ID: 1090419468

View in Genome Browser
Species Human (GRCh38)
Location 11:126564281-126564303
Sequence CCTGGGCTGCAGACGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090419468_1090419480 17 Left 1090419468 11:126564281-126564303 CCATCCACCGTCTGCAGCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 288
Right 1090419480 11:126564321-126564343 GCAGGATGAAAGAGAGTGCAGGG 0: 1
1: 1
2: 4
3: 48
4: 450
1090419468_1090419479 16 Left 1090419468 11:126564281-126564303 CCATCCACCGTCTGCAGCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 288
Right 1090419479 11:126564320-126564342 AGCAGGATGAAAGAGAGTGCAGG 0: 1
1: 0
2: 6
3: 47
4: 426
1090419468_1090419474 -1 Left 1090419468 11:126564281-126564303 CCATCCACCGTCTGCAGCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 288
Right 1090419474 11:126564303-126564325 GTCCACCCACCAAGCATAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090419468 Original CRISPR CCTGGGCTGCAGACGGTGGA TGG (reversed) Intronic
900623132 1:3596499-3596521 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623151 1:3596543-3596565 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623170 1:3596587-3596609 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623188 1:3596631-3596653 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
901115508 1:6840716-6840738 CCTGGGATGCAGAAGATAGATGG + Intronic
901261782 1:7876426-7876448 CATGTGCTGCAGAGGGGGGAGGG + Intergenic
902331921 1:15735058-15735080 GGTGGGCTGCAGATGGTGGGCGG - Intergenic
903118156 1:21195270-21195292 CCTGGGATGCAGACAGCTGAAGG - Intergenic
903875736 1:26472171-26472193 GCTGGGTTGCATAAGGTGGAAGG + Intergenic
904294681 1:29511689-29511711 CCTGGGCTGCAGACCGGTGTCGG - Intergenic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
904851975 1:33466447-33466469 ACTGTGCTGCAGAACGTGGAGGG + Intergenic
905002038 1:34680117-34680139 CTAGGGCTGCACAGGGTGGAGGG + Intergenic
905267490 1:36764872-36764894 CCTTGGCTGAAGAGGGTGGGTGG - Intergenic
905419741 1:37832928-37832950 CCTGGGCGGCAGAGGTTGCAGGG + Intronic
905508127 1:38496327-38496349 CCTGGGCTGCGGAGGGAAGAAGG + Intergenic
906098358 1:43239436-43239458 ACAGGGCTGTAGAGGGTGGAGGG + Intronic
906209283 1:44003153-44003175 CAGGGGCTGCAGCAGGTGGAGGG - Intronic
906244244 1:44262061-44262083 GCTGGGCTGCGGTGGGTGGAGGG - Intronic
907196579 1:52692136-52692158 CCAGGGCTGGAGACATTGGAAGG - Intronic
907317735 1:53583271-53583293 CCTGGGCTGCAGAGTTTTGATGG - Intronic
907411328 1:54285787-54285809 CCAGGGCTGCAGTGGGTGCATGG + Intronic
907523583 1:55040503-55040525 CATGGGCAGCGGAGGGTGGAGGG + Intronic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
908830151 1:68170596-68170618 TCTGGGCTGCAGACAGTGCTTGG + Intronic
911259885 1:95673075-95673097 CCAGGGCTGCAGTTGTTGGAAGG - Intergenic
913962979 1:143353765-143353787 TGAGGGCTGCAGACGGTGGGCGG + Intergenic
914057334 1:144179350-144179372 TGAGGGCTGCAGACGGTGGGCGG + Intergenic
914121812 1:144787016-144787038 TGAGGGCTGCAGACGGTGGGCGG - Intergenic
915341154 1:155177463-155177485 CCTGGGCTGCAGGAGGGGGCAGG + Intronic
915917013 1:159946205-159946227 CCTCAGCTGCACACGGTGGGAGG - Intergenic
916016912 1:160757811-160757833 CCTGGGCTGCAGTCTGTGATAGG - Intergenic
916563705 1:165955117-165955139 CCTGGGCTCCAGAAGTGGGAGGG - Intergenic
918708624 1:187700192-187700214 CCAGGGCTGAAGAAAGTGGAGGG + Intergenic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
919883160 1:201914260-201914282 CAGGGGCTGCAGACAGTGGACGG - Intronic
920086655 1:203422398-203422420 CCTGGGGTGAGGACGGAGGAGGG - Intergenic
920184682 1:204152298-204152320 CCTGGGGTGGAGGCGGGGGAGGG + Intergenic
920363217 1:205433640-205433662 GCTGGGCTGCAGACAGCAGAGGG + Intronic
921552327 1:216553184-216553206 CCTGGGCTGCAGAGGGAGAGAGG - Intronic
921581759 1:216903778-216903800 CCAGAGCTGCAGAGGGTGGTTGG - Intronic
922779865 1:228243349-228243371 CAAGGGCTGCAGACGGAGGCTGG + Exonic
922782526 1:228264282-228264304 CGTGGGCTGCACACGGAGGCTGG + Exonic
922783049 1:228268696-228268718 CGTGGGCTGCACACGGAGGCTGG + Exonic
922783548 1:228272112-228272134 CGTGGGCTGCACACGGAGGCTGG + Exonic
922846545 1:228689557-228689579 CCTGGGCTGCAGACAGGTGCTGG + Intergenic
924939742 1:248804735-248804757 CCTGGGCTGCAGAGGCAGGTGGG + Intergenic
1063503822 10:6579287-6579309 ACTAGGCTGGAGAAGGTGGAGGG - Intronic
1063607317 10:7534072-7534094 CCTGTGCTGTAGAGGGTGGGAGG - Intergenic
1064474362 10:15670949-15670971 CCTGGGATGATGACGGTGGGGGG - Intronic
1066023101 10:31320913-31320935 CCTGGGCTGCGGCCGGCGGCAGG - Intronic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1066491518 10:35899328-35899350 CCGTGGCTGCAGATGGAGGATGG + Intergenic
1067802130 10:49366204-49366226 CCGGGGCTGCTGCTGGTGGAAGG + Exonic
1069089308 10:64180102-64180124 CCCTGGTTGCAGACGGTGGGTGG + Intergenic
1069680853 10:70284095-70284117 CCAGGGCTGCAGTGGGAGGAGGG - Intergenic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1070673042 10:78391560-78391582 CCTGGCCTGCAGGAGGTGGTGGG + Intergenic
1070933440 10:80276403-80276425 ACTGGGCTGCAGGTGGTAGACGG + Exonic
1071671268 10:87611553-87611575 CCTAGGCTGCACACAGCGGAGGG - Intergenic
1072039113 10:91590796-91590818 TGTGGGCTGGAGACGGGGGATGG - Intergenic
1072683750 10:97524824-97524846 TCTGGGCTCCAGCCAGTGGAGGG + Intronic
1073063178 10:100744215-100744237 CCGGAGCTGCAGACGGGGGCTGG + Intronic
1073217391 10:101843908-101843930 CCCGGGCTGCAAAGGGTGGGGGG - Intronic
1073497909 10:103911182-103911204 CCTAGGCTACAGATGGTGGCAGG + Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074996337 10:118760369-118760391 CCTGGGCTGGCGGCGGCGGAGGG - Intergenic
1076482417 10:130793187-130793209 CCTGCACTGCAGACTGTGCAGGG - Intergenic
1077008175 11:369009-369031 CCTGGGCTGAAGCCGGTGCTTGG + Intergenic
1077214231 11:1388728-1388750 CCCGTGCTGCAGAAGGTGGTGGG - Intergenic
1077495174 11:2883862-2883884 CCGGGGCAGCGGACGTTGGAAGG - Exonic
1078320965 11:10334206-10334228 CCTGTGCTACAGAGGCTGGAAGG - Intronic
1078535164 11:12167354-12167376 CCTGGGCTACACACAGGGGAGGG - Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1083593866 11:63909892-63909914 CCGGGGCTGCTGAGGCTGGAGGG + Exonic
1083660779 11:64250975-64250997 CCTGGGCTAGGGACGGGGGAGGG + Intergenic
1084091050 11:66879591-66879613 CCTGGGCTGCAATCAGGGGAAGG + Intronic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085820377 11:79786689-79786711 GATGGGCGGCAGAGGGTGGAGGG + Intergenic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1087272778 11:96128366-96128388 CCTGGGCAACAGACAGTGGGAGG + Intronic
1088748350 11:112823094-112823116 CCTGGACTGCGGACTTTGGATGG - Intergenic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1091180385 11:133599234-133599256 CCTGGGCTGCAGACCCTCCAGGG + Intergenic
1091328078 11:134707114-134707136 TCTGGGCTGCAGTAGGTGTAGGG + Intergenic
1092076554 12:5678245-5678267 CATGGGCTGCATACGCTTGATGG + Intronic
1096382798 12:51173068-51173090 CTGGGGCGGCGGACGGTGGAAGG - Intronic
1098223259 12:68292717-68292739 CCTGGGGTGAAGATGGGGGAGGG + Intronic
1100435743 12:94569986-94570008 TCTGGGCTGAAGGCGGTGAATGG + Exonic
1101959422 12:109237457-109237479 CCTGGGCTGCATGCTGGGGATGG + Intronic
1104718747 12:131033139-131033161 CCTGGTCTGCACACGGAGGGTGG - Intronic
1107217186 13:37935082-37935104 GTTGGGGTGCAGGCGGTGGATGG + Intergenic
1107549965 13:41464945-41464967 CCTGGGCAGGAGAGGGTGGGGGG + Intronic
1110870930 13:80451970-80451992 CCTGGGTCCCAGAGGGTGGAGGG - Intergenic
1112196965 13:97235754-97235776 CCAGAGCTGCAGACGCTAGAGGG + Intronic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1113836725 13:113332910-113332932 CCTGGGCTGCACACACTGGAGGG - Intronic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1116784089 14:49268703-49268725 CCTAGGCTGCACACAGTGGAGGG - Intergenic
1119224519 14:72934626-72934648 CCTGGGCTGGAGGTGGGGGAGGG - Intronic
1122637215 14:103135792-103135814 CCTGGGCTGCAGAGGGCAGATGG - Exonic
1122743943 14:103887222-103887244 TCTGGGCTGGACACTGTGGAGGG + Intergenic
1125979112 15:43983778-43983800 CCAGAGGTGGAGACGGTGGATGG - Intronic
1128609878 15:69064995-69065017 CCTGGGCTGCAAGAGGTGGGTGG + Intergenic
1129050013 15:72773201-72773223 CCTGGGCTGCAGACTGGACAAGG + Intronic
1129140333 15:73592173-73592195 CCAGGGCTACAGAGGATGGAAGG - Intronic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1132229509 15:100171221-100171243 TCTGGGCAGCAGACAGTGCAAGG + Intronic
1132810275 16:1793835-1793857 CCTGGGGTGCAGACAGTGCAGGG + Intronic
1133207497 16:4242119-4242141 CCGTGGCAGCAGGCGGTGGAGGG + Intergenic
1133932672 16:10244957-10244979 GCTGGGCTGCAGACTGGTGAAGG + Intergenic
1134005799 16:10818357-10818379 GCTGGGCTGCACCCGGTGGTCGG - Intronic
1134069833 16:11254302-11254324 GCTGGGCTGCAGGTGGTGTACGG - Intronic
1135284048 16:21178229-21178251 CCTGAGCTGCAGGCCCTGGAAGG - Intronic
1136111668 16:28067361-28067383 CATGAGCTGAAGACAGTGGATGG + Intergenic
1139592744 16:67942582-67942604 GCTGGCCTGCAGCGGGTGGAAGG + Exonic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141678308 16:85529318-85529340 TCTGGGTTGCAGCTGGTGGAAGG + Intergenic
1141788888 16:86219581-86219603 CCTGGGCAGCACAGGGTGGGAGG - Intergenic
1141942928 16:87290441-87290463 CCTGGGCTGCTGACGCTTGGAGG + Intronic
1143108507 17:4541152-4541174 GCAGGGCTGGAGACTGTGGAAGG - Intronic
1143645792 17:8229206-8229228 CCTGGGATGAAGACAGTGGTTGG + Exonic
1144347173 17:14359758-14359780 CCTGGGCTGCAAAAGGAGGGAGG - Intergenic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1146056774 17:29585263-29585285 CCTGGGCTGCTGGAGGTGGCTGG - Intronic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1147041868 17:37725773-37725795 CCTGGGCAGCAGACAGCGGGAGG - Intronic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1148397037 17:47317249-47317271 CCAGGGCTGTAGTCGGTTGAAGG + Intronic
1148467357 17:47872920-47872942 CCGGGGCTGGAGAGGGCGGAAGG + Intergenic
1148755498 17:49970986-49971008 CCTGGGCTGCGGAGTGTGGCTGG + Intronic
1148821897 17:50364671-50364693 CCTGGGCTGCAGGCAGGGAAGGG + Intergenic
1148856687 17:50582801-50582823 CCTGGGCTGTAGACGGGGAGAGG + Intronic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1150251048 17:63704604-63704626 CCTGGGCTGTAGCGGGTGGGGGG + Intronic
1150282123 17:63934775-63934797 CCTGGGCTGGAGAAGGAGGCAGG - Intergenic
1151333077 17:73422611-73422633 CCTGGGGAGGAGACGGTGGAGGG + Intronic
1151422056 17:74005164-74005186 GCTGGGCTTCAGAGGGTGGGTGG - Intergenic
1151647357 17:75442314-75442336 CCAGGGCTGCAGTCATTGGAAGG - Intronic
1151669484 17:75564206-75564228 CCTGGGCTGTAGCAGTTGGAAGG + Intronic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152380699 17:79941102-79941124 CCTCGCCTGCAGACAGAGGACGG + Exonic
1152443890 17:80329090-80329112 CCTGGGCTGCAGACGTAGGGTGG + Intronic
1152538067 17:80961711-80961733 CCTGGGCTGCCAACTGCGGAGGG + Intronic
1152657764 17:81527891-81527913 CCTGGGCTGCAGGTTGTGGCTGG + Intergenic
1153205222 18:2692103-2692125 CTTGGGCTGCAGAGGTTGGAAGG - Intronic
1155308094 18:24498668-24498690 CTTGGCCTGCCGAGGGTGGAGGG + Intergenic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1158157631 18:54443434-54443456 CATGGGCTGGACACTGTGGAAGG - Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1162135426 19:8552200-8552222 CCTGGGGTGCAGGTGGGGGAAGG + Intronic
1163044552 19:14630149-14630171 CCTGGGCTGCACATGGTGTCTGG - Exonic
1163419589 19:17206567-17206589 CCTGGGCACCACAGGGTGGATGG + Intronic
1163799695 19:19356959-19356981 CCTGGGCCCCAGAAGCTGGAGGG - Exonic
1165420688 19:35720676-35720698 CTTGGGCAGGAGGCGGTGGAGGG - Exonic
1166855438 19:45780777-45780799 CCAGGGCTGAGGACGGGGGAGGG + Intronic
1166867366 19:45847995-45848017 CCTGGCCTGCTGGCAGTGGATGG - Exonic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167786603 19:51643101-51643123 ACAGGGCTGGAGATGGTGGATGG + Exonic
1167955294 19:53059014-53059036 CGTGGGCTGTGGACCGTGGAAGG + Intergenic
1168121458 19:54254517-54254539 CCTGGGATGCAAATGGTGAAAGG - Intronic
1168644506 19:58051481-58051503 GCTGGGCTAGAGACGGAGGAGGG - Intronic
1202696819 1_KI270712v1_random:132023-132045 TGAGGGCTGCAGACGGTGGGCGG + Intergenic
926038758 2:9655892-9655914 CTGGGGCTGCAGACTGTGGTGGG - Intergenic
927427306 2:22995579-22995601 CCTGGGCTGCAGGAGGTGCCAGG - Intergenic
928023698 2:27723000-27723022 CCTGGGATGCAGAGGTTGAAGGG - Intergenic
928465552 2:31519527-31519549 CCTAGGCTGCACACAGTGTAGGG - Intergenic
931964977 2:67523155-67523177 CCTGGGCAGCACATGGTAGAGGG - Intergenic
932424382 2:71619862-71619884 CTTGGGCTGCAGCCTGAGGAGGG - Intronic
932607617 2:73175629-73175651 AATGGGCTGCAGCCGGCGGAAGG + Intergenic
933174128 2:79157601-79157623 CCGGGGCTTGAGATGGTGGAGGG + Exonic
934046948 2:88180137-88180159 TCTGGGCTGCAGAGGGCGGCTGG - Intronic
934277974 2:91589037-91589059 TGAGGGCTGCAGACGGTGGGCGG + Intergenic
935334603 2:102004887-102004909 CCTTGGCTGGAGATGGTGGTGGG + Intronic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
937122267 2:119448998-119449020 CCTGGGCTGCAGAAGCTCTAAGG + Intronic
937329590 2:121018415-121018437 CCTGGGCAGAAGACGCTGAAAGG - Intergenic
938763608 2:134445850-134445872 CCTGGGCTGCAGAGGCTGTCTGG + Intronic
941123704 2:161561488-161561510 CCTAGGCTGCACACAGTGCAGGG - Intronic
941917880 2:170823849-170823871 CCTGGCCTGCTGAGGGTGGGGGG + Intronic
942765814 2:179455335-179455357 CATGGGCTGGAGCCGGTGGGAGG + Intronic
944474206 2:200087213-200087235 TCTGGGCTTTAGACTGTGGACGG + Intergenic
946509211 2:220335799-220335821 ACTGGGCTGCTGCCGGGGGATGG + Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947561586 2:231158646-231158668 CCTGGGATGGAGACTGGGGAGGG - Intronic
948046705 2:234951506-234951528 CCTTGGCTGAGGACAGTGGAGGG - Intergenic
948113592 2:235477021-235477043 CCTGGGCTGCAGGCAGGAGAAGG - Intergenic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948368292 2:237472769-237472791 GCAGGGCTGCACACCGTGGAAGG + Intergenic
948667524 2:239545828-239545850 CCTGGGCTCCGGACGGCAGAGGG - Intergenic
948805502 2:240452144-240452166 CCTGGGCTGCAGGGAGGGGAGGG + Intronic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
948963502 2:241357744-241357766 CCTGGACTGCAGACGTTTGCTGG + Intronic
949036154 2:241816591-241816613 CCGAGGCTGCAGACGGCTGAAGG - Exonic
949048794 2:241885877-241885899 GCAGGGCTGCAGGCTGTGGACGG + Intergenic
1169149441 20:3277687-3277709 CCTGGGGTGGATACTGTGGATGG + Intronic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1171493349 20:25537696-25537718 CCTGGGCTGCTGCAGGTGGAGGG + Intronic
1172102149 20:32491414-32491436 GCTGGGCGGCAGTCTGTGGAGGG - Intronic
1172245821 20:33444114-33444136 GCTGGGCTGCATATGGCGGAGGG + Intergenic
1172414973 20:34757751-34757773 CCTGGGCTGGAGGAGGTTGAAGG + Exonic
1173923809 20:46765640-46765662 CCTTGGCAGCAGGCGGTGGGAGG + Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176261701 20:64185306-64185328 CCTGTGCTGGAGACGGAGGAGGG + Intronic
1176267318 20:64216980-64217002 CCTGGGCTGCAGATTGGGGTTGG + Intronic
1182557683 22:31137948-31137970 CCTGGGCTGCAGGCGAGCGAGGG + Exonic
1183230471 22:36578832-36578854 CCTGTGCTGGAGGGGGTGGATGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183716147 22:39534844-39534866 GCTGGGCTGCGGACGCTGCAGGG - Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184654723 22:45935349-45935371 GCTGGGCTGCAGGCAGTGGTGGG - Intronic
1184712826 22:46263137-46263159 GCTGGGCCGCAGACTGAGGAGGG + Exonic
1185080299 22:48706025-48706047 CCGGGGCTGCAGACGGGAGGTGG + Intronic
1185173178 22:49305170-49305192 TCTGGGCTGCAAACGGTGTCAGG - Intergenic
1185196184 22:49470825-49470847 CCTGGGCTGCTGTGGCTGGATGG + Intronic
950135465 3:10577653-10577675 CCTGGGCTGCACAATGTAGATGG + Intronic
950408097 3:12816990-12817012 CCTGCACGGCAGACGGTGGGAGG - Exonic
950569896 3:13793382-13793404 CCAGGGCGGCAGACGGTCGCTGG - Intergenic
950810866 3:15648604-15648626 CCAAGGCTGCAGCCGGTTGAAGG + Intergenic
952096540 3:29960835-29960857 CCTAGGCTGCACACAGTGAAGGG + Intronic
952881087 3:37986778-37986800 CCTGGGCTGCAGGATGTGGAAGG - Intergenic
954577145 3:51682829-51682851 CCAGAGCTGCAGACAGTTGAGGG + Intronic
961482478 3:127193030-127193052 CCTGGGCTCCTGGCGGTGGTCGG - Intergenic
961501394 3:127338339-127338361 CCTGGGCGGCAGACGCTCCATGG + Intergenic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
964721862 3:159775389-159775411 CCAGGCCTGCAGACAGCGGATGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967254603 3:187576879-187576901 CTTGGGATGCAGACGCTGGTGGG + Intergenic
967449998 3:189613235-189613257 CCTAGGCTGCACACAGTGCAGGG - Intergenic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
968679359 4:1905952-1905974 CCCGGGCTGCAGAGGCTTGAAGG - Intronic
968894087 4:3388650-3388672 CAGGGGCTGCAGGCGCTGGAGGG - Intronic
969567301 4:7986021-7986043 CCTTGGCTGCCCGCGGTGGACGG + Intronic
975204082 4:71624240-71624262 CCTGGGCTGCACACAGTAGGGGG + Intergenic
977026108 4:91821147-91821169 CCTAGGCTGCACACAGTGCAGGG + Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
985604429 5:850769-850791 GCTGGGCTGGAGTCGGTGCAGGG + Exonic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
996118410 5:119644321-119644343 CCTGGGCTGAGGATGGAGGAAGG - Intergenic
997621241 5:135297575-135297597 CCTGGGGTGCAGGCGCTGGTGGG + Intronic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
998481587 5:142467551-142467573 CCTGGGCTGCAGACCCTGTTAGG + Intergenic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999738079 5:154527675-154527697 CCTGGGAGGCAGTCGGTGAAGGG - Intergenic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1001599037 5:172917008-172917030 GCTGGGCTGGAGAGGGTGGCAGG + Intronic
1001741743 5:174058578-174058600 CCTGGAGTGGAGACGGAGGAGGG + Intronic
1001920696 5:175597077-175597099 CCTGGCCTGCCGGCAGTGGAGGG + Intergenic
1002098432 5:176845529-176845551 CCTGGGCTGCAGAGGGTCTGTGG - Intronic
1002159285 5:177305536-177305558 CCAGAGCTGCAGCTGGTGGAAGG + Intronic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1003868479 6:10383618-10383640 CCTAGGCTGCAGAGGGCGGCGGG - Intergenic
1005307774 6:24530490-24530512 CCAAGGCTGCCGACGGTGCAAGG - Intronic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1013601574 6:111710112-111710134 GCTGGGCGGGAGAGGGTGGAGGG - Intronic
1017719674 6:157235967-157235989 CCTGGGGTGCACACGGAGGAGGG + Intergenic
1017775025 6:157673765-157673787 CCGGGGCTGCAGAGGGCGGCTGG + Exonic
1017981320 6:159402796-159402818 CCTGGGCTGCAGAGGAAGGATGG + Intergenic
1018803961 6:167244349-167244371 GCAGGGCTGCTGACGGAGGAGGG + Intergenic
1018940956 6:168308626-168308648 GCTGGAGTACAGACGGTGGAGGG - Exonic
1019182926 6:170203125-170203147 CCTGGTCTGCACAAGCTGGAAGG + Intergenic
1019531083 7:1503872-1503894 CCCGGGCTGCAGAGCGAGGAGGG + Intronic
1019587750 7:1814233-1814255 CCGGGGCTGCTGGCGGTGAAAGG + Intergenic
1020469211 7:8516850-8516872 CCCAGGGTGCAGAAGGTGGATGG + Intronic
1026104782 7:67412117-67412139 TGTGGGCTGCAGATGGTGGGTGG + Intergenic
1026470117 7:70687925-70687947 CCTGGGCTGAACAGTGTGGAAGG + Intronic
1026818190 7:73528790-73528812 CCTGGGCGGCAGAGGTTGCAAGG - Intergenic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1029617166 7:101666214-101666236 CCCGGGATGCAGACTCTGGATGG - Intergenic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1032068886 7:128791827-128791849 CCGGGGCTGCAGGAGGTGTAGGG - Intronic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034815888 7:154171607-154171629 CCTGGGCTGCAGGTGGGAGATGG - Intronic
1034949092 7:155284960-155284982 CCAGGGCTGCAGACCAAGGAAGG + Intergenic
1035110296 7:156476024-156476046 CCTGGGCTGCAGGCTCTTGAGGG + Intergenic
1035126019 7:156607997-156608019 ACCGGGCTGCAGACGGGAGACGG + Intergenic
1035653190 8:1284280-1284302 CCTGTGCTGAAGATGATGGAAGG + Intergenic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037668808 8:20996979-20997001 CTGGGGCTGGAGACGGGGGATGG - Intergenic
1037882635 8:22580362-22580384 CCTGGGCTGAAGACTAAGGAAGG + Intronic
1039965101 8:42278278-42278300 CCTGGGTGGCTGAGGGTGGACGG + Intronic
1040631987 8:49224771-49224793 CCTGGGCGACAGACGGTGCTGGG - Intergenic
1046932405 8:119854992-119855014 CTGGGGCTGCACAGGGTGGAGGG + Intronic
1048036766 8:130684569-130684591 CCTTGGCTCAAAACGGTGGAGGG + Intergenic
1049351531 8:142167263-142167285 CCTGTGCTGCAGTCGGTGTGGGG + Intergenic
1049376324 8:142291049-142291071 CCTGGGCAGGAGAGGTTGGAGGG - Intronic
1051170018 9:14312984-14313006 ACTGCGCTGCAGGCGGTGGGCGG - Intronic
1053919279 9:42972429-42972451 CCTGGGCTGTTGCCGGCGGAGGG + Intergenic
1056089275 9:83188697-83188719 GCTGGGCTGCGGTAGGTGGAAGG - Intergenic
1056132779 9:83602114-83602136 GTTGCGCTGCAGACGCTGGATGG - Intergenic
1056365148 9:85897418-85897440 GCTGGGCTGCAGTCTGAGGAGGG - Intergenic
1058442400 9:105021649-105021671 CCAGGGCTGAAGGCGGAGGATGG + Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1061334465 9:129922530-129922552 CCTGGGCTTCATAGGGTGGCTGG + Intronic
1062008108 9:134251694-134251716 CCTGGGTTGCAGACACGGGAAGG - Intergenic
1203794595 EBV:169766-169788 CGGGGGCTGCGGGCGGTGGATGG + Intergenic
1203794796 EBV:170304-170326 CGGGGGCTGCGGGCGGTGGATGG + Intergenic
1203794987 EBV:170827-170849 CGGGGGCTGCGGGCGGTGGATGG + Intergenic
1203795188 EBV:171365-171387 CGGGGGCTGCGGGCGGTGGATGG + Intergenic
1187271993 X:17788087-17788109 CCTGGGGTGCAGCCGGGGTAGGG + Intergenic
1187622950 X:21078898-21078920 GCTGGGCTGGAGATGGTGGTGGG + Intergenic
1191095046 X:56665085-56665107 CCTGGGCTGCACACAGTGGGAGG - Intergenic
1195247106 X:103004730-103004752 TCTGGGCTGCTGAGGGTGGCAGG + Intergenic
1197335161 X:125203687-125203709 CCGAGGCTGCAGGCGGCGGATGG - Intergenic
1199722730 X:150553849-150553871 CCTGGGCTACAGACCATGAAGGG - Intergenic