ID: 1090429143

View in Genome Browser
Species Human (GRCh38)
Location 11:126631495-126631517
Sequence TTAGCTCTGCTCAGGACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 145}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090429133_1090429143 4 Left 1090429133 11:126631468-126631490 CCCTCCTCCCCATAAGCCACACT 0: 1
1: 0
2: 4
3: 31
4: 348
Right 1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1090429135_1090429143 0 Left 1090429135 11:126631472-126631494 CCTCCCCATAAGCCACACTTCCA 0: 1
1: 1
2: 1
3: 24
4: 361
Right 1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1090429138_1090429143 -5 Left 1090429138 11:126631477-126631499 CCATAAGCCACACTTCCATTAGC 0: 1
1: 0
2: 2
3: 14
4: 151
Right 1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1090429132_1090429143 8 Left 1090429132 11:126631464-126631486 CCATCCCTCCTCCCCATAAGCCA 0: 1
1: 0
2: 2
3: 121
4: 1640
Right 1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1090429136_1090429143 -3 Left 1090429136 11:126631475-126631497 CCCCATAAGCCACACTTCCATTA 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1090429134_1090429143 3 Left 1090429134 11:126631469-126631491 CCTCCTCCCCATAAGCCACACTT 0: 1
1: 1
2: 1
3: 29
4: 282
Right 1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 145
1090429137_1090429143 -4 Left 1090429137 11:126631476-126631498 CCCATAAGCCACACTTCCATTAG 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090429143 Original CRISPR TTAGCTCTGCTCAGGACAGG TGG Intronic
906409961 1:45570386-45570408 TAGGCACTGGTCAGGACAGGGGG - Intergenic
906521651 1:46470240-46470262 TTAGGACTGCTCAGGACTGCTGG + Intergenic
910367232 1:86478879-86478901 ACAGCACTGCCCAGGACAGGAGG + Intronic
910767195 1:90793486-90793508 TGAGGTCTGCTTAGGAGAGGTGG + Intergenic
911093178 1:94033986-94034008 TTAGCTCTGGCCAGGTCAGTGGG - Intronic
917737263 1:177932594-177932616 TTTCCTCTGCTCAGGACTGGGGG + Intronic
918562094 1:185881065-185881087 TTAGCTCTGCTGTTGACAGATGG + Intronic
920417904 1:205811014-205811036 TTAGCTCTTCCCAGGAAGGGAGG - Exonic
922580371 1:226692884-226692906 TTGGCTCTTGTCAGGAAAGGAGG - Intronic
922844204 1:228670302-228670324 CTAGCTCTGCTGAGGAAAGGGGG - Intergenic
923165227 1:231355297-231355319 TTAGCTCTGCCCAGGACTTCGGG + Intergenic
924594808 1:245435732-245435754 AAGTCTCTGCTCAGGACAGGAGG + Intronic
1062787635 10:278507-278529 TTAGCTGGGCACAGGACTGGTGG - Intronic
1063502276 10:6566181-6566203 TTAGCTTTGCTATGGACAGGAGG - Intronic
1066206980 10:33199145-33199167 TTAGGTCTGGAGAGGACAGGTGG - Intronic
1067535580 10:47107462-47107484 GCAGCTCTGCACAGGACTGGGGG + Intergenic
1069909793 10:71752046-71752068 TGCCCTCAGCTCAGGACAGGTGG - Intronic
1070617181 10:77978091-77978113 TTAGCTGTGCTCAGGGGAAGGGG + Intronic
1075269699 10:121038049-121038071 TCAGCTATGCTCAGGACACTGGG + Intergenic
1079137878 11:17786551-17786573 TGAGTTCAGCTCAGGAGAGGAGG - Intergenic
1084148635 11:67277930-67277952 GGAGCTCAGCTCTGGACAGGGGG + Intronic
1088470993 11:110187454-110187476 TGATCTCTGCTCAGGAAGGGTGG - Intronic
1088884878 11:113998816-113998838 CTAGCTCTGTTGAGGACATGTGG - Intergenic
1089348296 11:117805997-117806019 TTAGCTGAGCGCAGGCCAGGCGG - Intronic
1090029686 11:123195975-123195997 TTAGCTCTGCTCGGGACCTGAGG - Intergenic
1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG + Intronic
1090855613 11:130607484-130607506 ATAGCGGTGCTCAGGGCAGGTGG + Intergenic
1091018112 11:132072684-132072706 TTAGTTTTACTCAAGACAGGAGG + Intronic
1091070059 11:132554553-132554575 TGAGCTTTGCTGAGGACAGTGGG + Intronic
1095327977 12:40921002-40921024 TTAGCTCTTGTCAAGACAGTGGG - Intronic
1096869547 12:54584792-54584814 TTAGCTCTCCCCAGGGGAGGGGG - Intronic
1100700086 12:97138119-97138141 TTAGCTTTGATGAGGAAAGGAGG - Intergenic
1101773219 12:107770852-107770874 TTGGGTCTGCTCATGAAAGGGGG - Intergenic
1104451241 12:128869758-128869780 TGAGCTCTGCACCGAACAGGAGG - Intronic
1105068070 12:133217222-133217244 TGAGCCCTGCTGAGGACAAGAGG + Intergenic
1110602742 13:77394689-77394711 TTAGGTCTGATCAGGACTTGTGG + Intergenic
1111833979 13:93364300-93364322 TCAGCTCTGCTTATGACACGTGG - Intronic
1112065009 13:95783757-95783779 TTAGTTCAGCTAAAGACAGGGGG + Intronic
1112547135 13:100381998-100382020 TTAGCTCTGCTCTCCACAGGCGG + Intronic
1113087054 13:106579620-106579642 ATAGCTCTGCTGAGGACCTGTGG - Intergenic
1113423657 13:110189529-110189551 TTGGATCTACTCAGGAAAGGTGG + Intronic
1113684553 13:112273359-112273381 TGGCCTCTGCTCAGGACAGAGGG - Intergenic
1116187660 14:41618456-41618478 ATTCCTCTGCTGAGGACAGGTGG + Intronic
1120264039 14:82226361-82226383 CTAAATCTGCTCAGGACAGCAGG - Intergenic
1121095299 14:91214243-91214265 TCAATTCTGCTCAGGAGAGGAGG - Intronic
1121115187 14:91338354-91338376 ATAGCCGTGCTCAGGACAAGTGG + Intronic
1122099688 14:99397629-99397651 TTAGCACAGCCCAGGGCAGGAGG + Intergenic
1122540724 14:102496393-102496415 TCTGCTCTTCACAGGACAGGAGG - Intronic
1122913708 14:104846137-104846159 CTGGTTCTGCTCAGGACTGGAGG - Intergenic
1122985487 14:105209759-105209781 AGAGCTATGCTCAGGACGGGTGG + Exonic
1125587098 15:40828676-40828698 GTGGCTCTGCTCAGAACTGGCGG - Exonic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128244404 15:66123357-66123379 CTACATCTGCTCAGGGCAGGGGG + Intronic
1128251281 15:66165849-66165871 TCAGCTCTACTCAGGAATGGAGG + Intronic
1129235081 15:74218939-74218961 TCAGCTCAGCTCAGGACAGGGGG - Intergenic
1129589696 15:76904773-76904795 TTAGCTCTGCCCAGGAAACGGGG - Intronic
1131401319 15:92127918-92127940 ATAGCAGTGTTCAGGACAGGGGG + Intronic
1131714718 15:95095864-95095886 TTGGCTCTACTGAGAACAGGGGG - Intergenic
1132348167 15:101121112-101121134 TGACCCCTGCTCAGGTCAGGAGG - Intergenic
1134039045 16:11053834-11053856 CTGGCTCTGCTCAGGACACTGGG + Intronic
1135280215 16:21147763-21147785 TCTTCTCTGCTCAGGAGAGGTGG - Intronic
1136024321 16:27460318-27460340 TCAGCTCAGCTCAGCACAGCTGG - Intronic
1136290088 16:29266525-29266547 TTGGCTCTTCTCTGGGCAGGAGG - Intergenic
1140189532 16:72803357-72803379 TTACCTGTGCTCAGCACAGCTGG - Intronic
1140243859 16:73230873-73230895 ACAGCTCTTTTCAGGACAGGAGG + Intergenic
1140648824 16:77064737-77064759 TTTGCCTTTCTCAGGACAGGTGG - Intergenic
1142095971 16:88240047-88240069 TTGGCTCTTCTCTGGGCAGGAGG - Intergenic
1142178997 16:88658136-88658158 TCAGCCCTGCTGAGGGCAGGGGG + Intronic
1143357309 17:6339917-6339939 TTAGCCATGCTCAGTACATGGGG - Intergenic
1145771292 17:27495074-27495096 TGAGTTCTGCACAGCACAGGAGG + Intronic
1148321510 17:46758233-46758255 TTGGCTCAGTTTAGGACAGGAGG + Intergenic
1151822789 17:76506238-76506260 CTGGCTGTGCTCAGGACAGATGG + Intergenic
1152242145 17:79166292-79166314 GGAGCTATGCTCAGGAAAGGAGG + Intronic
1153466306 18:5391515-5391537 TATGCTCTGCTCAGGAAATGGGG - Intergenic
1156518483 18:37700971-37700993 TCAGCTATGCTCAGGATAGAAGG - Intergenic
1158335236 18:56409063-56409085 ATGGCTGTCCTCAGGACAGGTGG - Intergenic
1160317652 18:77862592-77862614 TGAGCTCTTCTCCAGACAGGTGG + Intergenic
1162783300 19:13018476-13018498 TTTCCTCTGCTCAGGAAAGGCGG - Intronic
925717176 2:6795148-6795170 TGAGCTCTTCTCAGGCCATGAGG - Intergenic
926108298 2:10166170-10166192 TCAGCTCTGCTCAGGAAATGGGG - Intronic
927934432 2:27068209-27068231 TCAGCTCTACCCAGGACTGGTGG - Intronic
927948305 2:27150458-27150480 TCAGTTCTGCACAGGGCAGGGGG - Intronic
930584068 2:53249000-53249022 TTAGCCATGCTCAGGATGGGAGG + Intergenic
930997594 2:57739612-57739634 GTAGCTGTACTGAGGACAGGAGG + Intergenic
931875378 2:66506439-66506461 TCAAGTCTGCTCAGGACCGGAGG + Intronic
932104692 2:68931939-68931961 GTAGATCTGCTCAGGAAAGAGGG - Intergenic
936733631 2:115413118-115413140 TTAGCTGTGTTCAGGATGGGAGG - Intronic
937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG + Intergenic
938418019 2:131120622-131120644 TTAGCTCTGTCAAGGACATGGGG - Intronic
940986411 2:160056363-160056385 TTAGCTTTGCTCTGGACATTGGG + Intronic
943704485 2:191020648-191020670 TTAGCTCTGCACACGACGGAAGG + Intronic
944821730 2:203439610-203439632 TTGGTTCTGCTCTGGACATGCGG + Exonic
947537838 2:230952133-230952155 TGAGCTCTCATCAGGACATGTGG + Intronic
948668695 2:239552514-239552536 TGGCCTCTGCACAGGACAGGCGG + Intergenic
1168862211 20:1053704-1053726 TTATTTCTCCTCAGCACAGGAGG - Intergenic
1169650743 20:7864626-7864648 CTAGCCCTGCCCAAGACAGGTGG - Intergenic
1169906000 20:10604594-10604616 TTCGCTCTGCTCCGTAAAGGAGG - Intronic
1170735877 20:19013800-19013822 TTAGTTCTCCCCAGGACAGAAGG - Intergenic
1171178725 20:23075451-23075473 TGAGCTCTTCCCAGCACAGGAGG - Intergenic
1173311262 20:41898020-41898042 CTAGCTCTGCAGAGGACAGTGGG - Intergenic
1174176009 20:48645431-48645453 TTAGATCTTCTCAGGTTAGGAGG + Intronic
1175136547 20:56828591-56828613 TTGGCTCTGCTCAGGTCACATGG - Intergenic
1176943776 21:14954634-14954656 CTAGCTTTGCTAAGGAAAGGGGG - Intergenic
1177218916 21:18165533-18165555 TCTGCTCTGCTCAGGGCAGCAGG + Intronic
1177922040 21:27164125-27164147 GTAGCTTTCCTCAGGACAAGGGG + Intergenic
1179610300 21:42545837-42545859 TGGGCTGTGCCCAGGACAGGAGG + Intronic
1180031643 21:45213044-45213066 TTTGCTCTGATGAGGGCAGGGGG + Intronic
1184071750 22:42151277-42151299 TCAGCCCTGCTCAGGCCAAGGGG - Intergenic
1184088250 22:42278899-42278921 TCACCTTTGCTCAGGACATGGGG - Intronic
1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG + Intronic
1185175153 22:49322304-49322326 TGAGCTCTGCTCCGGAGGGGAGG - Intergenic
954199837 3:49017713-49017735 TTACCTCTGCTAATGACGGGAGG - Exonic
959776596 3:110171807-110171829 TTAGCTTAGCCCAGGACAAGGGG - Intergenic
962282286 3:134061067-134061089 AAAACTCAGCTCAGGACAGGAGG + Intergenic
969697504 4:8743036-8743058 TTAGCTCTACTCAGAGGAGGTGG - Intergenic
969906001 4:10396502-10396524 TGATCTCTGCACAGGAAAGGTGG + Intergenic
976382644 4:84417769-84417791 TTATCTCTGCTCAGGAAAAATGG - Intergenic
977558464 4:98508444-98508466 TTAGCTGTGTTGAGGACTGGGGG + Intronic
981000393 4:139823547-139823569 TGGGCTCTGCTCTGGGCAGGAGG + Intronic
982628068 4:157793237-157793259 TTCGCTGTGCTCAGGACTGAAGG - Intergenic
984172716 4:176380501-176380523 TCAGCTCAGCTCTTGACAGGTGG - Intergenic
985817551 5:2137811-2137833 TTTGCGCTCCTCAGGGCAGGCGG + Intergenic
990225260 5:53644292-53644314 TGAGCTCAGCTCAGAACAGAGGG + Intronic
995526376 5:113053607-113053629 CTAGCTCTTCTCTGGGCAGGAGG + Intronic
1000314082 5:160072187-160072209 ATAGCTCTGCACACAACAGGAGG - Intronic
1001402656 5:171454924-171454946 TTGGATCTGATCTGGACAGGGGG - Intronic
1003353048 6:5338463-5338485 TGAACTCTGCTCAGGACTGTGGG - Intronic
1003772033 6:9316367-9316389 TTAGCTTTCCTTAGCACAGGTGG - Intergenic
1007506843 6:42342152-42342174 TCATTTCTGCTCAGGACAGTGGG - Intronic
1011479200 6:87777396-87777418 TTAGCTCGGCTCAGTACCCGAGG + Intergenic
1016220865 6:141668574-141668596 AGATCTCTGCACAGGACAGGTGG - Intergenic
1016832092 6:148444336-148444358 TTAGCTCTGACCAGAAGAGGGGG + Intronic
1016840670 6:148521261-148521283 CTTGATCTGCTCAGGACAGTTGG + Intronic
1016864133 6:148748471-148748493 TTACTTCTGCTAAAGACAGGCGG - Intronic
1017117547 6:150992813-150992835 GTAGCCCTGCTCAAGTCAGGTGG - Intronic
1018300053 6:162392241-162392263 TAAGGTCTGCTCAGGCCAGAGGG + Intronic
1021939556 7:25666153-25666175 TTAGCTGTGCATAGGAAAGGTGG - Intergenic
1022359801 7:29646967-29646989 TCAGCCCTGCTCAGTGCAGGAGG - Intergenic
1023047220 7:36220618-36220640 TTAGCTCTGCTCTAGAGATGAGG - Intronic
1026413581 7:70154632-70154654 TCTGCTCAGTTCAGGACAGGAGG - Intronic
1033037543 7:137888862-137888884 TTAGCTATGCTCTGGGCATGAGG + Intronic
1035039022 7:155914084-155914106 TTCCCCCAGCTCAGGACAGGAGG - Intergenic
1036681104 8:10874976-10874998 TCAGCTCAGATCAGTACAGGCGG + Intergenic
1039163264 8:34646492-34646514 TTAGATCTGCTCATTACATGTGG - Intergenic
1041215458 8:55595957-55595979 TTAGCTCTGCCCTGGCCAGGAGG - Intergenic
1048063277 8:130942832-130942854 TTAGCTCTGATCAAGACAGCTGG + Intronic
1048985291 8:139731705-139731727 GGAGCTGTGCCCAGGACAGGGGG - Intronic
1049365895 8:142236706-142236728 TCAGCTCTGCTCAGGGAGGGTGG - Intronic
1050550274 9:6743191-6743213 TTAGCTCTACTTAAGACAAGAGG - Intronic
1050935849 9:11393539-11393561 TTAGCTCTGCCCTTGACACGTGG - Intergenic
1056401222 9:86229357-86229379 GTAGCTCTTCCCAGGGCAGGTGG - Intronic
1056456666 9:86766984-86767006 TTGGCTCTGCCCACGAAAGGAGG + Intergenic
1058054829 9:100438966-100438988 TTAGCTTTGCTCAGGATCTGAGG + Intronic
1061594194 9:131618388-131618410 TTGTCACTGCTTAGGACAGGGGG - Intronic
1062322455 9:135997092-135997114 CGGGCTTTGCTCAGGACAGGCGG - Intergenic
1192232387 X:69274489-69274511 TTACCTCTTCTCAGAACGGGAGG + Intergenic
1194717566 X:97305109-97305131 TCAGCTCAGCTTAGGACAGATGG - Intronic
1199082815 X:143595402-143595424 AGAACTCTGCTCAGGACAGCAGG - Intergenic