ID: 1090421353

View in Genome Browser
Species Human (GRCh38)
Location 11:126577444-126577466
Sequence GCATCCTAGAAACTAACCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090421351_1090421353 -8 Left 1090421351 11:126577429-126577451 CCTAGCTGGCAACCAGCATCCTA 0: 1
1: 0
2: 3
3: 14
4: 163
Right 1090421353 11:126577444-126577466 GCATCCTAGAAACTAACCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090421353 Original CRISPR GCATCCTAGAAACTAACCGC TGG Intronic
1065501243 10:26384827-26384849 GCTTCCTAGCAACTAACCATGGG + Intergenic
1067814287 10:49460618-49460640 CCCTCCTAGAAAGTAACTGCTGG + Intronic
1074530891 10:114297908-114297930 GTATCCTAGAAGCTCACTGCTGG + Intronic
1074670265 10:115782286-115782308 GCTCCTTAGAAACTAACAGCAGG + Intronic
1078940637 11:16001239-16001261 CTATCCTAGAAACTGACCTCTGG - Intronic
1090421353 11:126577444-126577466 GCATCCTAGAAACTAACCGCTGG + Intronic
1090637004 11:128695353-128695375 GCAGCCTCGAAGCTAACCCCTGG - Intronic
1090725734 11:129525841-129525863 GCATCCTAGAATCCAGCCACTGG - Intergenic
1093430639 12:19081278-19081300 GCATCCTATAAAATAAACTCAGG - Intergenic
1111122574 13:83872609-83872631 GAAGCCGAGAAACTAACAGCTGG - Intergenic
1116754172 14:48925308-48925330 GCAGCCTAGAAACTGACTCCAGG - Intergenic
1119554996 14:75546418-75546440 CCTTCCTAGACACTAACCTCCGG + Intronic
1126372420 15:47961618-47961640 ACCTCCTAGAAACTAACAGTTGG + Intergenic
1129040273 15:72679972-72679994 GCATCCTGGTAACCAACTGCTGG + Intronic
1140737768 16:77913541-77913563 GCATCCTAGAAGCCAACTGAAGG - Intronic
1158882153 18:61790611-61790633 GCATGCTAGAAACTCAAGGCAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
929028422 2:37627793-37627815 GCATCATAGAAAGTAACTTCTGG - Intergenic
931880400 2:66563650-66563672 GCATTTTAGAAACAAACAGCTGG + Intronic
940179751 2:150918866-150918888 GCATCTTAAAAACTAAACACAGG + Intergenic
944587210 2:201182943-201182965 GCTTCCTAGAAACGAACCCGTGG - Exonic
946942645 2:224785778-224785800 GCAGCTTAAAAACTAACCTCTGG - Intronic
1173332034 20:42083372-42083394 ACATCCCAGAAACTAGCAGCTGG - Intronic
1176385732 21:6137839-6137861 GCAGCCTAGACCCTGACCGCTGG - Intergenic
1179737741 21:43400413-43400435 GCAGCCTAGACCCTGACCGCTGG + Intergenic
1183604480 22:38860521-38860543 GCAGCCTGGAAATTAACAGCAGG + Intergenic
1184024936 22:41848568-41848590 GCATCGTAGAGCCTAACTGCTGG + Intronic
951637878 3:24799314-24799336 GCATCCTAGCAATTACCCTCAGG + Intergenic
953927726 3:46990865-46990887 GCATCTGAGAAACTAAGCCCTGG + Intronic
962497775 3:135959879-135959901 GAATAATAGTAACTAACCGCAGG - Intergenic
970098125 4:12487874-12487896 GCATCCCAGTAACTAGCAGCAGG - Intergenic
972034014 4:34497514-34497536 GCTTCATGGAAACTAACAGCTGG + Intergenic
976447650 4:85150390-85150412 GCATCCTAATAACAAACTGCAGG + Intergenic
986012856 5:3732443-3732465 GCATACTAGAAACTATCTGGAGG + Intergenic
989682803 5:44048723-44048745 GCATTATAGAAACTAACCCCGGG - Intergenic
992200952 5:74383413-74383435 GCAGCCTAGAAACCAGCCTCAGG + Intergenic
1002713922 5:181213463-181213485 GCATCCTCGAAACCAACCTGTGG - Intergenic
1007413830 6:41680440-41680462 GCCTCCTAAAAACTAACCTCAGG - Intergenic
1031224786 7:119021920-119021942 GCACCCTAGAACCTAACATCAGG + Intergenic
1041944726 8:63428117-63428139 CCCTCCTAGAAACTAGCTGCTGG - Intergenic
1051028042 9:12637608-12637630 GCATGCTAGAAATAAACTGCAGG - Intergenic
1053202384 9:36161623-36161645 GCATCCTAGAAACCAAAAGGGGG + Intronic
1055120692 9:72657242-72657264 GCAGCCTAGAAACTCTCCTCAGG + Intronic
1197649702 X:129051387-129051409 GCATCCTAGAGACAAAGCACGGG - Intergenic