ID: 1090433013

View in Genome Browser
Species Human (GRCh38)
Location 11:126662512-126662534
Sequence CATATAAGGATGCAGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2347
Summary {0: 3, 1: 13, 2: 135, 3: 535, 4: 1661}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090433013_1090433017 -9 Left 1090433013 11:126662512-126662534 CCTTCTTGCTGCATCCTTATATG 0: 3
1: 13
2: 135
3: 535
4: 1661
Right 1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 18
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090433013 Original CRISPR CATATAAGGATGCAGCAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr