCCTGAGGAAGG + Intronic
938397228 2:130960705-130960727 ACGGAATCTTCCCCTGGTGAAGG + Intronic
939280990 2:140064609-140064631 AGGGGAACTCTCCTTGGGGAAGG + Intergenic
941069736 2:160942528-160942550 GGAGAAACTTCCCCTAGGGATGG - Intergenic
942877082 2:180813749-180813771 ATGGAATCTACTCCTGGTGAAGG + Intergenic
944317602 2:198300198-198300220 AGGGACACCCCCACTGGGGAGGG + Intronic
947771459 2:232673600-232673622 AGGGAAAGCAGCCCAGGGGAGGG - Intronic
948306599 2:236952802-236952824 ATCGCAGCTACCCCTGGGGAGGG + Intergenic
948392682 2:237624320-237624342 AGGCAAACTTGCGCTGGGGACGG + Intergenic
948514053 2:238492064-238492086 AGGGAAACTATCCTTCAGGAAGG - Intergenic
1169163944 20:3407064-3407086 AGGGAAACATTCCCTGGGGAAGG + Intronic
1170140639 20:13122382-13122404 AGGGAAAGTACCGCAGGGTAAGG + Intronic
1173729403 20:45318013-45318035 AGGGTAACAACCCCAGGGCAGGG - Intergenic
1174060029 20:47826204-47826226 AGAGAAACGGCCTCTGGGGAGGG - Intergenic
1174069267 20:47888473-47888495 AGGGAAACAGACCCGGGGGAAGG - Intergenic
1174071867 20:47905172-47905194 AGAGAAACAGCCTCTGGGGAGGG + Intergenic
1174152185 20:48493497-48493519 AGAGAAACGGCCCCTGGGGAGGG - Intergenic
1174467433 20:50729113-50729135 AGGGATGCCACACCTGGGGAAGG + Intergenic
1175913584 20:62415717-62415739 AGGGATCCTCCCCCTGGGGCTGG - Intronic
1178503567 21:33145379-33145401 ATGGCAGCTGCCCCTGGGGAGGG - Intergenic
1183931008 22:41236314-41236336 AGGGTAACTAACCCTGGAAAGGG + Intronic
1185321022 22:50200393-50200415 AGGGACCCGACCCCTGGGGGAGG - Intergenic
949871072 3:8589643-8589665 AGGGAAACTGAGGCTGGGGAAGG - Intergenic
950866798 3:16196148-16196170 AGGGGAAACAGCCCTGGGGAGGG + Intronic
951150822 3:19287985-19288007 AGGGAAAATTCTCCTGGGTAAGG - Intronic
952660175 3:35836372-35836394 ATGGAAACTATTCCTGGTGAAGG - Intergenic
953540564 3:43814222-43814244 TGGGAAAATAACCATGGGGAAGG - Intergenic
955326177 3:58010457-58010479 AGGGAAGCCACCCTTGGGGAGGG - Intronic
955759071 3:62258822-62258844 TGGGAAACTACTCCCTGGGAAGG - Intronic
958045795 3:88282288-88282310 AGGAAAAATACCTCTGGGAAGGG + Intergenic
958933342 3:100231031-100231053 ATGGAATCTACTCCTGGTGAAGG + Intergenic
959195873 3:103181066-103181088 ATGGAATCTACCCCTGGTGAAGG + Intergenic
959263946 3:104114219-104114241 AAGGTAACTACCCCCTGGGATGG + Intergenic
959923757 3:111898709-111898731 ATGGAAACTACTCCTGGTAAAGG - Intronic
960974509 3:123161505-123161527 AGGGAAACTTCCACTGAGGAGGG + Intronic
961155983 3:124680143-124680165 AGGAAAAGGAGCCCTGGGGAGGG + Intronic
961484474 3:127207376-127207398 AAAGAAACTACCCCTGGGTTTGG + Intergenic
964078631 3:152723712-152723734 ATGGCAACTACCACTGGGGCTGG - Intergenic
964392490 3:156212269-156212291 ACTGAAAATACCCCTGGGAAAGG - Intronic
969364981 4:6689201-6689223 AGGGACACAGCTCCTGGGGAGGG - Intergenic
970599375 4:17628852-17628874 TGGGAAAATATCCCTGTGGAGGG + Exonic
974699188 4:65417099-65417121 AGGGAAGCTGCCCCTTGGCAGGG - Intronic
977835529 4:101641559-101641581 AGGGTAGCCACCCCTGGGTAGGG + Intronic
978842982 4:113236506-113236528 GGGAAAACAGCCCCTGGGGATGG - Intronic
979260126 4:118637122-118637144 ACGGCCCCTACCCCTGGGGATGG - Intergenic
979328250 4:119403506-119403528 ACGGCCCCTACCCCTGGGGATGG + Intergenic
981752782 4:148108684-148108706 TGGGAACCTACCCCTGGGGTGGG - Intronic
982876142 4:160652703-160652725 ATGGAATCTACTCCTGGTGAAGG + Intergenic
985600592 5:827887-827909 AGGGACACAAACACTGGGGAAGG - Intronic
985904760 5:2824860-2824882 AGTGAAAATACCACGGGGGATGG + Intergenic
987376719 5:17242409-17242431 AGGGAAACTATGCATGGGGTGGG - Intronic
988607198 5:32689109-32689131 ACGGAACCTGGCCCTGGGGAGGG + Intronic
989000973 5:36760042-36760064 ATGGAATCTACTCCTGGTGAAGG - Intergenic
990498743 5:56373322-56373344 AGGGACACAAACACTGGGGAAGG + Intergenic
991621903 5:68553588-68553610 ATGGAATCTACTCCTGGTGAAGG - Intergenic
992858975 5:80892621-80892643 AGGGAAACCACCCCTAGTTAAGG - Intergenic
995260519 5:110098683-110098705 AGGCAATCCACCCCTGTGGAAGG - Intergenic
996679184 5:126212138-126212160 AAGCCAGCTACCCCTGGGGAGGG + Intergenic
998045106 5:138980804-138980826 AGGGACTCTGCCACTGGGGAGGG - Intronic
1002295621 5:178229490-178229512 AGGGAAACCTTCCCTGAGGAAGG - Intronic
1005046053 6:21643528-21643550 AGAGAATCTACTCCTGGTGAAGG + Intergenic
1006424562 6:33956120-33956142 AAGGAAGCTACCCCCTGGGATGG - Intergenic
1008479825 6:51974157-51974179 AGGGAAACTTCTTCTGGAGAGGG - Intronic
1008678045 6:53842682-53842704 AGGGAAACCTGCCCTGGGGAAGG + Intronic
1010002631 6:70963077-70963099 AAGGATACAACCCCTGGGCAGGG + Intergenic
1012492925 6:99802504-99802526 GGGGAAACTTGCCCTGGAGAGGG + Intergenic
1012983432 6:105853253-105853275 AGGGACACAAACCCTGCGGAAGG - Intergenic
1013584753 6:111568559-111568581 AGGGAGAGTGTCCCTGGGGAGGG + Intronic
1013804846 6:113985792-113985814 AGAGCACCTTCCCCTGGGGAAGG - Intronic
1014463554 6:121729224-121729246 AGGGACACAAACACTGGGGAAGG - Intergenic
1014758427 6:125327681-125327703 ATGGAAGCTACCTATGGGGATGG - Intergenic
1017719969 6:157236900-157236922 GGGGAAAGTGCCCCTGCGGACGG + Intergenic
1022784414 7:33623899-33623921 AGAGAAAATACCACTGGGGAGGG + Intergenic
1023110520 7:36806480-36806502 ATGTGAACTGCCCCTGGGGAGGG + Intergenic
1023401841 7:39796723-39796745 ACGGCCCCTACCCCTGGGGATGG - Intergenic
1024621030 7:51158018-51158040 AGGGTTGCTGCCCCTGGGGAAGG + Intronic
1025051616 7:55738426-55738448 ATGGCCCCTACCCCTGGGGATGG + Intergenic
1025176959 7:56806976-56806998 ACGGCCCCTACCCCTGGGGATGG + Intergenic
1025234878 7:57227798-57227820 AGAGAAACGGCCCCTGGAGATGG + Intergenic
1026468951 7:70678128-70678150 AGGACAACTACACGTGGGGAAGG - Intronic
1032052354 7:128657115-128657137 ACGGCCCCTACCCCTGGGGATGG - Intergenic
1034468112 7:151241747-151241769 AGGAAACATGCCCCTGGGGAAGG + Intronic
1034681978 7:152935855-152935877 AGGGACACTACCACAGGGCAGGG - Intergenic
1034693569 7:153034228-153034250 ATGGTAATTACCTCTGGGGAGGG + Intergenic
1035752531 8:2006768-2006790 AGGTAAACTACACCTGTTGAAGG + Exonic
1036288169 8:7462781-7462803 AGGGAAAGAGCCCCTGGGCAAGG - Exonic
1036333306 8:7848747-7848769 AGGGAAAGAGCCCCTGGGCAAGG + Exonic
1036984948 8:13519139-13519161 AGTGAGACTACATCTGGGGAGGG - Intergenic
1037949635 8:23010528-23010550 AGGGAAACACCACCTGGGGAGGG - Exonic
1038741591 8:30221476-30221498 AGGGAAACCAACTCTGGGGCTGG + Intergenic
1044640068 8:94370190-94370212 ATGGAATCTACTCCTGGTGAAGG + Intergenic
1044889344 8:96816250-96816272 ATGGAATCTACTCCTGGTGAAGG - Intronic
1045559303 8:103245586-103245608 AGGGAAAATATCCATGGAGAAGG - Intergenic
1049304530 8:141893911-141893933 AGGGAAGCTAACCCTGGGATTGG - Intergenic
1053096074 9:35329204-35329226 AGGTATCCAACCCCTGGGGAAGG - Intronic
1055174009 9:73295788-73295810 AAGGAAACTAGCTCTTGGGAAGG - Intergenic
1057355564 9:94328458-94328480 AGGGACATCACACCTGGGGATGG - Intronic
1057885141 9:98824066-98824088 AGGGAAGCAACCCCTGCTGATGG + Intronic
1060359456 9:122941138-122941160 TCGGAAAATACCCCTGGGGTTGG - Intronic
1061241673 9:129378155-129378177 AGGGAGGTTACCTCTGGGGATGG + Intergenic
1061493324 9:130958067-130958089 AGGGAAACTAAGGCTGGAGAGGG - Intergenic
1186584873 X:10862269-10862291 AGGGAAAATGTCTCTGGGGAGGG + Intergenic
1188162713 X:26822199-26822221 AGGGACTCTTCCCCTTGGGAGGG + Intergenic
1189479276 X:41380679-41380701 TGAGAAACTGCCCTTGGGGAGGG + Intergenic
1191894092 X:65974853-65974875 AGGGACACAAACACTGGGGAAGG - Intergenic
1192129568 X:68536500-68536522 AGGGAAAATACCTTGGGGGAGGG - Exonic
1192129586 X:68536597-68536619 AGGGAAAATACCTTGGGGGAAGG - Exonic
1194747966 X:97650408-97650430 ATGGAAACTGTCCCTGAGGAAGG - Intergenic
1196804491 X:119572523-119572545 AGGGAAATTATCCATGGGGTGGG + Intergenic
1196848411 X:119915122-119915144 AGGGAAACTACCAGTAGAGACGG - Intronic