ID: 1090433017

View in Genome Browser
Species Human (GRCh38)
Location 11:126662526-126662548
Sequence CCTTATATGCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090433013_1090433017 -9 Left 1090433013 11:126662512-126662534 CCTTCTTGCTGCATCCTTATATG 0: 3
1: 13
2: 135
3: 535
4: 1661
Right 1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 18
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090433017 Original CRISPR CCTTATATGCAGAAGGTGGA AGG Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
920334433 1:205235141-205235163 CCTTATATGAAGCAGGCAGAGGG + Intronic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
923897471 1:238288095-238288117 CCTTGTCTGCAGAAGTTGTAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
1068487750 10:57681283-57681305 CTTTATATTCATAAGGTGGCAGG + Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1073885660 10:108036880-108036902 CCTTATATGAATAAGGCAGAGGG - Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1082644469 11:55704483-55704505 TCTTATAGGCAGAAGATAGATGG - Intergenic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098609925 12:72444025-72444047 CTTTATATGCAAAAAGAGGAAGG - Intronic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1107642097 13:42454002-42454024 CCTTGAATCCAGGAGGTGGAGGG - Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1110439967 13:75516880-75516902 CCATAGTGGCAGAAGGTGGAAGG - Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1114054880 14:18959254-18959276 CCTGATATCCAGAAGTTTGATGG + Intergenic
1114107661 14:19442523-19442545 CCTGATATCCAGAAGTTTGATGG - Intergenic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1116519244 14:45830372-45830394 CCTTATATCCAGAAAATAGAGGG + Intergenic
1120194047 14:81463876-81463898 CCTTATATGGGAAAGGTGGAGGG - Intergenic
1120453797 14:84705260-84705282 GATTATATGAGGAAGGTGGAAGG + Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1137801422 16:51265652-51265674 CCTTATAAGAGAAAGGTGGAGGG - Intergenic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1144335699 17:14267302-14267324 CCTTATATGAGAAAGGTAGAGGG - Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1147265961 17:39234857-39234879 CGTTTTACCCAGAAGGTGGAGGG + Intergenic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1151138929 17:71973308-71973330 CCTTATTTGCAGAAAGTGTGTGG + Intergenic
1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG + Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1155234306 18:23804165-23804187 GCTTATATGTAGACGGTGGCAGG + Intronic
1155702100 18:28758921-28758943 TCTTATATGAAGGAGTTGGATGG + Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158140443 18:54249977-54249999 CCAAGTATGCAGAATGTGGAAGG - Intergenic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
926398273 2:12468174-12468196 CCTTCTATCCAGAAGGTGCTAGG + Intergenic
926839248 2:17060256-17060278 CTTTCTATTGAGAAGGTGGATGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
940176089 2:150878939-150878961 CCATATATGCAGAGTGGGGAGGG + Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940588474 2:155687165-155687187 CCCTATATGTAGGAGTTGGATGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942317310 2:174707956-174707978 TCTAATATCCAGAAGGTGAAAGG - Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1176718517 21:10374610-10374632 CCTTACATGGTAAAGGTGGAAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1180473363 22:15681804-15681826 CCTGATATCCAGAAGTTTGATGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG + Intergenic
1183114834 22:35683388-35683410 CCTTATATGCAGATTGGAGAAGG + Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956440945 3:69279811-69279833 CCTTTTCTGCAGAAGTGGGAAGG - Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977269856 4:94903751-94903773 CCTTATAAGAAGAAGGTGTTAGG + Intronic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981663427 4:147194499-147194521 TCTTATTTGCTGAACGTGGATGG - Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983961730 4:173762475-173762497 ACTTATATCCTGAAGGTGGGGGG + Intergenic
986675048 5:10176861-10176883 CCCTAAATGTGGAAGGTGGAGGG + Intergenic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
990350935 5:54915375-54915397 GTTTATATGCAGAAGGTTAAAGG - Intergenic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
997684841 5:135781305-135781327 CGTAATATGCAGAAGGGGTAGGG + Intergenic
999052051 5:148533518-148533540 CCTTAATTGCAGAAGGAGCACGG - Intronic
1001671653 5:173478692-173478714 CCCTAGATGCAAAAGATGGAAGG - Intergenic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1008358203 6:50581179-50581201 TCTTCTATGCAGAAAGTGAATGG - Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1017395123 6:153990006-153990028 CTATATAGGCAGAAGGTTGAAGG - Intergenic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1024352207 7:48377976-48377998 CCTTAGATGCTGATGGTTGAGGG - Intronic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1024945288 7:54801895-54801917 ATTTATATACAGGAGGTGGATGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1027545071 7:79517365-79517387 CCTTATATCAAGAAGGTGAAGGG - Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030754514 7:113271819-113271841 TCTTGTAGGCAGCAGGTGGATGG - Intergenic
1031723640 7:125208815-125208837 CCGTATATTCAGAAGGTTGGGGG + Intergenic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1036783669 8:11670639-11670661 CCTCATACACACAAGGTGGATGG + Intergenic
1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038792651 8:30682011-30682033 CCTTATATTCAAAAAGTCGATGG + Exonic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1055984042 9:82037392-82037414 CCATTTATGCAGAAGTGGGAAGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059295164 9:113263936-113263958 CCTTATAAGGAGCAGGCGGAGGG + Exonic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1186187417 X:7035132-7035154 ACTTCTATACAGAAGGTGGGTGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1190077624 X:47329402-47329424 ACTTAAATACAGAAGGTGGCAGG + Intergenic
1191841548 X:65516849-65516871 CCTTGTATGGACAGGGTGGAAGG - Intronic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198790240 X:140337366-140337388 CCTTATTTGCTGAAGGTGAAGGG + Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1201389039 Y:13477352-13477374 CATTCTTTGGAGAAGGTGGAAGG - Intronic