ID: 1090422593

View in Genome Browser
Species Human (GRCh38)
Location 11:126585700-126585722
Sequence ACGTGGGAACAAAGGGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090422580_1090422593 14 Left 1090422580 11:126585663-126585685 CCAAGTGGCAGAGGCCCCGGGGG 0: 1
1: 0
2: 4
3: 27
4: 318
Right 1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG 0: 1
1: 0
2: 0
3: 7
4: 137
1090422575_1090422593 22 Left 1090422575 11:126585655-126585677 CCCTCATGCCAAGTGGCAGAGGC 0: 1
1: 0
2: 0
3: 15
4: 191
Right 1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG 0: 1
1: 0
2: 0
3: 7
4: 137
1090422585_1090422593 -2 Left 1090422585 11:126585679-126585701 CCGGGGGAAGCCTCCTGCGGAAC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG 0: 1
1: 0
2: 0
3: 7
4: 137
1090422573_1090422593 25 Left 1090422573 11:126585652-126585674 CCACCCTCATGCCAAGTGGCAGA 0: 1
1: 0
2: 1
3: 11
4: 179
Right 1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG 0: 1
1: 0
2: 0
3: 7
4: 137
1090422583_1090422593 0 Left 1090422583 11:126585677-126585699 CCCCGGGGGAAGCCTCCTGCGGA 0: 1
1: 0
2: 0
3: 11
4: 82
Right 1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG 0: 1
1: 0
2: 0
3: 7
4: 137
1090422584_1090422593 -1 Left 1090422584 11:126585678-126585700 CCCGGGGGAAGCCTCCTGCGGAA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG 0: 1
1: 0
2: 0
3: 7
4: 137
1090422576_1090422593 21 Left 1090422576 11:126585656-126585678 CCTCATGCCAAGTGGCAGAGGCC 0: 1
1: 0
2: 0
3: 43
4: 380
Right 1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG 0: 1
1: 0
2: 0
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090422593 Original CRISPR ACGTGGGAACAAAGGGATGC GGG Intronic
902398573 1:16145287-16145309 GCGGGGGAACCAAGGGAAGCTGG + Intronic
903535288 1:24062780-24062802 ACTGGGGGAGAAAGGGATGCAGG - Intronic
905811553 1:40917011-40917033 ACCTGGGAGCCAAGGGAGGCTGG + Intergenic
907798608 1:57742375-57742397 ATGTGGGATCAAAAGGATGGGGG + Intronic
908144919 1:61230713-61230735 AAGTGTGAAAAACGGGATGCGGG - Intronic
911202676 1:95061518-95061540 AGGTGGGAACAAAGGGAGTGGGG + Intronic
911624418 1:100104760-100104782 ACCTGAGAAAAAAGGGAGGCTGG - Intronic
912422980 1:109558854-109558876 GAGTGGGAAAGAAGGGATGCAGG + Intronic
912858045 1:113189391-113189413 AGATGGGAATAAAGGCATGCAGG - Intergenic
915730896 1:158053551-158053573 ATGTGGGAGTAAAGGGATTCTGG - Intronic
916207756 1:162331903-162331925 AGGTAGGAACAAGGGGAGGCTGG - Intronic
918560983 1:185867330-185867352 ACCTGGGAAGAAAGGGATTGGGG + Intronic
920109197 1:203575229-203575251 AGTCGGGAACCAAGGGATGCTGG + Intergenic
921046963 1:211484748-211484770 AGGTGGGAAGAGAGGGAGGCAGG - Intronic
921196048 1:212759411-212759433 GCATGGGAAGAAAGGGAAGCAGG + Intronic
1065871194 10:29957836-29957858 AGGTGGGAACAAAGGGGCCCAGG - Intergenic
1067698800 10:48554055-48554077 AGGTGGTAACAAAGGGATCCTGG - Intronic
1070355406 10:75635131-75635153 AAATGGGAACAAGGGAATGCAGG + Intronic
1070563197 10:77583327-77583349 ACGGGGGCACAAATGGCTGCTGG + Intronic
1070959706 10:80490016-80490038 AGGTGGGGACAGAGGCATGCAGG + Intronic
1076043059 10:127268041-127268063 ACTTGGGAAGAGAGGGCTGCTGG + Intronic
1076899191 10:133328793-133328815 CCCTGGGAACAAAGGGGTGTGGG - Intronic
1081937941 11:46917946-46917968 GCGTGCGAAGAAAGGGAGGCGGG - Intronic
1083759582 11:64808238-64808260 ACGTGGGAGGGAAGGGATGGAGG - Intronic
1087135609 11:94715471-94715493 AGGTGAGAACAAAGGAAGGCTGG - Intronic
1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG + Intronic
1091026712 11:132147986-132148008 ACATGAGAACAAGGTGATGCTGG + Intronic
1094207712 12:27858275-27858297 AGGTGGAGACAAAGGGAGGCTGG - Intergenic
1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG + Intronic
1099205215 12:79719116-79719138 AGGTGGGAAAAAAGTGATGTTGG + Intergenic
1100112889 12:91267215-91267237 ATGTAGGAACCAAGGCATGCAGG - Intergenic
1101038014 12:100724224-100724246 AAGTGGAATCAAAGGGACGCCGG + Intronic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1103535518 12:121631055-121631077 ACTTGGGAACAAAAGGGTGCTGG - Intronic
1103792328 12:123480481-123480503 ACCTGGGAACAAATGGCTGAAGG + Intronic
1105045764 12:133002009-133002031 ACGTGAGAAGAAAGGGAAGCGGG - Intronic
1118416910 14:65549390-65549412 ACATGGTAACAAAGAAATGCAGG - Intronic
1121416978 14:93786524-93786546 ACCAGGAAAAAAAGGGATGCGGG - Intronic
1124201429 15:27681706-27681728 TCCTGGGAACAAAAGGATGAGGG - Intergenic
1124341687 15:28894091-28894113 TAGTGGAAACAAAGGGGTGCGGG + Intronic
1124965486 15:34429876-34429898 TAGTGGAAACAAAGGGGTGCGGG - Intronic
1124982111 15:34576083-34576105 TAGTGGAAACAAAGGGGTGCGGG - Intronic
1128707013 15:69843758-69843780 AGGGAGGAACAAAGGGATTCTGG - Intergenic
1128766596 15:70254838-70254860 AAGTGGGAGCCAAGGGCTGCAGG - Intergenic
1132803684 16:1766162-1766184 ACGTGGGAATGAGGGGATGGGGG - Intronic
1135968027 16:27051800-27051822 ACCTGGGTGCAAAAGGATGCGGG + Intergenic
1136539857 16:30923371-30923393 ACGGGGGAACAATAGGACGCTGG - Intronic
1137231200 16:46569346-46569368 ACGTGGGAACACAGGACTGAGGG + Intergenic
1139582798 16:67883337-67883359 AGGTGGGAAGAAAGGGGTCCAGG - Intronic
1139962193 16:70724413-70724435 ACTAGGGAACAATGGAATGCAGG + Intronic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141366116 16:83444915-83444937 ACGTGGGAACAGAGGCATTTTGG - Intronic
1142664555 17:1455549-1455571 ACGTGGGGACAAAGAGCTGAGGG - Intronic
1143409864 17:6702359-6702381 CCTTGGCCACAAAGGGATGCAGG - Intronic
1144877817 17:18411517-18411539 ACATGGGAAGAAAAGGGTGCGGG - Intergenic
1145154403 17:20532872-20532894 ACATGGGAAGAAAAGGGTGCGGG + Intergenic
1149315358 17:55433350-55433372 TAGTGAGAACAAAGGAATGCGGG + Intergenic
1150697253 17:67416593-67416615 AGGTGGGGGCCAAGGGATGCAGG - Intronic
1151304137 17:73252103-73252125 GAGTGGGAATAAAGGGATGAGGG + Intronic
1157197639 18:45632371-45632393 CCATGGGTACAACGGGATGCTGG + Exonic
1158245835 18:55431252-55431274 AGGTGGAATCAAAGGGATGTAGG - Intronic
1161715451 19:5873767-5873789 AGGTGGGAACAAACGGAGCCAGG + Intronic
1163162866 19:15475923-15475945 ACCTGGGAACTGAGGGCTGCTGG - Exonic
1164503575 19:28839765-28839787 ACTTGGAAGCAACGGGATGCTGG + Intergenic
1165016703 19:32886436-32886458 ATCTGGGAACTGAGGGATGCAGG - Intronic
1168351172 19:55676806-55676828 ACATGGGAAGACAGGGAGGCAGG - Exonic
1168505673 19:56932805-56932827 AGGTCGGAACAAAGGGAGGGAGG - Intergenic
1168707636 19:58478992-58479014 ACTTGGGAACCAAGCGATCCAGG - Intronic
925945920 2:8863586-8863608 GCGAGGGCACAGAGGGATGCGGG - Intronic
927631409 2:24777381-24777403 ACATGGTGACAAAGGGAAGCTGG + Intergenic
928169613 2:28994950-28994972 ATGTGGGGATAAAGGGCTGCTGG + Intronic
928918772 2:36503534-36503556 GGGTGGGAACAAAGGGGGGCGGG - Intronic
934622279 2:95820748-95820770 ACGTAGGCTCAAAGGGATGGAGG - Intergenic
935100283 2:99988111-99988133 AAGAAGGAACAAAGGGATGAAGG + Intronic
939299519 2:140317467-140317489 AGGTGGGAACACAAGGATGATGG + Intronic
940329009 2:152454666-152454688 ATGTGGGCAGAAAGGGATGCTGG + Intronic
946126238 2:217565612-217565634 AGGTAGGAAGAAAGGGATTCAGG - Intronic
947860356 2:233353889-233353911 ACGGGGGAAGAAAGGGAAGCTGG - Intergenic
948949633 2:241240593-241240615 TCGTGGGAAGAAAGGGAGCCTGG - Intronic
1170126431 20:12969387-12969409 AAGTAGGTACAAAGGAATGCAGG + Intergenic
1170716408 20:18834960-18834982 ACGTGGGAAGATGGGAATGCAGG - Intergenic
1180016310 21:45087424-45087446 ATGTGAGAAGAAGGGGATGCAGG + Intronic
1181851084 22:25750450-25750472 GCGAGGGAAAAAAAGGATGCTGG - Intronic
952722231 3:36545371-36545393 AGGTGGGAAGTGAGGGATGCAGG - Intronic
953312186 3:41890841-41890863 AGGGGGGAAGGAAGGGATGCGGG + Intronic
957193284 3:77038730-77038752 ACGTTAGATCAAAGGGGTGCCGG - Intronic
961506149 3:127371735-127371757 ACGTGGGGACCCAGAGATGCTGG + Intergenic
961661602 3:128471646-128471668 ACCTGGGACCGAAGGGATGGTGG + Intergenic
961824864 3:129593738-129593760 GTGTGGCAACAAAGGGAGGCGGG + Intronic
965772197 3:172193139-172193161 AGGTGGGAAGGAAGGGAGGCAGG - Intronic
967483864 3:190007195-190007217 AAGTGGGAGTAAAGGGATACTGG + Intronic
968065732 3:195757994-195758016 ACATGGGGCAAAAGGGATGCAGG + Intronic
970600151 4:17635690-17635712 ACGTGTGAACAAAGGTATCATGG - Intronic
972277520 4:37571011-37571033 ACGTGGGAATGAAGGCATGATGG - Intronic
972779998 4:42279239-42279261 ACGTGGGAAGAAGAGGACGCGGG - Intergenic
973561229 4:52138270-52138292 ACATAGGAACAAATGGATACAGG + Intergenic
976784495 4:88802681-88802703 AGGGGAGAAGAAAGGGATGCAGG - Intronic
985577405 5:679802-679824 GCCTGGGAGCAAAGGGATGAGGG + Intronic
985592337 5:771898-771920 GCCTGGGAGCAAAGGGATGAGGG + Intergenic
990549948 5:56864817-56864839 CCGTGTTAACAAAGTGATGCGGG + Exonic
995284532 5:110371963-110371985 ACGTGGGAACAAAAATATGTTGG - Intronic
995936672 5:117524442-117524464 ACCTGGGAACCAAGGAATGCAGG - Intergenic
996864521 5:128104930-128104952 ATTTGGGAACAAAGGAATGAGGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1000040305 5:157480324-157480346 CCGTGTGAATACAGGGATGCAGG + Exonic
1001170038 5:169410584-169410606 ATGTGGGGACAGAGGTATGCAGG + Intergenic
1007654691 6:43445121-43445143 CAGTGGGAACACTGGGATGCTGG - Exonic
1013399575 6:109779378-109779400 ATGTGGGAATAAAAGGAAGCTGG + Intronic
1013650296 6:112187990-112188012 ACGTGGGCACATGGGGAGGCAGG + Intronic
1016641158 6:146351159-146351181 AGGTTGGAACAAAGGGCAGCTGG + Intronic
1017525118 6:155235624-155235646 ACTTGGGACCAAAAGGAGGCAGG - Intronic
1018631452 6:165826319-165826341 ACATGGGGACAGAAGGATGCAGG - Intronic
1018942057 6:168314985-168315007 ACACGGGAACCAAGGGAGGCAGG - Intronic
1019530525 7:1500771-1500793 AAGTGGGAAGAAGGGCATGCTGG - Intronic
1021887580 7:25155053-25155075 CCGTGGGAGGAAAGGGCTGCTGG + Exonic
1026568504 7:71509741-71509763 ACATGGGAACAGAGAGATGGAGG + Intronic
1027998201 7:85454414-85454436 ATGGGGAAACAAAGTGATGCAGG - Intergenic
1028331957 7:89605612-89605634 AGGTGGGAACACTGGGTTGCAGG - Intergenic
1032194114 7:129779975-129779997 GCGGGGGAACAAAGGGGAGCCGG + Intergenic
1032598450 7:133267050-133267072 AAGTGGGACTAAAGAGATGCAGG - Intronic
1035596742 8:864190-864212 AGGTGGGAGGACAGGGATGCAGG + Intergenic
1036069570 8:5425771-5425793 ACTTGGGAAAACAGGGATGAGGG - Intergenic
1037429580 8:18795400-18795422 ACTGGAGAACAGAGGGATGCTGG + Intronic
1039256360 8:35723247-35723269 AAGTGGAAACACAGGCATGCTGG + Intronic
1039548114 8:38424291-38424313 AGCTGGGAACAGAGGGCTGCAGG - Intronic
1039600126 8:38829514-38829536 ATGTGGGAGCAAAAGCATGCTGG - Intronic
1040132893 8:43818104-43818126 ATCTGGGAACAAATTGATGCTGG + Intergenic
1040290718 8:46122690-46122712 ATGTGGGAAAAAGGGGCTGCAGG - Intergenic
1041941645 8:63394728-63394750 ACTTGGGAACACTGGGATGATGG - Intergenic
1042445742 8:68883508-68883530 AGGAGGGAAAAAAGGGATGGAGG + Intergenic
1043576506 8:81664705-81664727 AAGTAGGAACTAAGGGGTGCGGG + Intronic
1044847068 8:96392468-96392490 AGGTGGGAACAGAGGGGTGAAGG - Intergenic
1046917861 8:119696317-119696339 AGATGAGAACAAAGGTATGCAGG - Intergenic
1047988891 8:130265082-130265104 TCATGGCAACAAAGGGCTGCTGG + Intronic
1048150355 8:131887714-131887736 ACCTGGGAAGAAAGGCAGGCAGG - Intergenic
1049216026 8:141408804-141408826 GCTGGGGAACAGAGGGATGCTGG + Intronic
1051357632 9:16254374-16254396 ACCTGGGGAGAAAGGGAAGCTGG - Intronic
1052364512 9:27596754-27596776 AGATGGGAACAAAGGCATTCAGG - Intergenic
1057170396 9:92960013-92960035 ACATGGGAACACAGGGACTCGGG - Intronic
1058897839 9:109415393-109415415 AAGTGGGAAAAAAGGCATTCTGG + Intronic
1060181828 9:121539598-121539620 ACTTGGGCACAAAGGAATGCGGG + Intergenic
1061456419 9:130701272-130701294 TCCTGGGAACAAAGGCAGGCTGG + Intronic
1062300343 9:135863873-135863895 AGGGGGGAACACAGGCATGCGGG + Intronic
1197659468 X:129154582-129154604 GCTGGGGAACAAAGGGAGGCAGG + Intergenic
1198532616 X:137560865-137560887 ACTTGGGGACAAAGGGTTGGTGG + Intergenic