ID: 1090428742

View in Genome Browser
Species Human (GRCh38)
Location 11:126628733-126628755
Sequence AATCTGATGAATAGGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 384}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090428742_1090428750 10 Left 1090428742 11:126628733-126628755 CCATCTTTCCTATTCATCAGATT 0: 1
1: 0
2: 2
3: 27
4: 384
Right 1090428750 11:126628766-126628788 CAGCCTGCTACCTGGAGCCAGGG 0: 1
1: 0
2: 0
3: 32
4: 284
1090428742_1090428746 2 Left 1090428742 11:126628733-126628755 CCATCTTTCCTATTCATCAGATT 0: 1
1: 0
2: 2
3: 27
4: 384
Right 1090428746 11:126628758-126628780 CTGGAGCCCAGCCTGCTACCTGG 0: 1
1: 0
2: 3
3: 26
4: 309
1090428742_1090428749 9 Left 1090428742 11:126628733-126628755 CCATCTTTCCTATTCATCAGATT 0: 1
1: 0
2: 2
3: 27
4: 384
Right 1090428749 11:126628765-126628787 CCAGCCTGCTACCTGGAGCCAGG 0: 1
1: 0
2: 6
3: 43
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090428742 Original CRISPR AATCTGATGAATAGGAAAGA TGG (reversed) Intronic
900384389 1:2402926-2402948 TGTCTGATGTATAGAAAAGATGG + Intronic
901205289 1:7491253-7491275 AACCTTATGAACAGGAAAGAGGG - Intronic
902255476 1:15186315-15186337 AATTGGATGGACAGGAAAGACGG + Intronic
902267509 1:15278422-15278444 TAACTGAGGAATAGGAAAAAGGG + Intronic
903000437 1:20261828-20261850 GATCTGCTGAATAAGAAACATGG - Intergenic
906699293 1:47846268-47846290 CTTCTGAGGAATGGGAAAGAGGG + Intronic
907288617 1:53398014-53398036 AATTAGATGTATATGAAAGATGG + Intergenic
907887616 1:58607653-58607675 AAGATGATGAATAGGAGACAGGG - Intergenic
907964438 1:59315473-59315495 AATCTGAGGAAAAGGAAAAGAGG - Intronic
908445939 1:64200143-64200165 AATCTGATGGGCTGGAAAGAAGG + Intergenic
910519886 1:88107996-88108018 TATCAGGTGAAAAGGAAAGAAGG - Intergenic
911877765 1:103190536-103190558 AATCTGAAGAAAAGGAACTAGGG - Intergenic
911899548 1:103485414-103485436 ACTATGTTGAATAGGAGAGAGGG - Intergenic
912162691 1:107005746-107005768 AAGCTGATGAATCCAAAAGAAGG - Intergenic
913439504 1:118883170-118883192 AATATTATGAATATGAAAAAGGG - Exonic
916720578 1:167482315-167482337 ACTCTGATGATCAAGAAAGAAGG + Intronic
917059230 1:171018194-171018216 AATCTGGAGAACAGCAAAGATGG - Intronic
917831891 1:178899391-178899413 AATTTGAAGAACAGGATAGAGGG + Intronic
917982976 1:180284333-180284355 AATCACATGATTACGAAAGATGG + Intronic
918797640 1:188924022-188924044 AATGTGATGAAAAATAAAGAGGG + Intergenic
919436961 1:197574050-197574072 ACTATGTTGAATAGGAGAGAGGG - Intronic
919567697 1:199209538-199209560 AATCTGACGACTGGGCAAGAGGG - Intergenic
920031957 1:203042946-203042968 AAACTGATGGATATGAAAGAGGG - Intronic
920941278 1:210485385-210485407 AATATGAAGAACAAGAAAGAAGG - Intronic
921316443 1:213895843-213895865 AGACTGATGAATACGAAAGATGG - Intergenic
921459518 1:215411712-215411734 AATGTGAGGAACAGGAAAGAAGG + Intergenic
921509514 1:216011937-216011959 AGGCTGAGGAACAGGAAAGAAGG - Intronic
921871820 1:220149130-220149152 AATCTGATTGATAGGAAGAAAGG - Exonic
921878736 1:220229450-220229472 AACCTAATGAGTAGAAAAGAAGG - Intronic
923809086 1:237292787-237292809 AAGCTGATGAATAGGAATGTTGG + Intronic
924450826 1:244177541-244177563 TATCTGATGCGAAGGAAAGAAGG - Intergenic
924654964 1:245966108-245966130 ATTATGATGAAGAAGAAAGAAGG - Intronic
924803228 1:247343049-247343071 ATTCAGATGAATAGGAGAAAAGG + Intergenic
1063320641 10:5049525-5049547 AATCTGATGCATATGAACAAGGG - Intronic
1063509336 10:6631363-6631385 AGGGTGAGGAATAGGAAAGAAGG + Intergenic
1064640601 10:17411787-17411809 TTTCAGATGAATAGGAAATAGGG - Intronic
1064835663 10:19526924-19526946 AAAATGTAGAATAGGAAAGAAGG + Intronic
1065070183 10:22015253-22015275 AGTCAGATGAATAGGAGAAAAGG + Intergenic
1065230051 10:23588913-23588935 ACTATGTTGAATAGGAGAGAGGG + Intergenic
1065642519 10:27799065-27799087 AATCTGAGGTTTAGGAAGGAAGG - Intergenic
1066135827 10:32445460-32445482 AATGAAAGGAATAGGAAAGATGG - Intergenic
1067923293 10:50481340-50481362 AAGCTGCAGAATAGCAAAGATGG - Intronic
1068118226 10:52758175-52758197 AATTTCATGAATAGGAGAAAGGG - Intergenic
1072333939 10:94380647-94380669 ATTTTGATGAATAGGAGAAAAGG + Intergenic
1072884743 10:99263150-99263172 AGGGTGAGGAATAGGAAAGAAGG - Intergenic
1073612518 10:104958514-104958536 AATCTAGAGAATGGGAAAGAGGG + Intronic
1074379123 10:112964266-112964288 AATGACATGAAAAGGAAAGACGG - Intronic
1074617687 10:115086525-115086547 ACTCTGGGGCATAGGAAAGAAGG - Intergenic
1080593180 11:33741962-33741984 AAGATGATGAAGAGGAGAGACGG - Exonic
1080661142 11:34296986-34297008 AAACTCATGAATAGGATAGGTGG - Intronic
1080693266 11:34577775-34577797 AAGCAGATGAAAAGTAAAGAAGG + Intergenic
1080749255 11:35137960-35137982 GATCTGCTGGGTAGGAAAGATGG + Intergenic
1081311978 11:41585463-41585485 AATCTCATGTATAGGAAAGATGG + Intergenic
1081921112 11:46778248-46778270 AATTGGAAGATTAGGAAAGAAGG - Exonic
1081982104 11:47273896-47273918 AAACTGATGAATTGGAACCATGG + Exonic
1082587410 11:54958870-54958892 AAACTGATGAATAAGAAGAAAGG - Intergenic
1084689694 11:70717871-70717893 AATCAGATGAAGAAGAAAGATGG + Intronic
1086240779 11:84687692-84687714 AACCTGATAGGTAGGAAAGAAGG - Intronic
1086250075 11:84802265-84802287 AATAGGAATAATAGGAAAGATGG + Intronic
1087124099 11:94606263-94606285 AAACTCATGAATTGGAAGGAAGG + Intronic
1088936617 11:114407425-114407447 CATCTGAGGAATAGGAAAAGTGG - Exonic
1090428742 11:126628733-126628755 AATCTGATGAATAGGAAAGATGG - Intronic
1090924245 11:131235628-131235650 TATGTGATGAATAGTGAAGAGGG - Intergenic
1091419971 12:328427-328449 AATTTGATGAATAGGAAGGATGG - Intronic
1092800161 12:12156860-12156882 ACTCTGATGGAGAGAAAAGAAGG - Intronic
1093197025 12:16141742-16141764 AAGCTGGAGAATAGGAAACATGG + Intergenic
1093229371 12:16525101-16525123 TATCAGGTGAAAAGGAAAGAAGG - Intronic
1093462578 12:19419923-19419945 AATCTGATGTTTTGGAAGGACGG - Intronic
1094733797 12:33209079-33209101 AATCCAAAGAATGGGAAAGAGGG - Intergenic
1094770466 12:33652428-33652450 AATCTGGTTCACAGGAAAGAAGG + Intergenic
1095319599 12:40810205-40810227 AAGCTGAAGAATATAAAAGAGGG - Intronic
1095359897 12:41324180-41324202 AATCTCATGCAGAGGAATGAAGG - Intronic
1095643285 12:44510089-44510111 AATCAAAAGAATAGGATAGAAGG - Intronic
1096393356 12:51246919-51246941 AAACTTTTGAATAGGGAAGAAGG - Intronic
1097478803 12:60094531-60094553 AATCAGAGGACTAGGAAATAAGG + Intergenic
1097652100 12:62311743-62311765 AATTACAAGAATAGGAAAGATGG + Intronic
1098582245 12:72113865-72113887 ACTATGATGAATAAGAAAAAAGG - Intronic
1099606347 12:84806428-84806450 ACAATGATGAATAAGAAAGAAGG - Intergenic
1099949672 12:89287547-89287569 AAAATGAAGCATAGGAAAGAAGG - Intergenic
1100004435 12:89876973-89876995 TGCCTGATGAATAGGAGAGAGGG - Intergenic
1100326484 12:93544437-93544459 AAATTGATGAATAGAAAAAAGGG - Intergenic
1100863002 12:98827197-98827219 AATCTGATCAATGAGAAAAAGGG - Intronic
1102804760 12:115769939-115769961 AATCTTCTGAAGAGGAAAAAGGG - Intergenic
1103288444 12:119823406-119823428 AGTGTGATGAAAAAGAAAGAAGG + Intronic
1105327889 13:19386739-19386761 AAGCTGAGGAATTGGAAAGATGG - Intergenic
1105654288 13:22418750-22418772 ACTCTAAAGAAAAGGAAAGATGG - Intergenic
1105755419 13:23459229-23459251 GTTCTGCTGAAGAGGAAAGATGG - Intergenic
1105864014 13:24442948-24442970 AAGCTGAGGAATTGGAAAGATGG + Intronic
1107094089 13:36515958-36515980 AATGTGAGGAAGAGGAAACATGG + Intergenic
1107330920 13:39298320-39298342 AATCTGCAGAATAGGCCAGAAGG + Intergenic
1108909876 13:55534666-55534688 AATGTGAGAACTAGGAAAGAAGG + Intergenic
1108947720 13:56044458-56044480 AGGCTGAGGAACAGGAAAGAGGG - Intergenic
1109710140 13:66148615-66148637 ACTCTGATCAGTAGGAAAGCTGG - Intergenic
1110145710 13:72187879-72187901 AACCTGAGGAATAGAAAAGCTGG + Intergenic
1110667678 13:78137209-78137231 AATCTGATGATTAGGATATATGG + Intergenic
1110742164 13:79010278-79010300 GATTTGTTGATTAGGAAAGAAGG - Intergenic
1111787773 13:92812528-92812550 AATTTCTTGAATATGAAAGAGGG + Intronic
1111820049 13:93202558-93202580 TATCTGATGAATGAGAAATAAGG - Intergenic
1112307515 13:98288484-98288506 AATATCATGAATAAGAAAGCAGG - Intronic
1112798160 13:103080313-103080335 AGTCAGATGAGTAGGAAAGGTGG - Intergenic
1112827537 13:103408808-103408830 AATGTGGAGAATGGGAAAGAGGG + Intergenic
1113058858 13:106299461-106299483 AATCTTCTGAATGGTAAAGATGG + Intergenic
1113175477 13:107558869-107558891 CATCTGAGGACAAGGAAAGATGG - Intronic
1114577442 14:23727160-23727182 GAACTGAGGAAGAGGAAAGAAGG - Intergenic
1115461209 14:33663109-33663131 ACTATGTTGAATAGGAGAGAGGG + Intronic
1115837893 14:37430185-37430207 AATCTGATTAATGCCAAAGATGG - Intronic
1116029585 14:39554751-39554773 AAGCTGACAACTAGGAAAGAAGG + Intergenic
1116046796 14:39753339-39753361 AATAAAATGAATAGGAAAGTTGG - Intergenic
1116481789 14:45399755-45399777 ATCCTGATGAATAGGCAGGATGG + Intergenic
1116534520 14:46014193-46014215 AGGGTGAGGAATAGGAAAGAAGG + Intergenic
1117289398 14:54317911-54317933 AATGTGAACTATAGGAAAGAAGG - Intergenic
1117784863 14:59272406-59272428 AATTTTATTAATAGTAAAGATGG - Intronic
1118257941 14:64221394-64221416 AAAATGAGGAAGAGGAAAGAAGG - Intronic
1118512089 14:66486568-66486590 AAAATGCTGAATAGAAAAGAGGG + Intergenic
1118970816 14:70636026-70636048 AAGGTGAAGATTAGGAAAGAAGG + Intergenic
1119177499 14:72579939-72579961 GATCTGGACAATAGGAAAGAGGG + Intergenic
1119317457 14:73707432-73707454 AGGGTGAGGAATAGGAAAGAAGG - Intergenic
1119956233 14:78801421-78801443 AATCTGATGGAAAGGGAAGCTGG + Intronic
1120076907 14:80169277-80169299 TATCTGAAGAATAAGAACGAGGG - Intergenic
1120174536 14:81278795-81278817 AAACTGAAGTATAGGAATGAGGG + Intronic
1120437795 14:84501984-84502006 AGGGTGAGGAATAGGAAAGAAGG + Intergenic
1120569014 14:86094759-86094781 AATTTGATGAAGAGGAAATGTGG - Intergenic
1121192998 14:92046335-92046357 AGGGTGAGGAATAGGAAAGAAGG + Exonic
1121921263 14:97883717-97883739 AATGTGATGAATAGCAGAGAAGG - Intergenic
1122285469 14:100649177-100649199 AAACGGAAAAATAGGAAAGAAGG - Intergenic
1123900805 15:24874731-24874753 AATCTCATAAATAGGAGAGTAGG + Intronic
1124046446 15:26155345-26155367 AGGCTGAAGAATAGCAAAGATGG + Intergenic
1124070365 15:26387096-26387118 AAACTGATGAAAAGAAAAGTTGG - Intergenic
1125227999 15:37417757-37417779 AATCCTGTGACTAGGAAAGAAGG + Intergenic
1125342131 15:38685629-38685651 AAGCTGATTAATAGGAGACAAGG - Intergenic
1125887613 15:43240462-43240484 AATCAGATCAATAGGAGAAAAGG - Intronic
1127251215 15:57240342-57240364 ACTATGAAGAATACGAAAGAAGG + Intronic
1127407244 15:58663498-58663520 AAGACGATGAACAGGAAAGAGGG - Intronic
1127477818 15:59351217-59351239 ATTCAGATGAACAGGAAAAAAGG + Intronic
1127808813 15:62545369-62545391 TGTCTGTTGAAGAGGAAAGAGGG + Intronic
1128011118 15:64297043-64297065 AAGCTGATGAATAGGAAGAGGGG - Intronic
1129739553 15:77983668-77983690 AATCTGTTGGTGAGGAAAGAGGG + Intergenic
1129846354 15:78769379-78769401 AATCTGTTGGTGAGGAAAGAGGG - Intronic
1131067910 15:89445792-89445814 GATCTGTTGAATAGTAAACATGG + Intergenic
1134502930 16:14783220-14783242 AATTTGATGTATAAGGAAGAAGG + Intronic
1134577634 16:15345676-15345698 AATTTGATGTATAAGGAAGAAGG - Intergenic
1135231701 16:20714547-20714569 GCTCTGATGAATAGGATGGAGGG + Intronic
1135657092 16:24259849-24259871 AATCTGATGACCAGCAAAGTTGG - Intronic
1136130148 16:28214995-28215017 AAGCTGATGAATCGGAATGGAGG + Intergenic
1137402904 16:48167658-48167680 GATCTGATGAATACAAAACAGGG + Exonic
1138695357 16:58807937-58807959 AAGCTGATGAAGAGGAAGCAAGG - Intergenic
1143737348 17:8922115-8922137 AGCCTGGAGAATAGGAAAGAAGG + Intronic
1144010432 17:11143267-11143289 AATTTGAAGAAGGGGAAAGAAGG - Intergenic
1144064689 17:11614282-11614304 CTACTGATGAATTGGAAAGAAGG + Intronic
1144365933 17:14544932-14544954 AATCTGATGATCAGAAAAGGAGG - Intergenic
1144419864 17:15086707-15086729 AATCTCATGAATAAGGAGGAGGG + Intergenic
1145365535 17:22262781-22262803 AATCTGCTGAATCAGAAAAAAGG + Intergenic
1146505710 17:33403047-33403069 AATCTGATTATTAGTAGAGATGG - Intronic
1146598159 17:34187217-34187239 AGGGTGAGGAATAGGAAAGAAGG - Intergenic
1146785859 17:35720775-35720797 AGGATGAAGAATAGGAAAGAGGG - Intronic
1147531335 17:41280946-41280968 ACTCTGATATATAGGAAATAAGG - Intergenic
1148794939 17:50192466-50192488 AACCTGGTGAACAGGTAAGAGGG - Exonic
1149508655 17:57217944-57217966 AAATTGATGACTAAGAAAGAAGG - Intergenic
1151070297 17:71202503-71202525 AATCTGAAGAAGAGGAAAAATGG - Intergenic
1151503030 17:74504511-74504533 AGGGTGAGGAATAGGAAAGAAGG - Intergenic
1155563559 18:27107668-27107690 GCACTGATGAAGAGGAAAGATGG + Intronic
1156040903 18:32821788-32821810 AATATTTTGAATAGGAAACATGG - Intergenic
1156524094 18:37750079-37750101 AATCTTTTGATTAGAAAAGAGGG + Intergenic
1157623132 18:49027400-49027422 AGTCTGCTTAATAGGAAACAGGG - Intergenic
1157952861 18:52059685-52059707 AATCTGAAAAACAGTAAAGAGGG + Intergenic
1158293972 18:55973242-55973264 AATCTGGAGGATAGGAAAGTAGG - Intergenic
1158388184 18:57018610-57018632 GATCTGATCAATTAGAAAGATGG + Intronic
1159358016 18:67361231-67361253 ATTCTGGTGAATATGAATGAGGG + Intergenic
1159904900 18:74080985-74081007 AATCTGAAGAAAAAGAAAGAAGG + Intronic
1160440612 18:78888149-78888171 ACTATGATGAATAGGAGTGATGG - Intergenic
1164003767 19:21131142-21131164 AGGGTGAGGAATAGGAAAGATGG + Intergenic
1164186508 19:22874232-22874254 AATCAGTTGAATATGGAAGAGGG - Intergenic
1164223699 19:23222376-23222398 AATCTGACAAATAAGAAAAATGG - Exonic
1165531042 19:36401787-36401809 AGTCTGAGGAATAACAAAGACGG - Intronic
1166498674 19:43325277-43325299 AGGGTGAGGAATAGGAAAGAAGG + Intergenic
1168211869 19:54896661-54896683 AGGGTGAGGAATAGGAAAGAAGG + Intergenic
1168248514 19:55126962-55126984 AGGCTGAGGAACAGGAAAGAAGG - Intergenic
1168455728 19:56507047-56507069 AGTCTGATGAACAGTAAAAAGGG - Intergenic
928353840 2:30589110-30589132 TATCTGATGAACTGGAAAGCAGG - Intronic
929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG + Intergenic
930754351 2:54960126-54960148 ACCCTGATGACTGGGAAAGAGGG + Intronic
930977667 2:57483648-57483670 AATTTGATGTAGAAGAAAGAGGG + Intergenic
931247471 2:60503501-60503523 AATCTAATGGATAGGAGGGAGGG - Intronic
932102103 2:68910203-68910225 AATTTGAAAAATAAGAAAGAGGG + Intergenic
934660438 2:96140744-96140766 AATTTAATAAATAGGAAAGAAGG + Intergenic
935432802 2:102994497-102994519 AAACTGAAGAAAAGCAAAGATGG - Intergenic
936637160 2:114271988-114272010 ATTTTGATGAAAAGGAAAAAGGG - Intergenic
936813324 2:116428937-116428959 AATCTGAAACATAGTAAAGATGG + Intergenic
937510816 2:122593136-122593158 AATCTGATGAATAAGGAATATGG + Intergenic
937594713 2:123659725-123659747 AGGGTGAGGAATAGGAAAGAAGG + Intergenic
938724096 2:134091576-134091598 AATCTGATAAGTAGGAAGCAGGG + Intergenic
939082889 2:137684709-137684731 AAGGTGAGGAACAGGAAAGAAGG + Intergenic
940194585 2:151079759-151079781 AAGCAGATGAATAGGAGAAAGGG + Intergenic
940261581 2:151785425-151785447 AATTTGAGAAATGGGAAAGAAGG + Intergenic
940478552 2:154197961-154197983 AATCTGATGAATATAAAATGGGG - Intronic
941567322 2:167125701-167125723 AAGCTGAACAATAGGAAATATGG + Intronic
941608466 2:167630922-167630944 AATAGGAAGAAAAGGAAAGAAGG - Intergenic
941737822 2:168999143-168999165 CATTTGTTGAATAGCAAAGAAGG + Intronic
942523563 2:176829648-176829670 AATCTGATGAATGCTAAAGTTGG + Intergenic
944251344 2:197582426-197582448 AGGGTGAGGAATAGGAAAGAAGG - Intronic
944478209 2:200128123-200128145 AAACTGCTGAATTGCAAAGAGGG - Intergenic
944966198 2:204936878-204936900 AATTTGATATATAAGAAAGATGG + Intronic
944987655 2:205196117-205196139 TGTCTGATGAATAGGTAAAAGGG - Intronic
945486007 2:210396514-210396536 AGTTGGAAGAATAGGAAAGAGGG - Intergenic
948072084 2:235135825-235135847 AATGTGATGAATTGAAAGGAAGG - Intergenic
948555791 2:238810062-238810084 AATCTTAGAAATAGGGAAGAAGG - Intergenic
1169555304 20:6743281-6743303 ACTCTGAGGAGTAGGGAAGAAGG - Intergenic
1169660222 20:7971014-7971036 AAAATGGAGAATAGGAAAGAAGG + Intergenic
1170680152 20:18519156-18519178 AGGGTGAGGAATAGGAAAGAAGG + Intronic
1174244101 20:49163320-49163342 ATTCTTATGAATAGGAGACAGGG - Intronic
1174685642 20:52452494-52452516 ATTCAGTTGAATAAGAAAGAAGG - Intergenic
1176693682 21:9948699-9948721 GTTCTGATGAATAGAAAAAAAGG - Intergenic
1177840459 21:26229579-26229601 AGGGTGAGGAATAGGAAAGAAGG + Intergenic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1183818521 22:40324432-40324454 AACCTGATCATAAGGAAAGAGGG - Exonic
1184177205 22:42795114-42795136 AATCTGTTGGTGAGGAAAGAGGG - Intergenic
949265384 3:2151265-2151287 AAAATGATGAATAGGAAAATGGG + Intronic
949977420 3:9473669-9473691 AATCAGCTGAACAGGACAGATGG - Intronic
950317039 3:12011608-12011630 ATGCTGCTGAAAAGGAAAGAAGG - Intronic
950506174 3:13396050-13396072 CATCTGATGAATGGGTAAGCGGG + Intronic
950808705 3:15631260-15631282 AATCCTATGATTAGGAAAGGAGG - Intronic
951137334 3:19118732-19118754 AGGCTGATGAACAGCAAAGATGG - Intergenic
952496630 3:33921585-33921607 AATATGATGGATAGCAAAAATGG + Intergenic
953722946 3:45372237-45372259 AAAGTGATGATTAGGAAAGAGGG + Intergenic
953967258 3:47318912-47318934 AACCTGATAAAAAGGAAAAAAGG + Intronic
955001258 3:54929757-54929779 AAACAGATGGATAGGAAGGAGGG - Intronic
956851583 3:73232756-73232778 CATCTGGTGAGTATGAAAGAAGG - Intergenic
957677683 3:83391819-83391841 AACATGATTAATAGGATAGAAGG + Intergenic
957841151 3:85671552-85671574 ACTGCGATGAATTGGAAAGAGGG - Intronic
958255830 3:91323960-91323982 AATTTGAGGAATAGAATAGAGGG + Intergenic
959119722 3:102218868-102218890 AATCTGAAGTATAGGTAAGTAGG - Intronic
960009443 3:112817512-112817534 CAGCTGGTGAATAGGAAACAGGG - Intronic
960619901 3:119627662-119627684 ACTCTGAAAAAGAGGAAAGAAGG - Intronic
961207058 3:125092665-125092687 AAACTGATGAAGGAGAAAGATGG + Intronic
961974683 3:131010743-131010765 AATATGGTGAAGAAGAAAGATGG - Intronic
962093197 3:132266888-132266910 TATCTGAGGAAAAGGAAGGAAGG + Intronic
962254322 3:133860075-133860097 AAGCTGAGGAATAGGCCAGAAGG + Intronic
963468865 3:145714338-145714360 AGTGTGAGGAACAGGAAAGAAGG - Intergenic
963534783 3:146513995-146514017 ATTGTGCTGAATATGAAAGAGGG + Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964660063 3:159110643-159110665 ACAGTGATGAATAAGAAAGACGG - Intronic
965161309 3:165136917-165136939 ATTCCAATCAATAGGAAAGAGGG - Intergenic
965166775 3:165204230-165204252 CATCTGATGAAGAAGAAACATGG - Intergenic
965670848 3:171146377-171146399 AATATGATGTATATAAAAGATGG - Intronic
966246365 3:177812497-177812519 AATTTTATGAAATGGAAAGATGG + Intergenic
966661188 3:182416820-182416842 AATCTGAAGTATTAGAAAGAAGG - Intergenic
966734814 3:183180014-183180036 GAGCTGATGAATAGGAAGGAGGG + Intronic
967230858 3:187336305-187336327 GATCTCAGGACTAGGAAAGAGGG - Intergenic
967470579 3:189857175-189857197 AAATAGATCAATAGGAAAGAGGG + Intronic
967803186 3:193687633-193687655 AATCTGAAGGATCGGAAAGTAGG + Intronic
969983747 4:11185613-11185635 AATTACATGAAAAGGAAAGAAGG - Intergenic
970659885 4:18273390-18273412 AATCTGAGGAATAGATAAAAAGG - Intergenic
970814736 4:20141253-20141275 TCTCTGAAGAAGAGGAAAGAAGG + Intergenic
971100567 4:23462166-23462188 AATATGTTTAAGAGGAAAGAGGG + Intergenic
971553166 4:27979301-27979323 AAGGTGAGGAACAGGAAAGAAGG - Intergenic
972247282 4:37258721-37258743 TATCTGAAGAAGAGGAAATATGG + Intronic
974380981 4:61139571-61139593 GATCTGGTGAAGAGGAAGGAAGG + Intergenic
976185303 4:82437193-82437215 AATGTGAGGGAAAGGAAAGAAGG - Intronic
976839486 4:89414528-89414550 AGTCTGAAAAATAGGAAAGAAGG + Intergenic
976884307 4:89966530-89966552 AGGGTGAGGAATAGGAAAGAAGG + Intergenic
977058534 4:92225180-92225202 CAGCTGTTGAATAGGAAGGAGGG + Intergenic
977150836 4:93509380-93509402 AATCTAATTGATAGGAAACAAGG + Intronic
977176756 4:93828510-93828532 AATCTGACGAATTTAAAAGAAGG + Intergenic
977678674 4:99774715-99774737 AAGCTGAGGAACAGAAAAGATGG - Intergenic
977686501 4:99852716-99852738 AAACTGATTGATAGGAAATAAGG + Intronic
977838050 4:101668673-101668695 AAATTAATGAATAAGAAAGAGGG - Intronic
977882439 4:102220600-102220622 TATCTGAGGAAGTGGAAAGATGG + Intergenic
978624237 4:110666397-110666419 CATTTGATCAATAGAAAAGAAGG + Intergenic
980309783 4:131111552-131111574 ATTCTGAAGAAAAGCAAAGATGG + Intergenic
983644401 4:169975288-169975310 ATTCTGATGAGTAGAAAAGTTGG - Intergenic
984692112 4:182738606-182738628 AATCTCATGAGTTGGAAAGTGGG - Intronic
984738052 4:183129910-183129932 ACTCTGCTGAAGAGAAAAGAGGG - Intronic
984843335 4:184089173-184089195 CATCGGATCAATTGGAAAGAAGG - Exonic
986103643 5:4638260-4638282 CATCTTATGTATAGGTAAGAAGG - Intergenic
986634607 5:9809029-9809051 AAAGGGAAGAATAGGAAAGAAGG - Intergenic
987282250 5:16423661-16423683 AGGGTGAGGAATAGGAAAGAAGG - Intergenic
987795487 5:22622776-22622798 ATTCCGATCAATAGAAAAGAGGG + Intronic
987877941 5:23704873-23704895 AAGCTGAAGATTAGGAATGATGG + Intergenic
988199385 5:28049797-28049819 AGTGTGAGGAACAGGAAAGAAGG - Intergenic
989474981 5:41864462-41864484 AAGCAGATGAATAGAAAAGAGGG - Intronic
990043212 5:51397191-51397213 CATTTGATGAATGGGATAGAGGG - Intergenic
990779895 5:59348734-59348756 AAAATGATAAAGAGGAAAGATGG - Intronic
992538676 5:77739691-77739713 GATTTGATGAATAGTTAAGACGG - Intronic
992756801 5:79914556-79914578 ATTCCAATCAATAGGAAAGAGGG + Intergenic
993040988 5:82814521-82814543 AATCTATTGAGTAGGAATGATGG + Intergenic
993122082 5:83787816-83787838 CATCTCATAAATAGCAAAGAGGG + Intergenic
994671408 5:102765910-102765932 AATGTGACGAATTGGAAATAGGG - Intronic
994775932 5:104035551-104035573 AGGGTGAGGAATAGGAAAGAAGG - Intergenic
994914294 5:105953496-105953518 AAAATAATGAACAGGAAAGACGG + Intergenic
995001862 5:107142431-107142453 AATTTGATCAAGAGAAAAGAAGG - Intergenic
996018070 5:118563080-118563102 AATCTAATGAATAAAACAGAGGG + Intergenic
996470850 5:123858647-123858669 AATCTTGTGAAAAGGATAGATGG - Intergenic
997684008 5:135776034-135776056 AATATCAAGAAGAGGAAAGAAGG + Intergenic
999134477 5:149309288-149309310 AATCATATGAATAGAAAAAAAGG - Intronic
1000284482 5:159815261-159815283 AAAGTGAGAAATAGGAAAGAAGG - Intergenic
1000559173 5:162764669-162764691 AATCCGATCAATGGGAAAGGTGG - Intergenic
1000682949 5:164209525-164209547 ACTCTGGTTAATAGAAAAGAAGG - Intergenic
1000765034 5:165277027-165277049 AATCTGCTGAAGGGGCAAGATGG - Intergenic
1001029857 5:168254411-168254433 AATTTAAAGAAGAGGAAAGAGGG + Intronic
1001295969 5:170499244-170499266 AAACAGATGAAGAGCAAAGATGG + Intronic
1001311126 5:170611745-170611767 AATATGATGATTAGGAAACCAGG - Intronic
1001400553 5:171443973-171443995 GATCTGATGAAGAGGAGAAAAGG - Intronic
1002446649 5:179294388-179294410 AATCCCATGAACAGGGAAGATGG + Intronic
1003294436 6:4811896-4811918 GAGCTGATGAATGGGGAAGAGGG - Intronic
1003341056 6:5221212-5221234 GATCTTATGAATAAGAAAAATGG - Intronic
1003456483 6:6287472-6287494 AATTAGGGGAATAGGAAAGAGGG + Intronic
1003934032 6:10957159-10957181 AAGCTGAAAAAGAGGAAAGAAGG + Intronic
1004545537 6:16594985-16595007 AATTGAATGACTAGGAAAGAAGG - Intronic
1004738015 6:18427710-18427732 AATAACATAAATAGGAAAGAGGG - Intronic
1004981243 6:21027186-21027208 AGACTGATGAACAGCAAAGAGGG - Intronic
1005285811 6:24325714-24325736 AATGTGATGAAGAAGAGAGAGGG - Intronic
1008695637 6:54032935-54032957 AATCTGAGTAATAAGAAAAATGG - Intronic
1008795974 6:55303480-55303502 AAACTGATGAATGGGAAACATGG + Intergenic
1009360490 6:62805054-62805076 AAAATGATGTATAGAAAAGATGG + Intergenic
1010777154 6:79900603-79900625 AATCCCATGAATAGGAAAATCGG + Intergenic
1013134462 6:107267392-107267414 AATATGGTGAAAAGGAGAGATGG + Intronic
1014396325 6:120929113-120929135 AGGGTGAGGAATAGGAAAGAAGG - Intergenic
1015447634 6:133326105-133326127 TATGTGAGGAACAGGAAAGAAGG - Intronic
1015726594 6:136305867-136305889 AATATGATGAATCTGAAAAATGG + Intergenic
1016118591 6:140319115-140319137 AATCTGATGAATAAATATGAAGG + Intergenic
1016637255 6:146306830-146306852 AATCTGAGCAACTGGAAAGATGG + Intronic
1018258174 6:161942923-161942945 AAGATGATGATTAGGGAAGATGG + Intronic
1018346118 6:162900649-162900671 AGCCTGAGGAATAAGAAAGACGG - Intronic
1019033741 6:169036180-169036202 CTTCTGATGAATTGCAAAGAAGG + Intergenic
1019182442 6:170199079-170199101 AATGTGATGAATGGGGAAGTTGG + Intergenic
1019277134 7:181752-181774 AATCTGAGGAAGAGGGGAGAGGG + Intergenic
1020216020 7:6191139-6191161 AAAATGATGACTATGAAAGAAGG + Intronic
1020807784 7:12811724-12811746 TATCTGAAGAAAGGGAAAGAAGG - Intergenic
1021013926 7:15508485-15508507 CATGTTATGAATATGAAAGAGGG - Intronic
1022036942 7:26543428-26543450 AAAAGGATGAATACGAAAGAGGG - Intergenic
1022431818 7:30331318-30331340 AAACAGATGAATAGGAAATATGG + Intronic
1022615177 7:31922197-31922219 AATCTGAAGAATTTGTAAGAGGG - Intronic
1027780319 7:82512364-82512386 AATTTGAAGAATTGGAAGGAAGG + Intergenic
1028441590 7:90869300-90869322 AATCTGAAGGAGATGAAAGAGGG + Intronic
1028655983 7:93207555-93207577 TATCTGAGAAATAGGAAGGAAGG + Intronic
1028657413 7:93225622-93225644 AAACTGATAAATAGGAAGAATGG + Intronic
1030814456 7:114017939-114017961 TAGCTGATGAATAGTTAAGATGG + Intronic
1030944087 7:115694521-115694543 AATCAGATGTAGAGAAAAGAAGG - Intergenic
1031927846 7:127655022-127655044 AGTTTGATGAATAGGAAAACAGG + Intronic
1032225285 7:130026508-130026530 AATCTGCTGACTGAGAAAGATGG + Intronic
1032536331 7:132667727-132667749 AATGTGATGGACAGGAAACAGGG - Intronic
1032898664 7:136281144-136281166 CAACTGATGAATAGAAAAGGTGG - Intergenic
1033254750 7:139790688-139790710 ATTCTGATGGATAAGATAGATGG + Intronic
1033300749 7:140182940-140182962 AATCTGATGAACAGGTTACAGGG - Intergenic
1033625816 7:143108601-143108623 AGTGTGAGGAACAGGAAAGAAGG - Intergenic
1033785840 7:144728659-144728681 AATCTAAGGAATAGCAAAGGAGG + Intronic
1033821967 7:145146017-145146039 GATCTGATGTTAAGGAAAGAAGG + Intergenic
1039761271 8:40578764-40578786 CATCTTATTTATAGGAAAGAAGG + Intronic
1039778556 8:40761010-40761032 AAGCTGAAGAAGAGAAAAGAAGG + Intronic
1040282290 8:46065787-46065809 AAACTGATGAATATAAAAGAAGG - Intergenic
1040327345 8:46357558-46357580 AACCTGCTGAATAAAAAAGAAGG + Intergenic
1040499721 8:47995974-47995996 TATGGGATGAATAGGAAGGATGG + Intergenic
1041455406 8:58053541-58053563 AATCTGGTGTTTTGGAAAGATGG + Intronic
1041892962 8:62891803-62891825 AGTGTGATGAAGAGAAAAGAAGG - Intronic
1043214774 8:77572185-77572207 AACATGATGAAAAGTAAAGAAGG + Intergenic
1043991547 8:86761997-86762019 AATCTGAAGAAAGGGAAAAAGGG - Intergenic
1044343359 8:91072724-91072746 TATCTCATTAATAGAAAAGATGG - Intronic
1044659558 8:94581894-94581916 AATCTGATGAAAAGGTGAGAAGG - Intergenic
1044671506 8:94685711-94685733 AATGGCATGAATATGAAAGATGG + Intronic
1044914835 8:97101886-97101908 AATCTAATGAATAAAAATGAAGG - Intronic
1046183430 8:110682724-110682746 AATGTTATTAATAAGAAAGAGGG - Intergenic
1046754767 8:117962049-117962071 AATCTGAGGCAGTGGAAAGAAGG - Intronic
1047121853 8:121913604-121913626 AATCTGATTAATGGGAAATTGGG - Intergenic
1047578609 8:126186901-126186923 AAGCTGAAGAATAGGCAAAATGG - Intergenic
1048692627 8:136984856-136984878 AATCTGAGGAATTGAAGAGACGG + Intergenic
1049291599 8:141805938-141805960 AATTTGATGACTATGAAAGATGG - Intergenic
1049590642 8:143459784-143459806 AACCTAATAAATAGGATAGAAGG + Intronic
1049921069 9:364843-364865 AATCATATGATTATGAAAGAGGG + Intronic
1049937606 9:514275-514297 ATTGAGATGAATAGGAAGGAAGG - Intronic
1050713091 9:8488036-8488058 AATGTGAAGAAAAAGAAAGATGG + Intronic
1050771264 9:9203606-9203628 AATCTTGGGAATAGGAAAAATGG - Intronic
1050961350 9:11737251-11737273 TATATGATGAAAAAGAAAGATGG + Intergenic
1051581410 9:18680140-18680162 AACCTGATGAGTAAGAGAGAAGG - Intronic
1051836821 9:21348065-21348087 AATATGATAAACATGAAAGAAGG + Intergenic
1052466726 9:28839154-28839176 AGGGTGATGAAAAGGAAAGAAGG - Intergenic
1052571383 9:30228556-30228578 AATCTGTTAAATAGAAAAGCAGG + Intergenic
1053593847 9:39539934-39539956 AATCTGAAGGACAGAAAAGAGGG + Intergenic
1053851635 9:42294987-42295009 AATCTGAAGGACAGAAAAGAGGG + Intergenic
1054572404 9:66825018-66825040 AATCTGAAGGACAGAAAAGAGGG - Intergenic
1054956662 9:70919083-70919105 AATAGGATGAATTGGAAAGAGGG - Intronic
1055265283 9:74488475-74488497 AATCTAAAGAATACAAAAGATGG + Intergenic
1055754332 9:79541737-79541759 CATCTGATAAATAGAAAAGCAGG - Intergenic
1055782029 9:79830648-79830670 ACTCTGAAGAAAAGGAAGGAAGG - Intergenic
1055861882 9:80760915-80760937 AATGTTATCAATAGGAAAAAAGG + Intergenic
1057378246 9:94543750-94543772 AAGGTGAGGAACAGGAAAGAAGG - Intergenic
1057602150 9:96467832-96467854 AATCAGATGATGAAGAAAGAAGG - Intronic
1059032012 9:110708217-110708239 AATTTGATCTCTAGGAAAGAAGG - Intronic
1059574869 9:115477285-115477307 AGGCTGAGGAACAGGAAAGAAGG - Intergenic
1059727142 9:117020123-117020145 TATCCTAGGAATAGGAAAGAGGG + Intronic
1060153999 9:121306260-121306282 TATCTAAGGAATAGGAGAGAGGG - Intronic
1060341262 9:122779070-122779092 AATCTAAAGATGAGGAAAGATGG + Intergenic
1185703467 X:2248970-2248992 AAGCAGATGAATAGGAGAAAAGG - Intronic
1185828405 X:3275155-3275177 ACTATGTTGAATAGGAGAGAGGG - Intronic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1187368511 X:18684413-18684435 AACCTGTCTAATAGGAAAGAAGG + Intronic
1187838997 X:23466232-23466254 AACCTGAAGAAAAGGGAAGAAGG + Intergenic
1188273088 X:28166672-28166694 AATATAATGAATAGAAATGAGGG - Intergenic
1189910387 X:45805036-45805058 TTTCTTATGAAAAGGAAAGATGG + Intergenic
1191105774 X:56771221-56771243 AATCAGAAGAACAAGAAAGAGGG - Intergenic
1191106767 X:56776623-56776645 AATCAGAAGAACAAGAAAGAGGG - Intergenic
1191805524 X:65131290-65131312 AGTGTGAGGAACAGGAAAGAAGG + Intergenic
1191825867 X:65364052-65364074 AGGGTGAGGAATAGGAAAGAAGG - Intergenic
1191976875 X:66882348-66882370 TAGCTGATGAATGGAAAAGATGG + Intergenic
1192683348 X:73277641-73277663 ACTCTGAAGGATAGGAAGGATGG + Intergenic
1193449565 X:81649276-81649298 AATCTTAGGAATTGGAAAGAGGG - Intergenic
1193449902 X:81652921-81652943 AATCTTAGGAATTGGAAAGAAGG - Intergenic
1193477555 X:81985197-81985219 ATTCTGATCAATAAAAAAGAGGG + Intergenic
1194480719 X:94420007-94420029 AATCAACTGAATAGCAAAGAAGG - Intergenic
1195954283 X:110312719-110312741 TATCTTATGGATAGAAAAGAAGG - Intronic
1197274836 X:124466018-124466040 AATCTTATGAATAGTAAGGTGGG + Intronic
1197280717 X:124532673-124532695 AATATGAGGAATAAGAAAGAAGG - Intronic
1197314947 X:124954266-124954288 TAACTGATGAAGGGGAAAGAGGG + Intronic
1199861565 X:151805421-151805443 ACACTGATGAATTGGATAGAAGG + Intergenic
1201357011 Y:13107948-13107970 ATTCTGGTGAATAAAAAAGAAGG - Intergenic