ID: 1090430218

View in Genome Browser
Species Human (GRCh38)
Location 11:126639718-126639740
Sequence CACTTTCCAACTCATCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090430214_1090430218 -10 Left 1090430214 11:126639705-126639727 CCCATCAATCACCCACTTTCCAA 0: 1
1: 0
2: 2
3: 18
4: 196
Right 1090430218 11:126639718-126639740 CACTTTCCAACTCATCTGTCTGG 0: 1
1: 0
2: 2
3: 24
4: 163
1090430211_1090430218 21 Left 1090430211 11:126639674-126639696 CCTGGTGTTGATTTTGTTCAAAT 0: 1
1: 0
2: 3
3: 16
4: 274
Right 1090430218 11:126639718-126639740 CACTTTCCAACTCATCTGTCTGG 0: 1
1: 0
2: 2
3: 24
4: 163
1090430210_1090430218 22 Left 1090430210 11:126639673-126639695 CCCTGGTGTTGATTTTGTTCAAA 0: 1
1: 0
2: 2
3: 16
4: 306
Right 1090430218 11:126639718-126639740 CACTTTCCAACTCATCTGTCTGG 0: 1
1: 0
2: 2
3: 24
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090430218 Original CRISPR CACTTTCCAACTCATCTGTC TGG Intronic
901440194 1:9273077-9273099 CATCTTCCCACTCACCTGTCGGG + Intergenic
901671195 1:10857193-10857215 CAGTTTCCCCCTCAGCTGTCAGG - Intergenic
904772334 1:32887079-32887101 CCCTTTCCCACTCACTTGTCCGG + Intronic
906799689 1:48725596-48725618 CAATTTTCCACTCATCTTTCAGG + Intronic
909361405 1:74763643-74763665 CACTTTCCAACCCAAATGTAGGG - Intronic
913347927 1:117826649-117826671 AGCTTTCCAACAGATCTGTCAGG - Intergenic
914937414 1:151993399-151993421 TACTTTCCCACTCGTCTCTCGGG - Intronic
918256708 1:182754987-182755009 CACTCTCCCACTCATTTATCTGG - Intergenic
920950158 1:210565031-210565053 CTCTATCCAACTTATCTGACTGG - Intronic
921494159 1:215816536-215816558 CATTTACAAACTCCTCTGTCTGG + Intronic
921815093 1:219554485-219554507 GTCTTTTCAACTCACCTGTCAGG - Intergenic
922609944 1:226918998-226919020 CACAATCCAACACAACTGTCGGG - Intronic
924498842 1:244616717-244616739 CACTTTCCATCTCAACTTTTGGG + Intronic
1064979542 10:21152215-21152237 CTCTTTCGTGCTCATCTGTCTGG + Intronic
1065895608 10:30160842-30160864 GACTTTCCAACTCTTCTGGGAGG - Intergenic
1066071745 10:31822724-31822746 CCCTTTCCAAGTCATCTGTTGGG + Intronic
1068052494 10:51968170-51968192 CAGATTCCAACTCATGGGTCTGG - Intronic
1071795851 10:89004750-89004772 TAATTTCCAACTGATCTGGCTGG + Intronic
1072922630 10:99589274-99589296 CCCTTTTCACGTCATCTGTCTGG - Intergenic
1074331032 10:112509630-112509652 AATTTTCCAACTCCTCTGACAGG - Intronic
1078437620 11:11338511-11338533 CATTTTCAAACTCATATGTCTGG + Intronic
1079170016 11:18084553-18084575 CACTTTCCATTCCCTCTGTCTGG + Intronic
1079219080 11:18543299-18543321 CACTTTCCAGCTCTTCGATCGGG + Intronic
1080367654 11:31595266-31595288 CATTTTCAAACTCATCTATCTGG + Intronic
1080526069 11:33120464-33120486 CACTTTCCCTCCCATCTCTCAGG + Intronic
1081384946 11:42460586-42460608 CACTTTCCCACTCCTCTGCCTGG - Intergenic
1083700583 11:64475202-64475224 CTCTTTCCCACACATGTGTCAGG - Intergenic
1084503665 11:69552406-69552428 CACTTTCTAAGTCCTCTGGCAGG + Intergenic
1086662497 11:89437508-89437530 CACTTCCCAGGTCATCAGTCTGG - Intronic
1087814997 11:102648616-102648638 CCCCTTCCAACTCATCCATCGGG + Intergenic
1090430218 11:126639718-126639740 CACTTTCCAACTCATCTGTCTGG + Intronic
1090891871 11:130931022-130931044 CACATTCCCACTCTTCTGTTTGG - Intergenic
1092712853 12:11355743-11355765 TCCTATCCAACTCATCTCTCTGG - Intronic
1092716648 12:11395719-11395741 TCCTATCCAACTCATCTCTCTGG - Intronic
1093067442 12:14673003-14673025 CATGATCCAACTTATCTGTCAGG - Intronic
1093966340 12:25331123-25331145 CACTTTCCAACTATGCTGTCAGG - Intergenic
1096626929 12:52901643-52901665 CCCTTTCAATCTCAACTGTCTGG - Intronic
1098905728 12:76160261-76160283 CACTTTCCAAATCCTCTTCCAGG - Intergenic
1099302825 12:80919321-80919343 CACTTTCCAACTCCTCTTAGAGG - Intronic
1100534174 12:95491125-95491147 CAGTTTCCAAGTAATCTGTGGGG + Intronic
1102954733 12:117052203-117052225 AACTTTCCAATTCTTCTGTAAGG + Intronic
1107265356 13:38546680-38546702 CAGTTTCCAACTCAACATTCAGG - Intergenic
1107724280 13:43282375-43282397 CACTTTCCAACTAATTCGTAAGG - Intronic
1108120039 13:47175638-47175660 CACTTACCACTTCCTCTGTCTGG - Intergenic
1108945278 13:56015140-56015162 TACTTTCCAACACATTTGTAAGG + Intergenic
1109051264 13:57484528-57484550 CACTTCCCAACTCATTTTTAGGG + Intergenic
1109382971 13:61589073-61589095 CACTTCCCAACTCAGCTGCAGGG + Intergenic
1109552863 13:63927803-63927825 TACTTTCCAATTCATGTGTTTGG + Intergenic
1110256060 13:73435139-73435161 CACTTTTCAACTCATATAACTGG + Intergenic
1111744280 13:92246544-92246566 CTCTTTCCAAGTCTTCTGTATGG - Intronic
1112896282 13:104304207-104304229 CACTTTCTTACTCATATGGCAGG - Intergenic
1115082373 14:29471488-29471510 CACTTTCCAATTCTTCTATGTGG - Intergenic
1115123391 14:29964467-29964489 CAATTTCCTTCTCATCTGGCTGG + Intronic
1116322458 14:43487220-43487242 CACTTCCCAACTCACCTATAAGG - Intergenic
1116589623 14:46755082-46755104 CACTTCCCAACTCATGTGAAGGG + Intergenic
1118319344 14:64743899-64743921 CAATTTCCCACTCACCTGTGAGG + Exonic
1120097846 14:80409032-80409054 CACTTTCCCACGCAACTCTCAGG - Intergenic
1120702467 14:87713108-87713130 CACTTTCCATTCCATCTGGCTGG + Intergenic
1126859929 15:52873631-52873653 CACTTGCCAACTCATGGGACTGG - Intergenic
1127695220 15:61440173-61440195 CACTTTCCAAACCATCATTCCGG + Intergenic
1130164216 15:81436434-81436456 CACCGTCAACCTCATCTGTCTGG - Intergenic
1136334604 16:29603208-29603230 CACTTGCCCCCTCACCTGTCAGG + Intergenic
1136546695 16:30958505-30958527 CACCTCCCAACTCTACTGTCAGG - Intronic
1136625653 16:31460375-31460397 CACCTTCCAGCTCATCAGTGGGG - Intronic
1136687933 16:32006664-32006686 CACTTTCCAACTCATTTATGAGG + Intergenic
1136788533 16:32950218-32950240 CACTTTCCAACTCATTTATGAGG + Intergenic
1136881279 16:33903716-33903738 CACTTTCCAACTCATTTATGAGG - Intergenic
1141014270 16:80433713-80433735 CACTTTCTATCTCTTCTCTCAGG - Intergenic
1141808051 16:86354968-86354990 CACTGTCCAAGTGATCAGTCAGG + Intergenic
1203090732 16_KI270728v1_random:1211709-1211731 CACTTTCCAACTCATTTATGAGG + Intergenic
1146230211 17:31100928-31100950 CACTTTCCACCTTATCTGTCTGG + Intronic
1147148918 17:38502339-38502361 CACTTTCCAACTCATTTATGAGG + Intronic
1147760607 17:42795358-42795380 CACTCTCCACCTCAGCTGTGTGG - Exonic
1149695311 17:58611769-58611791 CACTTTCTGTCTCATCTGACTGG - Intronic
1151483533 17:74384414-74384436 GACTTTCCACCTCATATTTCTGG + Intergenic
1152276936 17:79363443-79363465 GACTTCCAAACTCTTCTGTCTGG + Intronic
1154068159 18:11128753-11128775 CACTTTCAACCTCATCTTTAGGG - Intronic
1155626087 18:27836087-27836109 CATCTTCCAACTCCTCTGACAGG + Intergenic
1156571652 18:38261842-38261864 CACTTTCCAACTCATTAATGAGG - Intergenic
1156680786 18:39585979-39586001 CCCTTTCCCACTCCTGTGTCTGG + Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1159030320 18:63224109-63224131 CAATTTCCAACCCATCTATTGGG - Intronic
1162915536 19:13872824-13872846 CACGTTCCCACCCCTCTGTCTGG - Intronic
1163764188 19:19153296-19153318 CACTTTCTATCTCAGCTCTCAGG - Intronic
1165205836 19:34184894-34184916 CTAATTCTAACTCATCTGTCAGG - Intronic
926809669 2:16745280-16745302 AACTTTCCAACCCCTCTCTCTGG - Intergenic
928216959 2:29369778-29369800 CATTTTCCATCTCAACTGTTTGG - Intronic
928738151 2:34317033-34317055 CAGTTTCCAATTCATCAGTAAGG - Intergenic
932490893 2:72119587-72119609 CACTTTCCAACTAAACTTCCAGG - Intergenic
934973848 2:98786515-98786537 CACTTACCATCTCATCTGTAAGG - Intergenic
936890251 2:117360726-117360748 CACTTTCCCACTGACCTGGCAGG + Intergenic
940909344 2:159196473-159196495 CACATTCCAACTTGTCTTTCTGG - Intronic
942435541 2:175970207-175970229 CTCTTTCCAACACATCTGAAGGG + Intronic
943397679 2:187360737-187360759 CACTTTGCAACTAACCTGTGAGG + Exonic
943687328 2:190832078-190832100 CACTTTCAAACCCAGCTGTTTGG + Intergenic
944709464 2:202322837-202322859 GACTTTCCAACTCAGAGGTCAGG + Intergenic
946317309 2:218925213-218925235 CACCTTCCATCTCTTCTTTCTGG - Intergenic
1169578605 20:6994010-6994032 TACTTTCAAACTCAGCTGTCTGG + Intergenic
1171771594 20:29326563-29326585 GAGTTTCCAACACATCTGGCTGG + Intergenic
1173817253 20:45997768-45997790 CAATTTCCAAATCACCTGTATGG - Intergenic
1174003016 20:47388515-47388537 CACTTTTCCACTCAGCAGTCAGG + Intergenic
1174717551 20:52776108-52776130 TATTTTCCAAACCATCTGTCTGG + Intergenic
1175567303 20:59990512-59990534 CACTTCTCAACTTATCTGTTGGG + Intronic
1179489791 21:41733959-41733981 CACTTTCCAGCTCTTCTTTGGGG + Intergenic
1182654655 22:31880367-31880389 CACATTTCAACCCATCAGTCAGG - Intronic
1183260012 22:36788527-36788549 CAGTTTGCTACTCATGTGTCTGG + Intergenic
1183429103 22:37755097-37755119 CACCATCCAGCTCATCTGCCTGG - Exonic
949584526 3:5424939-5424961 CACCTCCCCACCCATCTGTCTGG + Intergenic
953265356 3:41381577-41381599 TAGTCTCCAACTAATCTGTCAGG + Intronic
955896677 3:63707748-63707770 CATTTTCCAAGTGAACTGTCAGG - Intergenic
956449232 3:69356809-69356831 CTCTCTCCAACTCTTCTGTCTGG - Intronic
959036318 3:101369282-101369304 CAATTTTCAATTCATCTGACTGG + Intronic
961813287 3:129533975-129533997 CTCCTCCCAACTCATCTTTCAGG + Exonic
963583212 3:147153009-147153031 CATTTCCCAACTCTTCTGTGAGG - Intergenic
965123803 3:164597757-164597779 AACTTTCCAACTAATTTGTCAGG - Intergenic
965430341 3:168579165-168579187 CACTTTCCTAATCAGCTGTCAGG - Intergenic
966448363 3:180029568-180029590 CTCTTTCCAGCTCTTCTTTCAGG + Intronic
973013033 4:45101243-45101265 GGCTTTGCACCTCATCTGTCTGG - Intergenic
975482464 4:74896547-74896569 CACTTTCCCACTTCTTTGTCTGG - Intergenic
976163311 4:82227295-82227317 TACTCTCCACCTCATCTGTAAGG + Intergenic
976818133 4:89174328-89174350 CACTCTCCAACTCTGCTCTCTGG + Intergenic
979427462 4:120585403-120585425 AACTCTCCAAGTCATCAGTCTGG + Intergenic
979533843 4:121797602-121797624 AACTTTCCAAATCTTCTGTAAGG - Intergenic
980466449 4:133190333-133190355 CACATTTCAACTCATTTCTCAGG - Exonic
983784193 4:171711793-171711815 CACTTTCCAAATCATTTGACAGG - Intergenic
987435639 5:17890672-17890694 CACTTCCCAACTCTTCCATCTGG - Intergenic
989490756 5:42049557-42049579 CACTTTCCAACTTTTCTTTTAGG - Intergenic
990183989 5:53193037-53193059 CACTTTTCTACTAATTTGTCAGG - Intergenic
991981020 5:72230821-72230843 CAGTTTCTGACTCATATGTCTGG - Intronic
993017802 5:82555284-82555306 CACTTTCAAACTCATTTTTGAGG - Intergenic
994597079 5:101853097-101853119 CACTTCCAAACTCATCTGTGAGG + Intergenic
996264527 5:121521655-121521677 TAGTTTCCTACTCAGCTGTCTGG - Intergenic
997288875 5:132709173-132709195 CACTTTCTAATTCCTCTGTATGG - Intronic
999509085 5:152228755-152228777 CAGTTTAGAATTCATCTGTCTGG + Intergenic
1000726198 5:164774072-164774094 CACTTTCCAACTTACTTGCCTGG - Intergenic
1004438397 6:15620823-15620845 CACATTGCATCTCATCTGGCAGG - Intronic
1006081711 6:31571801-31571823 GACTTTCCAGCCCATCTGGCAGG - Intergenic
1006834211 6:36986695-36986717 CATTTTCCATCTCCTCTGCCAGG + Intergenic
1007270831 6:40635680-40635702 CTCTTGCCAACTCTTCTGTGAGG + Intergenic
1007812857 6:44498508-44498530 CAAGTTCCCACTCACCTGTCTGG + Intergenic
1008249348 6:49219647-49219669 CACTTTCCAACTCATTTATGAGG + Intergenic
1008387702 6:50912973-50912995 CACTATCCCAGTCATCAGTCTGG + Intergenic
1009038114 6:58142814-58142836 TCCTTTCCTACTCATCTTTCAGG + Intergenic
1016428793 6:143961637-143961659 CACTTTACAAATCATCTTTATGG + Intronic
1018429382 6:163711661-163711683 AGCTTTCCAAGTCATCTGTTTGG + Intergenic
1022946304 7:35288083-35288105 CCAATTACAACTCATCTGTCTGG - Intergenic
1024933908 7:54692089-54692111 CATTTGCTAACTCATCTATCAGG - Intergenic
1027986925 7:85304886-85304908 TCCTTTCCTACTCAGCTGTCAGG + Intergenic
1029262319 7:99311711-99311733 CACGTTCCACCTCATCTCCCAGG + Intergenic
1029898107 7:104007774-104007796 GACTTTCCTCCTCATCTGCCTGG + Intergenic
1030282803 7:107794290-107794312 AACTTTCCAACTCTCCTTTCTGG - Intronic
1031020312 7:116620616-116620638 CACTTTCCAGCCCTTCTGGCTGG - Intergenic
1034214545 7:149395016-149395038 CACTTCCCAACCCCACTGTCTGG + Intergenic
1034754147 7:153598779-153598801 TCTTTTCCAACTCATATGTCAGG + Intergenic
1036574083 8:10008828-10008850 CACTTCCCAACTTATCTATGAGG - Intergenic
1036945399 8:13090159-13090181 CTTTTGCCAACTAATCTGTCTGG - Intronic
1037866753 8:22450247-22450269 CACTTTCCACATCAACTGTCTGG - Intronic
1038399718 8:27274334-27274356 CACCTTCTTACTCCTCTGTCCGG + Intergenic
1039460710 8:37741780-37741802 CATTCTTCACCTCATCTGTCTGG - Exonic
1040700714 8:50061056-50061078 CATTTTCCAACTCATTTTTAAGG - Intronic
1041322419 8:56626934-56626956 CACTTTCCATCTCCTTTCTCTGG + Intergenic
1042970947 8:74408504-74408526 CCCTTTCCAACTAGTCTTTCAGG + Intronic
1043313348 8:78889808-78889830 TTTTTTCCAACTCATCTGACTGG - Intergenic
1043886073 8:85602299-85602321 CACTTTGCACCTCAAGTGTCTGG + Intergenic
1046528150 8:115407935-115407957 CTCTTTCAAAGTCATCTTTCAGG + Intergenic
1046601714 8:116324914-116324936 CACTTTGCAACTGGTCTGGCAGG - Intergenic
1046753982 8:117954719-117954741 CACCATCCAACTCATATGTGGGG + Intronic
1048444200 8:134481205-134481227 CCCTTTCCCAGTCTTCTGTCAGG - Intronic
1048462550 8:134634507-134634529 CACTTTCCAACCCAGCAATCTGG + Intronic
1052138524 9:24946875-24946897 CACTTTCTAACTCTTCTGAGTGG - Intergenic
1054705992 9:68462569-68462591 CCCTTTCCAATTAATCAGTCAGG - Intronic
1054725858 9:68649372-68649394 CACCTTCCAAATCATCAGTAGGG - Intergenic
1055756673 9:79565553-79565575 CACTATCCAACTCACCTGCCTGG - Intergenic
1057467320 9:95326932-95326954 CACTCTCCAACTCATCTTTCAGG - Intergenic
1058260365 9:102821397-102821419 CTCTTTCCAACTCAGTTTTCAGG - Intergenic
1059425061 9:114215864-114215886 CACTGTCCCACTCACCTGGCAGG - Intronic
1060936158 9:127517379-127517401 CAGGTCCCAACTCATCTGCCTGG + Intronic
1061294253 9:129668174-129668196 CAGTTTCCAACTCATCCATCTGG + Intronic
1187675739 X:21714686-21714708 CACTTTCCTATTCATCTTTGTGG + Intronic
1188094372 X:26003545-26003567 AACTTTCCTGCTCACCTGTCAGG + Intergenic
1189987754 X:46569253-46569275 CCCCTTGCAATTCATCTGTCTGG + Intergenic
1190849877 X:54228711-54228733 TACTTTCCAACTCATTTATAAGG + Exonic
1193629361 X:83863273-83863295 CACTCTCCAACTGATATGTCAGG + Intronic
1196716757 X:118819493-118819515 CACGTTCTCACTCATCTGTGGGG - Intergenic
1197514338 X:127406223-127406245 CACTTTCCAAAACATCTTTCAGG + Intergenic
1198236643 X:134741833-134741855 CACGTTCAAAATCATCTGCCTGG - Intronic
1198795843 X:140393246-140393268 CAGCTTCCAGCTCATGTGTCTGG - Intergenic
1199522090 X:148747556-148747578 CACTTTCCAAATAATCTGCCTGG + Intronic
1199700966 X:150375260-150375282 CACCTTCCAAGTTCTCTGTCTGG + Intronic
1199770651 X:150973279-150973301 CACTCTCCCACACATCTGCCAGG - Intergenic