ID: 1090425673

View in Genome Browser
Species Human (GRCh38)
Location 11:126605468-126605490
Sequence TCCATCATGTCCCATGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090425673_1090425677 0 Left 1090425673 11:126605468-126605490 CCTACTTCATGGGACATGATGGA 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1090425677 11:126605491-126605513 TGAGACTCAGGATGCCAGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 315
1090425673_1090425678 3 Left 1090425673 11:126605468-126605490 CCTACTTCATGGGACATGATGGA 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1090425678 11:126605494-126605516 GACTCAGGATGCCAGGAGGGAGG 0: 1
1: 0
2: 3
3: 30
4: 377
1090425673_1090425675 -4 Left 1090425673 11:126605468-126605490 CCTACTTCATGGGACATGATGGA 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1090425675 11:126605487-126605509 TGGATGAGACTCAGGATGCCAGG 0: 1
1: 0
2: 2
3: 18
4: 187
1090425673_1090425676 -1 Left 1090425673 11:126605468-126605490 CCTACTTCATGGGACATGATGGA 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1090425676 11:126605490-126605512 ATGAGACTCAGGATGCCAGGAGG 0: 1
1: 0
2: 0
3: 19
4: 287
1090425673_1090425680 27 Left 1090425673 11:126605468-126605490 CCTACTTCATGGGACATGATGGA 0: 1
1: 0
2: 1
3: 14
4: 111
Right 1090425680 11:126605518-126605540 ACAGCCCACACTTAGCAGCTTGG 0: 1
1: 0
2: 1
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090425673 Original CRISPR TCCATCATGTCCCATGAAGT AGG (reversed) Intronic
900306484 1:2011695-2011717 TCCCTCATGTCCCATCACTTGGG - Intergenic
903957629 1:27036085-27036107 TCCATCAAGACTCATGTAGTGGG - Intergenic
908134445 1:61115731-61115753 TTCAACATTGCCCATGAAGTTGG - Intronic
920906503 1:210174742-210174764 TCCATCAAGTCCAATGACCTGGG - Intergenic
1065999516 10:31091360-31091382 TGAATAATGTCCCCTGAAGTTGG + Intergenic
1066806737 10:39263697-39263719 TCCTTCATGTCCCTTGTAATTGG - Intergenic
1068793233 10:61049703-61049725 TCCAGCATATTCCATGAAGCTGG - Intergenic
1068936823 10:62643881-62643903 TCCATCATGACCCTTGGACTGGG + Intronic
1071771882 10:88738317-88738339 TCCATGATGACCCAAGGAGTTGG + Intronic
1074305092 10:112269600-112269622 TCCATCATGGCCCATTGACTGGG - Intergenic
1074636650 10:115326366-115326388 TCCTTCATGTCCCTTTAAGTTGG - Intronic
1076054806 10:127363719-127363741 TTCATCATATCACATGAAGGCGG + Intronic
1077886959 11:6393770-6393792 TCCCTGTTGTCCCATGGAGTGGG + Intronic
1080187263 11:29504794-29504816 TCCATTATATACCATGAATTTGG + Intergenic
1080687800 11:34529857-34529879 TCCATCATGAGCCAGGCAGTGGG + Intergenic
1080730584 11:34948139-34948161 TCCCTACTGTCCTATGAAGTAGG - Intronic
1082314361 11:50698875-50698897 TCCTTCATGTCCCTTGAAAGTGG - Intergenic
1083905161 11:65664151-65664173 TCCATTCTGTCACCTGAAGTCGG - Intergenic
1085002522 11:73053169-73053191 TCCATAATTTTCAATGAAGTAGG + Intronic
1086590975 11:88513220-88513242 TTCATAATGTCCCATCAAGCAGG - Intronic
1088030067 11:105237729-105237751 TCCATCATGTCCACAAAAGTAGG + Intergenic
1088716489 11:112554080-112554102 TGGATCATGTCCCCTCAAGTAGG + Intergenic
1089531758 11:119134430-119134452 TCCATGATGCCCCCTGAAGGTGG - Exonic
1089657520 11:119961775-119961797 TCCATCTTTTCCCATGAAAACGG - Intergenic
1090425673 11:126605468-126605490 TCCATCATGTCCCATGAAGTAGG - Intronic
1094096512 12:26711242-26711264 TTCATCATGACCCATGCCGTGGG - Exonic
1094417945 12:30237112-30237134 TCTATTATGTACCAAGAAGTGGG + Intergenic
1097307710 12:58087621-58087643 TCCAACATGTGCCAAGAGGTGGG - Intergenic
1097809631 12:64004251-64004273 TCCCTCATGTCCCATGAAAAAGG + Intronic
1098863679 12:75737701-75737723 TCCACCAAGTCACATGAACTTGG - Intergenic
1099349135 12:81542854-81542876 ACCATCATGCCCTAGGAAGTTGG - Intronic
1100672918 12:96835735-96835757 TCCTGCCTGTTCCATGAAGTGGG + Intronic
1104113882 12:125730218-125730240 TCCTTCATGTCCCTTTAAGTTGG - Intergenic
1107619364 13:42210199-42210221 TCCAGCATGTGCAATGAAGCAGG - Intronic
1109793797 13:67283787-67283809 TCCGTCATTTCCAATGTAGTGGG + Intergenic
1117512357 14:56465800-56465822 TTCATCATGACCCTTGAAGGTGG - Intergenic
1117541296 14:56749148-56749170 CACTTCATATCCCATGAAGTGGG + Intergenic
1119644272 14:76337258-76337280 GGCATCCTGTCCCATGATGTGGG + Intronic
1123605665 15:22025391-22025413 TCCTTCATGTCCCTTGTAGGTGG + Intergenic
1125224526 15:37380214-37380236 TCCTTCAAGTCCCTTTAAGTTGG + Intergenic
1127520845 15:59741704-59741726 TCCATCATGGCCATTGAACTTGG - Intergenic
1129165766 15:73776394-73776416 TCCATCCTGGCCCATAAGGTAGG - Intergenic
1129186574 15:73910956-73910978 CCCATCATCTCCCGTGAAGAGGG + Intergenic
1139313162 16:66044176-66044198 TGCCTCAGGTCCCATGAAATAGG + Intergenic
1140722745 16:77786068-77786090 TCCATCCTGTCCCATGTACTTGG - Intergenic
1142076249 16:88119870-88119892 ACCATCCTGTCCCAAGCAGTGGG - Intergenic
1146556173 17:33826308-33826330 TCCATCATATGCCATGAAGGTGG - Intronic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1152458744 17:80430581-80430603 TCCAGCCTGTCCCAGGAAGAGGG + Intronic
1155608469 18:27635321-27635343 TCCATCCTCTCCCCTCAAGTGGG - Intergenic
1163265706 19:16219801-16219823 TGCAACCTGTCACATGAAGTTGG + Intronic
1163710637 19:18844738-18844760 CCCATCATGTCCCCTGGCGTGGG + Intronic
1164539504 19:29112403-29112425 TCCTTCATCTCCCATCAACTGGG - Intergenic
1168616286 19:57839665-57839687 TCATTCATGTCCCATGTATTTGG + Intronic
1168620582 19:57876367-57876389 TCATTCATGTCCCATGTATTTGG - Intronic
926803912 2:16686910-16686932 TCCATGATATCCCAGGAATTAGG - Intergenic
928877431 2:36056595-36056617 TCCATCAAGTACTATGAATTTGG + Intergenic
930898480 2:56474252-56474274 TTCATCTTCTCCCTTGAAGTTGG - Intergenic
931890879 2:66670788-66670810 TCCCTCATGTCCCTTCAATTCGG + Intergenic
932090781 2:68804439-68804461 TCAATCATGTCCTATCAATTTGG + Intronic
933643095 2:84785234-84785256 CCCCTGATGTCCCATGACGTGGG - Intronic
940522521 2:154768895-154768917 TCCTTCACGTCCCTTTAAGTTGG + Intronic
940846862 2:158651389-158651411 TCCATCCTGTCCTGTGAAATAGG + Intronic
941546541 2:166858123-166858145 TCCTTCATGTCCCTTTAAGTTGG - Intergenic
944117129 2:196200733-196200755 TCACTCATGTCCCATGAAAGCGG + Exonic
945674533 2:212840281-212840303 GCCATCCTGTCCCACTAAGTGGG - Intergenic
1178046439 21:28699816-28699838 TTCGTCATGCCCCATGAAATGGG + Intergenic
1185093838 22:48794973-48794995 TCCATCCTTTCCCAGGAAGAGGG - Intronic
951122130 3:18941680-18941702 TCCTTCATGTCCAAAGCAGTAGG - Intergenic
955136319 3:56222391-56222413 TCCATGGTGTTCCATGAAGGGGG - Intronic
956791881 3:72686306-72686328 TCCATCATGTGCCATGGAGTTGG - Intergenic
958590535 3:96153783-96153805 TCCATCATGTCATAGGAATTTGG - Intergenic
961575520 3:127832869-127832891 TCCATTCAGTCCCATGAAATAGG - Intergenic
962217510 3:133535411-133535433 TCCATCTGGTCCCTGGAAGTAGG + Intergenic
962862228 3:139414713-139414735 TCCCTCATCTCCCATGCAGTTGG + Intergenic
963614029 3:147511774-147511796 TTCATCGTGTCCCAGGAAGTAGG + Intergenic
967688403 3:192444336-192444358 TCCAACATTTCCCATTCAGTAGG + Intronic
970503388 4:16702278-16702300 TCCAACACTTCCCATGAACTTGG + Intronic
972246311 4:37248402-37248424 TCCAGCATCTTCCATGAGGTGGG - Intronic
975806125 4:78114537-78114559 TCCTTCATGTCCCTTTAAGTTGG + Intronic
978472831 4:109089341-109089363 TTCTTCATGTCCTATGAGGTGGG - Intronic
979945561 4:126827136-126827158 TTCCTCAACTCCCATGAAGTGGG - Intergenic
980275011 4:130639262-130639284 TCCATCATTTCTAATGAAATTGG - Intergenic
984752260 4:183289307-183289329 TCCATCATGCGCCAGGAAGGAGG + Intronic
985168149 4:187119320-187119342 CCGAGCCTGTCCCATGAAGTAGG - Intergenic
986902080 5:12448386-12448408 TCCATTATATCCCAAGTAGTTGG - Intergenic
988671164 5:33383554-33383576 TCCCTCTTCTCCCTTGAAGTAGG + Intergenic
990681669 5:58251415-58251437 TCAATCATGCTCCCTGAAGTAGG + Intergenic
990974298 5:61544202-61544224 TCCATCATGCGCCATTAAGAAGG - Exonic
992159432 5:73986212-73986234 TTCTTCAAGTCCCATGAAGTGGG - Intergenic
992983894 5:82206949-82206971 TCCATGTTGTTCCATGTAGTAGG + Intronic
996473809 5:123891927-123891949 TTCATCATATCCCATCAAATGGG + Intergenic
999180167 5:149664692-149664714 TCCATGAGGTTCCATGAGGTAGG + Intergenic
1000139141 5:158384376-158384398 ACCTTCATGTCCCATCAAGAAGG - Intergenic
1000161727 5:158604260-158604282 TTCCTGATGTCCCAGGAAGTGGG - Intergenic
1001430877 5:171660944-171660966 ACCATCAAGCCCCATGAAGTAGG + Intergenic
1012470875 6:99571056-99571078 CCCATAAAGTCCCATAAAGTCGG + Intergenic
1013943875 6:115698862-115698884 TCCATGATGTGTGATGAAGTTGG - Intergenic
1015655856 6:135518341-135518363 TCCTTACTGTCCCATGAAGTAGG + Intergenic
1016381041 6:143480628-143480650 TCAATCATGGAGCATGAAGTTGG - Intronic
1016772981 6:147872688-147872710 TCCATCACGGACCATGAAGTGGG - Intergenic
1017772038 6:157651116-157651138 TCCAACAAGTGCCATGAAATGGG + Intronic
1017847244 6:158269799-158269821 ACCTTCATTTCCCAAGAAGTAGG - Intronic
1020236472 7:6359691-6359713 TCCATCTTGGCCCATGAAGAAGG + Intergenic
1023867256 7:44244152-44244174 TCCTTCCTGCCCCATGTAGTGGG - Intronic
1031858188 7:126947014-126947036 TCCTTCATCTTCCATGAAGCTGG + Intronic
1032797245 7:135287824-135287846 TCCAGCCAGTCCCAGGAAGTAGG - Intergenic
1035123455 7:156589481-156589503 TCCATCAAGTCCTATGTAATGGG - Intergenic
1036604838 8:10295660-10295682 GCCATCATGTTCCATGATGCTGG + Intronic
1038049152 8:23792777-23792799 TCAATCATGTTCCTTGCAGTAGG - Intergenic
1039410390 8:37350053-37350075 GTGATCATGTCACATGAAGTGGG + Intergenic
1040518977 8:48159083-48159105 TCCTCCATGTGTCATGAAGTGGG - Intergenic
1041774943 8:61513698-61513720 TCCATCCTGTCACACAAAGTAGG + Intronic
1042361363 8:67886943-67886965 TCCCACATGTCCCAGGAATTTGG - Intergenic
1046315251 8:112492526-112492548 TCCATCATCTCCCATGATACAGG + Exonic
1047790532 8:128199090-128199112 TCCCTCAAATCCCATGAGGTTGG - Intergenic
1050433029 9:5581271-5581293 TCCAGCATGTCCAATGGAGAAGG + Intergenic
1051104131 9:13558692-13558714 TACATCAGGTACTATGAAGTTGG + Intergenic
1051825201 9:21211610-21211632 TCCATCATGACCGTTGCAGTGGG + Intronic
1056231598 9:84551234-84551256 GCAATCATGTCCCAGGTAGTAGG + Intergenic
1056675871 9:88676953-88676975 TCCATGATTCCCCATGAAGATGG - Intergenic
1058848578 9:108987737-108987759 TCCTTCACGTCCCTTGTAGTTGG + Intronic
1060876958 9:127090512-127090534 TCCCTCCTGTCCCCTGATGTTGG + Intronic
1061165318 9:128919004-128919026 CACATCCTGTCCCATGAAGCTGG - Intergenic
1062712696 9:137985426-137985448 TCCATTTTCTCCCAGGAAGTAGG + Intronic
1199804368 X:151283150-151283172 TCCTTCATGGACCATTAAGTTGG + Intergenic
1202061125 Y:20889408-20889430 TCCTTCATGTCCCTGTAAGTTGG - Intergenic