ID: 1090420562

View in Genome Browser
Species Human (GRCh38)
Location 11:126572464-126572486
Sequence CCCATTTGGTTCCAGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090420552_1090420562 26 Left 1090420552 11:126572415-126572437 CCTAAAGTCACACAACTGGGAAA 0: 1
1: 5
2: 49
3: 383
4: 1724
Right 1090420562 11:126572464-126572486 CCCATTTGGTTCCAGAGCCCAGG 0: 1
1: 0
2: 2
3: 18
4: 195
1090420557_1090420562 -5 Left 1090420557 11:126572446-126572468 CCAGGATTAGAACCCAGGCCCAT 0: 1
1: 0
2: 14
3: 100
4: 527
Right 1090420562 11:126572464-126572486 CCCATTTGGTTCCAGAGCCCAGG 0: 1
1: 0
2: 2
3: 18
4: 195
1090420556_1090420562 -4 Left 1090420556 11:126572445-126572467 CCCAGGATTAGAACCCAGGCCCA 0: 1
1: 0
2: 2
3: 36
4: 246
Right 1090420562 11:126572464-126572486 CCCATTTGGTTCCAGAGCCCAGG 0: 1
1: 0
2: 2
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090420562 Original CRISPR CCCATTTGGTTCCAGAGCCC AGG Intronic
900599072 1:3495476-3495498 CCACTTTGGTCCCTGAGCCCTGG + Intronic
902443484 1:16446667-16446689 CACATTTAGTTCCAGCTCCCTGG - Intronic
902556907 1:17252274-17252296 CCCATCAAGTTCCACAGCCCAGG + Intronic
902695044 1:18134600-18134622 CCCATGTGCATCCACAGCCCAGG - Intronic
903143651 1:21355815-21355837 CCCACTTGGCTCCACAGCCCTGG - Intergenic
903646222 1:24897797-24897819 GCCATTTAGTTCCACAGCCTGGG - Intergenic
904035163 1:27555135-27555157 CCCATTGGCTTCCAAAGCCTGGG + Intronic
904074849 1:27832291-27832313 CTGATTTGGTTTCAGAGCTCAGG + Intronic
904478307 1:30778298-30778320 CCATTCTGGTTCCAGAGCACAGG - Intergenic
904982938 1:34522052-34522074 CCCATCAGAATCCAGAGCCCAGG - Intergenic
907220550 1:52904432-52904454 CCCATTTGGTTCCAGCCCTTTGG + Intronic
907430830 1:54410291-54410313 ACCATCTGGTGCCAGAACCCAGG - Intronic
907440752 1:54476673-54476695 TCCATTTGGTTTCACTGCCCTGG + Intergenic
908518622 1:64918587-64918609 CCCAGTTTATTCCAGGGCCCTGG - Intronic
912205617 1:107505350-107505372 CCCAGTTTGTTCCAGGGCTCTGG - Intergenic
913409532 1:118535881-118535903 CCCCTTTGGTGCCTGACCCCTGG + Intergenic
916837072 1:168556699-168556721 GCAGTTTGGTTCCAGAGCCAGGG + Intergenic
917353255 1:174100416-174100438 ACTATTTGGTTCAAGAGGCCTGG + Intergenic
917941468 1:179926867-179926889 TCCATTTGCATCCAGAGCACTGG + Intergenic
922934158 1:229410941-229410963 ACCCTTTGGTGCCAAAGCCCAGG + Intergenic
924322561 1:242864561-242864583 CCCATTTGTTTCCAGACCCATGG - Intergenic
1063084199 10:2800339-2800361 CCCTTTTGGTTCCTGTGACCTGG - Intergenic
1065785878 10:29214326-29214348 CCTATTTCTTTCCAGTGCCCAGG + Intergenic
1067445605 10:46341772-46341794 CCCAGTTCCTTCCAGAGCCATGG + Intergenic
1067502821 10:46821040-46821062 CCCAGTTCCTTCCAGAGCCATGG + Intergenic
1067591769 10:47518971-47518993 CCCAGTTCCTTCCAGAGCCATGG - Intronic
1067638884 10:48027045-48027067 CCCAGTTCCTTCCAGAGCCATGG - Intergenic
1071517280 10:86306522-86306544 TCCCTTTGGTTTCTGAGCCCAGG - Intronic
1071573352 10:86709890-86709912 CCCGCTTGGTTCCAGGCCCCAGG + Exonic
1075062289 10:119265549-119265571 CCCATTTGGTTCCTCAGTGCAGG - Intronic
1076011014 10:126988332-126988354 CCGACTTCCTTCCAGAGCCCTGG - Intronic
1076400825 10:130184002-130184024 CCCATCTGGTTTCAGAGTCTTGG + Intronic
1076607669 10:131700143-131700165 CCCACCTGGTTTCACAGCCCTGG + Intergenic
1076630422 10:131848952-131848974 CCCATCTGGTGCCAGAGACTTGG + Intergenic
1076868105 10:133179247-133179269 ACCATTTGTCTGCAGAGCCCTGG + Intronic
1076997425 11:305078-305100 CCCCTTGGCTTCCACAGCCCCGG - Intergenic
1083594186 11:63911189-63911211 CCCTTTTGGTGCAAGGGCCCTGG - Intergenic
1083811862 11:65110863-65110885 CCCAGTTGGTCACAGAGTCCTGG - Intronic
1088558626 11:111089570-111089592 CACATTTGGTTCAAGGGACCTGG + Intergenic
1088820715 11:113454464-113454486 CTCATCTGATTCCAAAGCCCTGG + Intronic
1090420562 11:126572464-126572486 CCCATTTGGTTCCAGAGCCCAGG + Intronic
1091133510 11:133166741-133166763 CCAATTTGGTTACTAAGCCCAGG + Intronic
1091195208 11:133724934-133724956 CCCATTTTGTTCCATAGCTCAGG + Intergenic
1091583041 12:1800267-1800289 CCCACTTGCTACCAGACCCCGGG - Intronic
1091820737 12:3473590-3473612 CCCACTGGGATCTAGAGCCCAGG + Intronic
1092351482 12:7759527-7759549 CGCAGTTGGTTCCATAGCTCAGG + Intergenic
1092458412 12:8665361-8665383 CCCATTTGTTCTCAGAGCCCAGG + Intergenic
1092983344 12:13819972-13819994 CCCACTTGGTTCCTGACCCGAGG + Intronic
1093220837 12:16418634-16418656 GCTATCTGCTTCCAGAGCCCAGG - Intronic
1102036416 12:109772904-109772926 CCAATTTGGCTCCAGAACCCAGG + Intergenic
1102182311 12:110921817-110921839 CCCCTTTGTCTCCAGAGTCCAGG + Intergenic
1102456449 12:113073728-113073750 CCTATCTGGTTGCAGATCCCTGG + Intronic
1102896670 12:116603708-116603730 CCCATTTACCTCCAGCGCCCTGG - Intergenic
1103462393 12:121115381-121115403 TCCATATGACTCCAGAGCCCGGG + Intergenic
1103536388 12:121636547-121636569 TCCACTTGGCTCCACAGCCCGGG - Intronic
1103541404 12:121669063-121669085 CCCCCTAGGTCCCAGAGCCCCGG + Intronic
1104272437 12:127294151-127294173 CACACTTGTGTCCAGAGCCCTGG + Intergenic
1104386201 12:128353710-128353732 CACCCTTGGTTCCAGAGCCAAGG - Intronic
1104849990 12:131868253-131868275 CCCATTCAGGTCCAGGGCCCGGG + Intergenic
1105272814 13:18893980-18894002 ACCTTTGGGTTCCAGAGCCTGGG + Intergenic
1107014432 13:35696991-35697013 CACATTTGCAGCCAGAGCCCAGG + Intergenic
1109651188 13:65329383-65329405 CCTACTTGGTTCCACAGACCAGG - Intergenic
1109782154 13:67126130-67126152 ACCATTTGGTTCCAGAGCCTGGG + Intronic
1118451259 14:65904625-65904647 CAGATTTTGTTCCAGAGCCAGGG - Intergenic
1118731425 14:68669709-68669731 CCCACTTGGTTACAAATCCCAGG - Intronic
1119115880 14:72021096-72021118 GCCATTTTCTCCCAGAGCCCAGG + Intronic
1119779231 14:77267032-77267054 TCTATCTGGCTCCAGAGCCCAGG - Intronic
1119898325 14:78239238-78239260 GCAATCTGGTTCCAGAGCCTGGG + Intergenic
1122268391 14:100557247-100557269 CGCATTGGCCTCCAGAGCCCAGG + Intronic
1124377160 15:29135624-29135646 CCCATTTCGTCCCATAACCCTGG + Intronic
1128795725 15:70465154-70465176 CCCCTTAGGTTCCAGACACCTGG - Intergenic
1129690409 15:77710118-77710140 CCCCTGGGGTTCCAGAGGCCTGG - Intronic
1130928374 15:88401964-88401986 ACATCTTGGTTCCAGAGCCCTGG - Intergenic
1131292783 15:91121663-91121685 CCCATGTGGTTCAAGAGAGCTGG - Intronic
1131530560 15:93187735-93187757 TCCATCTGATTCCAGAGCCCAGG - Intergenic
1132135749 15:99337000-99337022 GCCATCTGGTTCTAGAGCCCTGG + Intronic
1132701537 16:1224297-1224319 CCCAGCTGGTTCCAGGGCCACGG + Intronic
1133382939 16:5346147-5346169 CCCCTCTGCCTCCAGAGCCCAGG - Intergenic
1135557428 16:23448740-23448762 GACAGTTGGCTCCAGAGCCCAGG - Intronic
1141714990 16:85721774-85721796 CCCATGTGGTCCCAGTGCCTGGG + Intronic
1142614365 17:1126103-1126125 CCACTTGGGCTCCAGAGCCCAGG + Intronic
1143364047 17:6394172-6394194 CCCATTTGACATCAGAGCCCAGG + Intronic
1146574439 17:33979047-33979069 CCCAGCTGGTTCCAGGGCCTTGG + Intronic
1147218165 17:38912843-38912865 CCCATTTGTGTCCAGAGCCTCGG - Intronic
1147647172 17:42040725-42040747 CCCACTTGGTCCCTGAGCTCCGG - Intronic
1150815330 17:68388180-68388202 CCCATGTGCTGCCAAAGCCCTGG - Intronic
1152194929 17:78912174-78912196 CCCACTTGACTCCAAAGCCCAGG + Intronic
1152559482 17:81070804-81070826 CAGATTTGGTGCCAGAGGCCCGG + Intronic
1152651033 17:81493054-81493076 CGCATTTGTGGCCAGAGCCCTGG + Intergenic
1154464594 18:14631556-14631578 ACCTTTGGGTTCCAGAGCCTGGG + Intergenic
1155318792 18:24597796-24597818 CCCAGTTGGTTGCAGAGCCAGGG - Intergenic
1155356449 18:24958248-24958270 CCCATCTGATTCCAGAGCCAGGG - Intergenic
1156068425 18:33174426-33174448 TCCATTTGATTCCAGAGCATGGG + Intronic
1158248903 18:55464558-55464580 TCCTTTTTGTTCCATAGCCCAGG + Intronic
1160565885 18:79786357-79786379 CCCATGGGGTTCCACAGCACGGG + Intergenic
1162053480 19:8049508-8049530 CCCAGTTGGTTGCAGTGGCCAGG - Intronic
1164579742 19:29427455-29427477 TCTGTCTGGTTCCAGAGCCCAGG + Intergenic
1165439996 19:35820036-35820058 TACATTGGGTTCCAGAGCTCAGG - Intergenic
1165895225 19:39137254-39137276 CCCAGATGGCTCCAGAGGCCAGG - Intronic
1166681119 19:44767758-44767780 GTCATTTGGTGGCAGAGCCCTGG - Intergenic
1167346322 19:48947650-48947672 ACCATCTGGCTCCAGTGCCCAGG - Intergenic
1167614214 19:50523030-50523052 GCCCTCTGGTTCCAGAGTCCTGG + Intronic
1168378770 19:55902483-55902505 CCCAACTGGCTCCAGAGCCTTGG - Intronic
925811611 2:7706695-7706717 CCAATTTGATTCCAAAGCTCAGG - Intergenic
927417335 2:22892740-22892762 CCCACTGTGTGCCAGAGCCCAGG - Intergenic
927472713 2:23386955-23386977 GCCGCTTGGTTCCACAGCCCAGG - Intronic
927708978 2:25313693-25313715 GGCATTTGGTTCCAGGACCCAGG - Intronic
928256592 2:29728302-29728324 CCCTTTTGGCTCCAGAACCTTGG - Intronic
931108382 2:59083101-59083123 ACCACCTGGTTCCAAAGCCCAGG + Intergenic
932337062 2:70937562-70937584 CCCCCTTGGGTCCAGAGCCCAGG + Intronic
938236166 2:129708738-129708760 GCCATTTGCTCCCATAGCCCAGG - Intergenic
938710527 2:133972804-133972826 CCCACTTGATGTCAGAGCCCAGG - Intergenic
939126489 2:138183883-138183905 CTCAGTTCTTTCCAGAGCCCTGG + Intergenic
942901124 2:181120338-181120360 CACATTTGGTTTCAGACCTCTGG + Intergenic
943976454 2:194484657-194484679 CCCATTTGGTTTCAAGGCCTGGG - Intergenic
944846360 2:203672251-203672273 CTCAGTTTGTTCCAGGGCCCTGG + Intergenic
945398508 2:209351215-209351237 CCCATTTTAAACCAGAGCCCTGG - Intergenic
946339580 2:219059047-219059069 CCCTCTCGGGTCCAGAGCCCGGG + Intronic
946467988 2:219929520-219929542 TCCAGGTGATTCCAGAGCCCAGG - Intergenic
947575474 2:231270229-231270251 TCCATTTTGTTCTAGAACCCCGG + Intronic
1170734412 20:19001771-19001793 TCCATTTGATTTCAGAGCGCAGG - Intergenic
1172079895 20:32331838-32331860 CGCATTTGGATCCAGGCCCCAGG + Exonic
1172355083 20:34274368-34274390 CCCATGTCATTCCAGAGCCTAGG + Intergenic
1172449038 20:35008877-35008899 TCCAACTGGGTCCAGAGCCCCGG + Intronic
1172600723 20:36180881-36180903 GCCATCTGGCCCCAGAGCCCAGG - Intronic
1173227099 20:41168396-41168418 CCCATATGCTTCCAGGTCCCGGG + Intronic
1173454417 20:43191093-43191115 CCAACTTGGGTCCAGAGCCTGGG - Intergenic
1173462931 20:43258521-43258543 CCAAGTGGATTCCAGAGCCCAGG - Intergenic
1173717732 20:45224339-45224361 CCCATGTGGTCCCAGATCCTTGG + Exonic
1174900777 20:54497227-54497249 CCCATTATGTTCCAGGGCTCAGG - Intronic
1175248312 20:57594364-57594386 TCAATTCGGTTCCAGACCCCTGG - Intergenic
1176809945 21:13526828-13526850 ACCTTTGGGTTCCAGAGCCTGGG - Intergenic
1179966653 21:44810703-44810725 CCCATGTGGATGCACAGCCCTGG + Intronic
1181079031 22:20401580-20401602 ACCATTTGGTCCCAGTGGCCAGG - Intronic
1181162059 22:20965169-20965191 CCCAAGCGGTTCCCGAGCCCAGG + Exonic
1181235246 22:21444602-21444624 TGCATTTGGTTTCACAGCCCGGG - Intronic
1181633026 22:24161372-24161394 CCCACTTGATTCCTGGGCCCTGG - Intronic
1182504399 22:30771531-30771553 TCCATGTGGTTCCAGAGCCTTGG + Intronic
1183551481 22:38489431-38489453 CCCATTTGGTTGCCAAGCGCCGG + Intronic
1183584014 22:38741665-38741687 TCTGTTTGCTTCCAGAGCCCTGG + Intronic
949621020 3:5811659-5811681 CCCACTTGGTACTAGATCCCTGG + Intergenic
953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG + Intronic
954359898 3:50116045-50116067 AGCATTTAGTTCCAGATCCCAGG + Intronic
955671156 3:61404623-61404645 CTCATGTGGTTCCAGAAGCCAGG - Intergenic
957982861 3:87533391-87533413 CCAGTCTGGTGCCAGAGCCCAGG + Intergenic
959310989 3:104736637-104736659 CCCCTTTCTTTCCAGAGCCTTGG - Intergenic
962377170 3:134867866-134867888 AACTGTTGGTTCCAGAGCCCAGG - Intronic
962810424 3:138954966-138954988 CCCATTAGGTTGCTGAGCCCGGG - Intergenic
964164769 3:153689724-153689746 TCCTTTTGGTTCCAAAGCTCTGG + Intergenic
968509662 4:989931-989953 CCCCTCAGGTCCCAGAGCCCAGG - Exonic
969598186 4:8160496-8160518 CCAGACTGGTTCCAGAGCCCAGG + Intergenic
972573780 4:40333551-40333573 CCCATTGGGGTCCAGTGTCCTGG - Intergenic
974401423 4:61412699-61412721 TCCATTTGGCTCTAGAGCCCAGG + Intronic
975696681 4:77020970-77020992 GCCATCTGGGTCCTGAGCCCAGG + Intronic
977960546 4:103079938-103079960 GCCATTTAGTTCCAGATCACAGG - Intronic
981392326 4:144205740-144205762 CCCATTTGCTACCACAGCCCTGG + Intergenic
986128438 5:4905125-4905147 CCCATGGGGTTCCAGGGACCTGG + Intergenic
988400101 5:30751366-30751388 CCCTTTTCCTTCCAGACCCCTGG + Intergenic
990475830 5:56160869-56160891 GCCATCTGGCTGCAGAGCCCGGG - Intronic
991088602 5:62671644-62671666 CACAATTGGCTCCAGGGCCCTGG - Intergenic
992368124 5:76114142-76114164 CCCATTTAGCTACAGAGCACCGG + Intronic
995531880 5:113099672-113099694 GCAATCTGGCTCCAGAGCCCTGG + Intronic
996553049 5:124749528-124749550 CCCTTTTGTTTCCAGGGCTCTGG + Intergenic
1001021429 5:168186164-168186186 TCCATCTGATTCCAGAGGCCAGG + Intronic
1001543474 5:172555346-172555368 CCCATCTCATTCCAGAGCCTGGG - Intergenic
1001914110 5:175545211-175545233 CTCTTTTGATTCCAAAGCCCAGG + Intergenic
1002821824 6:732762-732784 AGCATCTGGTTCCAGAGCCTGGG + Intergenic
1004274812 6:14226344-14226366 GTCATTTGATTCCAGAGCCTAGG + Intergenic
1006406043 6:33845613-33845635 CACATTTGGCCCCACAGCCCTGG - Intergenic
1007391163 6:41550106-41550128 CAGATTTGGTTCCAGAACTCTGG + Intronic
1008072725 6:47113825-47113847 CAAATTTGGGCCCAGAGCCCTGG + Intergenic
1008897090 6:56568735-56568757 CCTATTTGTTCCCACAGCCCAGG + Intronic
1017416968 6:154231066-154231088 CTCATCTGTTTCCAGTGCCCTGG - Intronic
1017822217 6:158057651-158057673 CTCAACTGGTTCCAAAGCCCAGG - Intronic
1018469710 6:164084507-164084529 CCCATCTAGTTCCTGGGCCCTGG - Intergenic
1018549151 6:164974750-164974772 CCCATTTAGTTCAAGTGCCTAGG - Intergenic
1019229754 6:170549922-170549944 CTCATGTAATTCCAGAGCCCAGG - Intronic
1019487423 7:1295819-1295841 CCTAGTTGGTGCCACAGCCCAGG - Intergenic
1020656824 7:10938109-10938131 CCCAGTTTGTTCCAGGGCTCTGG + Exonic
1021929669 7:25567321-25567343 ACCATTTGGCACCAGAGACCTGG - Intergenic
1021936821 7:25639279-25639301 ACCATCTGGCTCCAGAGTCCAGG - Intergenic
1023253429 7:38290025-38290047 CCCATTTGGTTCATGAGCATTGG - Intergenic
1023377005 7:39566448-39566470 CCCCTTTGTCTCCAGGGCCCTGG - Exonic
1027718759 7:81710878-81710900 TCCATTTGCTTCCTGAGCCTGGG + Intronic
1028513669 7:91652483-91652505 CCCCCTTGGTTCCTGATCCCGGG + Intergenic
1032620855 7:133530100-133530122 GCCATCTGATTCCAGAGCTCAGG + Intronic
1033890386 7:146006165-146006187 CCCATTTTGCTTCAGAGCCTTGG + Intergenic
1035629020 8:1094158-1094180 CCCATTTGGGAACAGAGCCCTGG + Intergenic
1035690127 8:1554563-1554585 CCCATCTGCCTCCTGAGCCCGGG + Intronic
1039573540 8:38605608-38605630 ACCATGTGGTGCCTGAGCCCTGG + Intergenic
1040948752 8:52914277-52914299 GCCATTTGGTGCCTGAGCCCTGG - Intergenic
1043052401 8:75400336-75400358 CTGATATGGTTCCAGAGCCGAGG - Intergenic
1047853743 8:128887421-128887443 ACCATTTGGTTCCAGACCCCAGG + Intergenic
1047992157 8:130297530-130297552 CCAATCTGATTCCACAGCCCAGG + Intronic
1048987194 8:139740982-139741004 CCCATTTGATTCCACAGCTTGGG + Intronic
1055403861 9:75953505-75953527 CACATTTGGTACCAGATTCCTGG - Intronic
1055408697 9:76003751-76003773 CCCTTTTGATTCCAGAACACAGG + Intronic
1055669077 9:78582521-78582543 GCCATTTGTTTCCCAAGCCCTGG + Intergenic
1058154638 9:101501719-101501741 CCCAGTTTGTTCCAGGGCTCTGG + Intronic
1058260368 9:102821425-102821447 CCCAATTGGCTCCAGTGACCTGG + Intergenic
1058737253 9:107905128-107905150 CCCCTTAATTTCCAGAGCCCTGG + Intergenic
1059257571 9:112945306-112945328 CCCTTTTCCTGCCAGAGCCCAGG - Intergenic
1059284977 9:113164688-113164710 GCCATCTGATTCCAGAGCCTGGG - Intronic
1060393710 9:123300764-123300786 CCCACATGGTCCCTGAGCCCCGG - Intergenic
1061801318 9:133114807-133114829 CCGACTGGGTCCCAGAGCCCAGG - Intronic
1062278734 9:135742636-135742658 CCCGCCTGGTCCCAGAGCCCAGG + Intronic
1062423049 9:136493221-136493243 CGCATTTGCATCCACAGCCCGGG - Intergenic
1188003785 X:25004183-25004205 CGCATTTGCTTCCCGGGCCCTGG + Exonic
1188041464 X:25374655-25374677 CCCTTTAGATTCCAGAACCCTGG - Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1190828344 X:54038658-54038680 ATTATTTGATTCCAGAGCCCAGG - Intronic
1192547712 X:72027581-72027603 GCCAGGAGGTTCCAGAGCCCAGG + Intergenic
1192831244 X:74752908-74752930 CCCATTTGGATCTAGAGTCAAGG - Intronic
1192948349 X:75989596-75989618 CCCATTTTGTTCCAATGCCCTGG + Intergenic
1197183143 X:123558498-123558520 CCCAGTTTGTTCCAGGGCTCTGG - Intergenic
1198404941 X:136303109-136303131 CCCATATGGTTTCAGATTCCTGG - Intronic