ID: 1090434231

View in Genome Browser
Species Human (GRCh38)
Location 11:126673558-126673580
Sequence GTGAAAACACAGATGAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 431}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090434231_1090434234 -1 Left 1090434231 11:126673558-126673580 CCAAAATTCATCTGTGTTTTCAC 0: 1
1: 0
2: 2
3: 37
4: 431
Right 1090434234 11:126673580-126673602 CTCACCACCACAGTCAGGGCTGG 0: 1
1: 0
2: 2
3: 26
4: 304
1090434231_1090434238 6 Left 1090434231 11:126673558-126673580 CCAAAATTCATCTGTGTTTTCAC 0: 1
1: 0
2: 2
3: 37
4: 431
Right 1090434238 11:126673587-126673609 CCACAGTCAGGGCTGGCACAGGG 0: 1
1: 0
2: 12
3: 40
4: 316
1090434231_1090434232 -6 Left 1090434231 11:126673558-126673580 CCAAAATTCATCTGTGTTTTCAC 0: 1
1: 0
2: 2
3: 37
4: 431
Right 1090434232 11:126673575-126673597 TTTCACTCACCACCACAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 134
1090434231_1090434233 -5 Left 1090434231 11:126673558-126673580 CCAAAATTCATCTGTGTTTTCAC 0: 1
1: 0
2: 2
3: 37
4: 431
Right 1090434233 11:126673576-126673598 TTCACTCACCACCACAGTCAGGG 0: 1
1: 0
2: 0
3: 15
4: 209
1090434231_1090434236 5 Left 1090434231 11:126673558-126673580 CCAAAATTCATCTGTGTTTTCAC 0: 1
1: 0
2: 2
3: 37
4: 431
Right 1090434236 11:126673586-126673608 ACCACAGTCAGGGCTGGCACAGG 0: 1
1: 0
2: 3
3: 36
4: 243
1090434231_1090434240 12 Left 1090434231 11:126673558-126673580 CCAAAATTCATCTGTGTTTTCAC 0: 1
1: 0
2: 2
3: 37
4: 431
Right 1090434240 11:126673593-126673615 TCAGGGCTGGCACAGGGACTGGG 0: 1
1: 0
2: 1
3: 38
4: 436
1090434231_1090434241 13 Left 1090434231 11:126673558-126673580 CCAAAATTCATCTGTGTTTTCAC 0: 1
1: 0
2: 2
3: 37
4: 431
Right 1090434241 11:126673594-126673616 CAGGGCTGGCACAGGGACTGGGG 0: 1
1: 0
2: 8
3: 83
4: 627
1090434231_1090434239 11 Left 1090434231 11:126673558-126673580 CCAAAATTCATCTGTGTTTTCAC 0: 1
1: 0
2: 2
3: 37
4: 431
Right 1090434239 11:126673592-126673614 GTCAGGGCTGGCACAGGGACTGG 0: 1
1: 0
2: 7
3: 91
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090434231 Original CRISPR GTGAAAACACAGATGAATTT TGG (reversed) Intronic
900421089 1:2556264-2556286 GGGGAAACACAGATGGACTTTGG + Intronic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
901271887 1:7958519-7958541 TTAAAAACACTGATGTATTTAGG + Intronic
902246745 1:15125726-15125748 TTAAAAAAACAGAAGAATTTAGG - Intergenic
904101910 1:28037575-28037597 GTGAAAACACATTTGAGCTTTGG - Intronic
904229718 1:29058401-29058423 TGGTAAACACAGATGACTTTTGG + Intronic
904791934 1:33029176-33029198 GTGAGAAGACTGGTGAATTTGGG - Intronic
905378118 1:37538872-37538894 CTGAAAATATAGATGAAGTTTGG - Intronic
905553718 1:38864720-38864742 GGGCAAAGACAGAGGAATTTAGG + Intronic
905574672 1:39034311-39034333 CTGGAAAAACAGATCAATTTTGG - Intronic
908985461 1:70013664-70013686 GTGGAAACAAAGATGAATTGAGG - Intronic
909044434 1:70691693-70691715 GTGAAATCACAGAGGAAATGGGG + Intergenic
909722369 1:78790263-78790285 GAGAAAAAGCAGATGAATTCTGG - Intergenic
909966011 1:81911523-81911545 GTGAAAAAACAGTTAAAATTTGG - Intronic
910548642 1:88450372-88450394 GAGAGAAGACAGATGAATTAGGG - Intergenic
911559508 1:99387107-99387129 GTGTAAACACAGTTGAATGGAGG - Intergenic
911982018 1:104580139-104580161 TTGAGAAGACAGATGAATGTTGG - Intergenic
912479436 1:109969156-109969178 GAGAAAATACAGATAACTTTGGG + Intergenic
913083938 1:115416672-115416694 GTAAAAACACTAATGAAATTTGG - Intergenic
913484678 1:119323132-119323154 GTGTAAGCTCAGATGACTTTAGG + Intergenic
913941249 1:125109109-125109131 GTGAAGACATAAAAGAATTTTGG + Intergenic
913993351 1:143635173-143635195 GTGGAAACACAGAGGAATGGAGG + Intergenic
915644608 1:157260076-157260098 GTGAATAAACAGATTAGTTTAGG + Intergenic
916217416 1:162409326-162409348 GTGAAAAGACTGGTGAATTTAGG - Intronic
916977948 1:170101788-170101810 GTGAAAACAAAGAGAAATTTGGG - Intergenic
917283121 1:173397895-173397917 GTGAAAAGACAGATGGGTCTTGG + Intergenic
917363815 1:174206418-174206440 TTCAAAGCACAGAAGAATTTTGG + Intronic
918390685 1:184057338-184057360 ATGAAAACACAGCTCTATTTGGG + Intronic
918801272 1:188975234-188975256 GAGACAACACAGAAGAATTTTGG - Intergenic
919605219 1:199673669-199673691 GTGAAAATACTGAGAAATTTTGG - Intergenic
919666887 1:200301140-200301162 GTGAAGACGCAGGAGAATTTAGG - Intergenic
920411068 1:205761419-205761441 GAAAAAACAGAAATGAATTTTGG - Intergenic
920696508 1:208184961-208184983 GTGGAAGCAAAAATGAATTTGGG + Intronic
920830065 1:209456498-209456520 GGGAGAGCACAGATGACTTTAGG - Intergenic
921287116 1:213618925-213618947 GTGAAATCACAGAATAATGTGGG + Intergenic
922254521 1:223881893-223881915 TTGAATATACAGATCAATTTTGG - Intergenic
922286937 1:224178473-224178495 GTTAAAACATTCATGAATTTGGG + Intronic
922661608 1:227435219-227435241 GAGAAAACAGAGCTGCATTTAGG - Intergenic
922667208 1:227480790-227480812 TTGAAAACACTGTTGAGTTTGGG + Intergenic
1063176177 10:3552718-3552740 TTGAAAACACAGAAGCCTTTTGG + Intergenic
1063506157 10:6601597-6601619 CTGTGAACACAGATGAAGTTTGG + Intergenic
1063724978 10:8627008-8627030 GTGAAAACAGAGATGAAATTGGG - Intergenic
1064063018 10:12155373-12155395 GTAAAAAGTCAGATGAATTCTGG - Intronic
1065438225 10:25723239-25723261 TTGAAGACACAGATTAATTAGGG - Intergenic
1066343588 10:34560517-34560539 GTGAAAACACATTTGTTTTTTGG + Intronic
1066588573 10:36966622-36966644 GTCAAAACACAGTTGCATTGGGG - Intergenic
1067300033 10:45000010-45000032 GATAAATCACAGGTGAATTTTGG + Exonic
1067468011 10:46515684-46515706 GTGGAAACCCTGATGAATTTAGG - Intergenic
1068764571 10:60748811-60748833 GTTAAAAAACAAAAGAATTTAGG + Intergenic
1068908772 10:62356390-62356412 GTGTAAAGACAGATGGATTCTGG + Intergenic
1073533872 10:104256749-104256771 GTCAGAACACACATGAATTTTGG - Intronic
1074918945 10:117987602-117987624 GTGAAAATGAAGATGAAATTAGG - Intergenic
1075140627 10:119831683-119831705 GTGAAAACACAGAGCACGTTAGG + Intronic
1075404384 10:122184707-122184729 GTGAATATACATATGTATTTAGG + Intronic
1075480410 10:122776651-122776673 GTGAAAACAGAGTTTGATTTGGG + Intergenic
1076447850 10:130530610-130530632 GTGAAAGCCGAGATGATTTTTGG + Intergenic
1077786362 11:5388593-5388615 GTGAATATACAGAGGAAATTAGG + Intronic
1077901205 11:6490472-6490494 GTGAATATATAGATGAATGTGGG - Intronic
1079484342 11:20919096-20919118 GTGAAATCACAGAGGATTTCAGG - Intronic
1079684715 11:23344170-23344192 GTGAAAACCTAGATGACTTTGGG + Intergenic
1080642780 11:34167371-34167393 CAGAAAACACAGATGATTTGTGG - Intronic
1080742594 11:35080195-35080217 GTGATAACCAAGATGATTTTAGG + Intergenic
1081415257 11:42807232-42807254 TTCCAAACACAGATGACTTTGGG - Intergenic
1081586532 11:44388884-44388906 GGGGAAACACAGATAAATTCAGG - Intergenic
1082828872 11:57600653-57600675 GTGATAAGAAAGATGAAATTAGG + Intronic
1083004333 11:59327582-59327604 GTGACAACATGGATGAATCTGGG - Intergenic
1085169967 11:74441541-74441563 GCCAAAGCACAGAGGAATTTAGG + Intergenic
1085963416 11:81490986-81491008 ATCAAAGCACAGATGAGTTTTGG - Intergenic
1087272691 11:96127674-96127696 GTAAAAACACATTTGGATTTTGG + Intronic
1087344516 11:96954316-96954338 GTGAAAAGAAAGCTGAACTTTGG + Intergenic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1087639560 11:100741739-100741761 GTGAAAGCAGAAATGAATTTTGG + Intronic
1087706737 11:101501926-101501948 CTGAAAACATAAATGTATTTAGG - Intronic
1088753769 11:112868096-112868118 ATGAAAACACAGAAGGATTCTGG + Intergenic
1089398075 11:118148758-118148780 GTGAAAATACAGATCAATGTGGG - Intronic
1089726689 11:120486815-120486837 CTAAAAACACAGATCAATTTAGG - Exonic
1090328609 11:125910954-125910976 GTGAAAACAAATATAAATATGGG - Intronic
1090434231 11:126673558-126673580 GTGAAAACACAGATGAATTTTGG - Intronic
1091470592 12:723090-723112 TTAAAGACACAGATGAATTTAGG - Intergenic
1093095883 12:14971843-14971865 TTCAAAACTCAGAGGAATTTTGG + Intergenic
1093340862 12:17972385-17972407 GTGAGAAAGCAGATGACTTTAGG - Intergenic
1098621881 12:72611206-72611228 GTGATAACACTGAAGAATTTTGG - Intronic
1098753740 12:74330420-74330442 GTGACAACATGGATGAATCTTGG - Intergenic
1099513334 12:83565275-83565297 GTGAAAATACAGATGGGATTTGG + Intergenic
1100683762 12:96961747-96961769 GTGAAAAAACATATGCATTATGG + Intergenic
1100912483 12:99381293-99381315 GTCAAAAGAAAGATGAATTCAGG + Intronic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1101580669 12:106038667-106038689 GGGAAAACTGAGATGAATTTAGG - Intergenic
1104074277 12:125375945-125375967 GTGATAACTCAGATGACTGTAGG + Intronic
1106044765 13:26128669-26128691 GTGCAAACAAAGATGAATAAAGG - Intergenic
1106300030 13:28455553-28455575 GAGAAAACCTAGATGAACTTCGG + Intronic
1107041244 13:35950227-35950249 GTTATAATAAAGATGAATTTAGG + Intronic
1107682131 13:42863013-42863035 TTGAAAACACATAGGAATGTTGG + Intergenic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1108813436 13:54260423-54260445 TTTAAAACTAAGATGAATTTCGG - Intergenic
1109520486 13:63503888-63503910 TTGAAAATCCAGATGAATTTAGG + Intergenic
1109663996 13:65505855-65505877 TTGAAAACAAAGACAAATTTGGG - Intergenic
1109814236 13:67558859-67558881 CTCAGCACACAGATGAATTTTGG - Intergenic
1109825671 13:67717653-67717675 GTTAAAAAACTGATGAGTTTGGG + Intergenic
1110301441 13:73933615-73933637 ATGAAAACTTAGATGAATTTTGG - Intronic
1110726150 13:78826936-78826958 CTGAAAACACACTTGATTTTAGG - Intergenic
1111096271 13:83519410-83519432 GTGAAAAAACCAAAGAATTTAGG + Intergenic
1111521781 13:89413961-89413983 GTGAATTCACAGTTGAAATTGGG - Intergenic
1111858160 13:93667123-93667145 GTCAAAATACAGATCTATTTTGG + Intronic
1112309128 13:98302376-98302398 GTGAAAAAAAAGATGAGTGTGGG - Intronic
1112347738 13:98604978-98605000 GTGAAAATACAGAAGAAAATGGG + Intergenic
1112683558 13:101795918-101795940 CTGAAAATACAGCTGAATTGAGG + Intronic
1112904687 13:104402383-104402405 GTGACAACACAGATGAACCTGGG + Intergenic
1113437017 13:110301152-110301174 GTGAACACAAAGATGAATCTGGG - Intronic
1114732626 14:25009925-25009947 GTGAAAAAACAACTGAAGTTAGG - Intronic
1115193174 14:30768891-30768913 CTGAACAAACAGATGAACTTTGG + Intergenic
1116357508 14:43948392-43948414 GAGAAAGTACAGTTGAATTTAGG + Intergenic
1116902063 14:50371047-50371069 GTGACAACATGGATGAAATTGGG - Intronic
1117221423 14:53610384-53610406 AGGAAAACACAGATGAGGTTTGG + Intergenic
1117774761 14:59172047-59172069 CTGAAAATACAGATATATTTTGG + Intergenic
1117815967 14:59597997-59598019 GGGAAACCATTGATGAATTTAGG + Intronic
1118157705 14:63257391-63257413 GGGAAAACCCAAATGAATTCTGG - Intronic
1118335421 14:64849734-64849756 GTGACAACAAAGGTGACTTTTGG - Intronic
1118459183 14:65973291-65973313 GTGAAAGCAAACATGAAATTTGG + Intronic
1119346788 14:73931893-73931915 GTGAAAAGACAGCTGAGTCTGGG - Exonic
1120801673 14:88696559-88696581 GTGGTAACTGAGATGAATTTAGG + Intronic
1121026357 14:90619190-90619212 GTGAGAACAAAAATGATTTTTGG - Intronic
1121238319 14:92409670-92409692 GTGACAACACAGACTAGTTTTGG + Intronic
1123394611 15:19918996-19919018 GTGAAGACATAAAAGAATTTTGG + Intergenic
1124088027 15:26570229-26570251 GTGAAAACATATGTGGATTTTGG + Intronic
1124986909 15:34627636-34627658 CTGAAAACATACATTAATTTAGG - Intergenic
1125231146 15:37457549-37457571 GTGATAACAGAGATGACTTCAGG + Intergenic
1125241208 15:37578678-37578700 GTCAAAGTACAGATGTATTTTGG - Intergenic
1126241719 15:46452628-46452650 GGGAAAATGCAGTTGAATTTGGG - Intergenic
1126417279 15:48430895-48430917 GTGAAATAACAGATGAAAATTGG - Intronic
1127215491 15:56819277-56819299 GTGAAAGTACAAATGAATTAGGG - Intronic
1127949224 15:63788155-63788177 GTTAACAAACAAATGAATTTGGG + Intronic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1128421982 15:67500936-67500958 ATGAAAACACAAATAAGTTTTGG - Exonic
1128836290 15:70811501-70811523 GTGGAAACACAGATACATTTGGG - Intergenic
1130179920 15:81615289-81615311 GTGACAACATGGATGCATTTTGG - Intergenic
1131559449 15:93426816-93426838 GTGATAACATGAATGAATTTAGG + Intergenic
1132223268 15:100121028-100121050 AAGAAAACAAAGATAAATTTTGG + Intronic
1133505292 16:6405994-6406016 GTGAGAACGCAGAGGAATTAAGG + Intronic
1134438162 16:14280879-14280901 TTGAATCTACAGATGAATTTGGG - Intergenic
1135372643 16:21918426-21918448 CTGAAAACACAGATTTTTTTTGG - Intergenic
1135439140 16:22452275-22452297 CTGAAAACACAGATTTTTTTTGG + Intergenic
1135927810 16:26710663-26710685 GTGAGCACACAGACTAATTTAGG + Intergenic
1136057101 16:27698616-27698638 GTGGAAACACGGATGAGTCTGGG - Intronic
1136224337 16:28848461-28848483 ATGAAAACTCAGAGGAGTTTAGG + Intronic
1136689413 16:32018196-32018218 GCTACAACATAGATGAATTTTGG + Intergenic
1136790005 16:32961738-32961760 GCTACAACATAGATGAATTTTGG + Intergenic
1136879807 16:33892198-33892220 GCTACAACATAGATGAATTTTGG - Intergenic
1137085099 16:36110699-36110721 GTGAAGACATAAAAGAATTTTGG - Intergenic
1203092208 16_KI270728v1_random:1223201-1223223 GCTACAACATAGATGAATTTTGG + Intergenic
1143916779 17:10299741-10299763 GTGACAACATAGGTGAACTTGGG - Intronic
1144089187 17:11838565-11838587 GTGAAGACCCAGATGAATGAAGG + Intronic
1145689479 17:26722977-26722999 GTGAAGACATAAAAGAATTTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146471361 17:33127556-33127578 GTGAAACTTCAGTTGAATTTGGG - Intronic
1146866842 17:36343891-36343913 GTGAAACGACATTTGAATTTTGG - Intronic
1146934410 17:36803221-36803243 GGGGAAAAACATATGAATTTTGG + Intergenic
1146987653 17:37236371-37236393 GTGACAACACAAATAAACTTTGG + Intronic
1146987839 17:37238635-37238657 GTCAATCTACAGATGAATTTAGG + Intronic
1147069710 17:37944500-37944522 GTGAAACGACATTTGAATTTTGG - Intergenic
1147081240 17:38024038-38024060 GTGAAACGACATTTGAATTTTGG - Intronic
1147097182 17:38147995-38148017 GTGAAACGACATTTGAATTTTGG - Intergenic
1147152259 17:38524341-38524363 GCTACAACATAGATGAATTTTGG + Intergenic
1147599658 17:41738068-41738090 GAGAAGACAGAGATGAAGTTAGG + Intergenic
1148917237 17:50992326-50992348 GTTATAACACAGATGAACCTTGG - Intronic
1148976291 17:51532763-51532785 GTGAAACCACAGCTGAAATGTGG - Intergenic
1149484767 17:57033902-57033924 GTGAAGACACAGATGCTTTGGGG + Intergenic
1149889700 17:60376484-60376506 GTGAAATGACATTTGAATTTTGG + Intronic
1150610507 17:66729582-66729604 GTGGAAACACCTGTGAATTTGGG - Intronic
1153411503 18:4798971-4798993 GGGAAAACACTGAGGAATCTGGG - Intergenic
1153432753 18:5036918-5036940 GTGAAAACGCAAAGGAATGTGGG - Intergenic
1153980772 18:10307859-10307881 TTAAAAAAAGAGATGAATTTGGG + Intergenic
1154351597 18:13588156-13588178 GTGAAAAGACAGAATTATTTTGG + Intronic
1154981619 18:21506897-21506919 ATAAAAATAAAGATGAATTTGGG - Intronic
1155431798 18:25767354-25767376 TTCAGACCACAGATGAATTTTGG + Intergenic
1155865357 18:30958192-30958214 GTAAAAACACTTTTGAATTTTGG - Intergenic
1155906611 18:31459719-31459741 TTGAACATACAGATGATTTTAGG + Intronic
1156641777 18:39109667-39109689 GTGAAGACAGAGAAGAATTGAGG + Intergenic
1157845174 18:50997153-50997175 TTGAAACTACAGATAAATTTAGG - Intronic
1157958308 18:52124016-52124038 TTGAAGACACAGATGAAAGTAGG + Intergenic
1158881751 18:61785676-61785698 GAGAAAACAAAGAAGCATTTGGG - Intergenic
1159071917 18:63633641-63633663 TTGAAACCATAGATAAATTTGGG - Intergenic
1159187346 18:64992410-64992432 GTGAAAACAATCATCAATTTTGG + Intergenic
1159485721 18:69054868-69054890 GGGAAACCACAGCTTAATTTTGG - Exonic
1160345794 18:78130814-78130836 GTGCACACACAGGTGGATTTGGG + Intergenic
1162151049 19:8645890-8645912 GTGAAAACGAAGATGATATTAGG + Intergenic
1162870171 19:13580526-13580548 GTGAAAACACAGATATTTCTGGG - Intronic
1163925411 19:20337016-20337038 GTGAAATCACTCATGAAATTAGG - Intergenic
1164528139 19:29026770-29026792 GTGGGAACACAGAGGTATTTAGG + Intergenic
1164814619 19:31185709-31185731 GTGTAGAGACAGATGAGTTTTGG + Intergenic
1164840010 19:31386159-31386181 GTGAACACACGGAGGAGTTTTGG - Intergenic
1166872556 19:45879598-45879620 GAGAACACACAGATAAATGTCGG + Intergenic
1168276792 19:55283405-55283427 GGGGAAACAGACATGAATTTTGG + Intronic
1202668918 1_KI270709v1_random:30838-30860 GTGAAGACAGAAAAGAATTTTGG + Intergenic
925324889 2:3010634-3010656 ATGAAAACACAAATGATTTCAGG + Intergenic
925774096 2:7316275-7316297 GGCAGAACACAGAAGAATTTTGG + Intergenic
925930811 2:8706361-8706383 GTGAACACAGAGAGGGATTTGGG + Intergenic
926453000 2:13028726-13028748 GTGAGAACACAGCTAAACTTAGG + Intergenic
927744363 2:25602893-25602915 GTGAGAACTCAGTTAAATTTTGG - Intronic
928242687 2:29600422-29600444 GAGAAAACACATAGAAATTTTGG + Intronic
928983619 2:37159277-37159299 GTGGAGACACAGCAGAATTTAGG - Intergenic
929346661 2:40892174-40892196 GAGAAAACATAGATGACCTTGGG + Intergenic
929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG + Intergenic
930526739 2:52539909-52539931 GTGTAAACACAGAAAAATGTTGG + Intergenic
934252372 2:90369029-90369051 GTGAAGACATAAAAGAATTTTGG - Intergenic
934257070 2:91433916-91433938 GTGAAGACATAAAAGAATTTTGG + Intergenic
936014407 2:108946885-108946907 GTGAAAAAAAAGATGAGATTTGG - Intronic
937422219 2:121767580-121767602 GAGAAAATAGAGATGAATTAGGG + Exonic
937523422 2:122738613-122738635 ATTTAAACAAAGATGAATTTGGG - Intergenic
937581563 2:123494687-123494709 TACAAAAGACAGATGAATTTTGG + Intergenic
938676725 2:133643459-133643481 GGGAAATCACAGATGATTCTTGG - Intergenic
938941527 2:136173659-136173681 GTGAAAACAGACATGGATATTGG + Intergenic
939775909 2:146387847-146387869 GTGGGAACACAGATAAATTTGGG + Intergenic
939872720 2:147542909-147542931 GTGAAAATACAAATGCAGTTTGG - Intergenic
940394759 2:153175140-153175162 GTGAACACATAGCTAAATTTAGG - Intergenic
940723873 2:157312508-157312530 GTGAGAACACTGACAAATTTGGG + Exonic
940747406 2:157583927-157583949 ATAAAAACACATATGAATTTTGG + Intronic
941015094 2:160346517-160346539 ATGAGAACTCAGATCAATTTAGG - Intronic
941179287 2:162238476-162238498 TTAAAATCACAGATGAATCTTGG - Intronic
941233053 2:162935227-162935249 ATGATAACATAGATCAATTTGGG - Intergenic
941828741 2:169930048-169930070 GTGTAAAATTAGATGAATTTGGG + Intronic
942215449 2:173714850-173714872 ATGAAAACACTGCAGAATTTTGG + Intergenic
942373743 2:175314109-175314131 TTGAAAAGACAGATCAAATTTGG - Intergenic
942650292 2:178159542-178159564 TAGAAACCACAGATCAATTTTGG + Intergenic
942652795 2:178186299-178186321 GTGACAACATGGATGAACTTAGG + Intergenic
942942747 2:181638736-181638758 GTGACAGCACAGCTGAAGTTTGG + Intronic
943458604 2:188140657-188140679 GTGACAACACTGATAAATTTTGG - Intergenic
943718397 2:191177243-191177265 GTTCAAACACAGATCATTTTAGG + Intergenic
944044998 2:195400854-195400876 TTGAATAAACATATGAATTTTGG - Intergenic
944354042 2:198763894-198763916 GTGAAAATGCAGAGGAATTGTGG - Intergenic
944953559 2:204780701-204780723 GTGGAAAAACAGACGCATTTGGG + Intronic
944995878 2:205292723-205292745 ATGAACATACAGTTGAATTTGGG + Intronic
945377992 2:209101822-209101844 TTGTAGAAACAGATGAATTTAGG + Intergenic
945435915 2:209817264-209817286 GTGAAAACACAGCATTATTTTGG - Intronic
945444975 2:209926132-209926154 AAGAAAACACACATGCATTTAGG - Intronic
945586403 2:211669360-211669382 GTGAAAACACTGTTAAATTTAGG - Intronic
946472046 2:219969839-219969861 GTGAACAGACAGTTGAATTGTGG + Intergenic
946731074 2:222710085-222710107 ATAAAAACACAGATGACTGTAGG + Intergenic
946739449 2:222787622-222787644 GAGAAAGCTCAGCTGAATTTAGG - Intergenic
946865161 2:224036045-224036067 GTGAAAACTAAAATCAATTTTGG + Intronic
947256128 2:228165618-228165640 GTGAAAATAAAAATGATTTTTGG + Intronic
1169305302 20:4484653-4484675 GTGAAAACTCACATGAAATTTGG - Intergenic
1170081925 20:12486147-12486169 GTGAAAAAACTGGTGAAATTTGG + Intergenic
1170155506 20:13265571-13265593 GGGAAGGCACAGATGAATTTGGG - Intronic
1170205720 20:13795975-13795997 GTGAATACAAAAATGAATTAGGG + Intronic
1171417016 20:24989065-24989087 GAGAAAAGACAGAAGAATTGTGG - Intronic
1174111312 20:48199987-48200009 GAGAAAACAAAGATGAAGTGGGG + Intergenic
1174263138 20:49311965-49311987 GTGACAACACAGAGGAATCCAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174915735 20:54651822-54651844 GAGAGAACACACATGCATTTCGG - Intergenic
1177033351 21:16011049-16011071 GTTAAAACAAAAATGAATTCAGG + Intergenic
1177386457 21:20415372-20415394 ATGATATCACTGATGAATTTTGG + Intergenic
1177494980 21:21877086-21877108 ATGACAACATGGATGAATTTGGG + Intergenic
1178912930 21:36690759-36690781 GAGAAAACACAGATGTTTTCTGG + Intergenic
1179397410 21:41054269-41054291 GTGAAAACAAAGATACAATTTGG + Intergenic
1183762067 22:39830375-39830397 CTGAAAAGACAGATTATTTTAGG - Intronic
1184285097 22:43466010-43466032 GGGAAAACACAGAAAACTTTCGG + Intronic
1184902240 22:47453716-47453738 GTGAAAGCACTGCTGTATTTTGG - Intergenic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
1203325724 22_KI270738v1_random:14506-14528 GTGAAGACATAAAAGAATTTTGG - Intergenic
949728846 3:7083590-7083612 GTGAAAACATAAATGAATGCAGG - Intronic
950951115 3:17000143-17000165 TTGAAAGCACAGGTGAATTTAGG + Intronic
951155617 3:19349806-19349828 TAAAAAACACAGAAGAATTTAGG - Intronic
951531161 3:23699314-23699336 GTGAAAACACAAATGTACCTGGG - Intergenic
952076610 3:29704393-29704415 GTTGAAATACAGATGCATTTTGG + Intronic
952622068 3:35356805-35356827 GGTAAAACACAGAGGATTTTAGG + Intergenic
953784622 3:45901773-45901795 GTGAAAACCCTGAAGAACTTGGG + Exonic
955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG + Intergenic
955213087 3:56960326-56960348 CTGATCACACAGATGAAATTGGG + Intronic
955838668 3:63087433-63087455 CTGAAAACTGAGAAGAATTTTGG - Intergenic
956210475 3:66796644-66796666 GTTCCAACATAGATGAATTTTGG + Intergenic
957199715 3:77116976-77116998 GTGATCACACAGCTGAATATCGG + Intronic
957484821 3:80845949-80845971 GTGACAACAAGGATGAACTTAGG - Intergenic
958551052 3:95613226-95613248 GTGGAAAAACAGATGAATAAAGG + Intergenic
958617085 3:96508431-96508453 GAGAGGACACATATGAATTTTGG + Intergenic
958803756 3:98785098-98785120 GTCAAAACACAGCTGTATTAAGG - Intronic
959241805 3:103806565-103806587 GACAAAAAACAGTTGAATTTGGG - Intergenic
959870947 3:111327537-111327559 TTGAAAATACAAATCAATTTGGG + Intronic
960268637 3:115650144-115650166 TTGAAAACACTGACTAATTTAGG + Intronic
960660143 3:120049079-120049101 GTGAAGAGACAGATTCATTTTGG - Intronic
960981445 3:123231507-123231529 GTGAAAACAGAAAGAAATTTGGG + Intronic
961969536 3:130945787-130945809 GTGAAAACACAGCATATTTTTGG + Intronic
962905050 3:139793859-139793881 GTGAAAACTCAGATGCCTATGGG + Intergenic
963625078 3:147661103-147661125 GGCAAAAGAGAGATGAATTTTGG - Intergenic
965528381 3:169745855-169745877 GTGCAAAAACAACTGAATTTCGG - Intergenic
965641208 3:170830720-170830742 GTGCCCACACAGAAGAATTTTGG + Intronic
968361027 3:198146972-198146994 CTGCAAACACACGTGAATTTGGG + Intergenic
970102053 4:12535633-12535655 TTGAAACCACAGATCAATTAGGG + Intergenic
970231945 4:13919903-13919925 GTAAACACACAGCTGAAATTTGG + Intergenic
970602943 4:17654645-17654667 GTGAAATCCCAGAGGAAATTTGG - Intronic
971334972 4:25714128-25714150 GTGAGTTTACAGATGAATTTTGG + Intergenic
971778947 4:31005502-31005524 GTGAAAAAAAAGATAAAATTGGG + Intronic
972356392 4:38282876-38282898 TTGAAATCACAGATGCATATTGG - Intergenic
972843496 4:42959268-42959290 GTGATAACATAGATGAACCTAGG + Intronic
974240812 4:59244240-59244262 GTGACAACATAGATGAACCTGGG + Intergenic
974382403 4:61158338-61158360 GTGCAAACACATATTAATTGTGG + Intergenic
975452751 4:74548884-74548906 CTGAAAACACACATGGTTTTTGG - Intergenic
975723954 4:77274291-77274313 GTGAAAACAAATCTGAATTCTGG + Intronic
976670552 4:87647982-87648004 GAGAAGACACAGATAAATATGGG - Intergenic
976822822 4:89226048-89226070 GTGATAAATCAGATAAATTTTGG + Intergenic
977453704 4:97230332-97230354 CTGAAAACTCAGATGAATAGAGG - Intronic
977664456 4:99629702-99629724 GTGAAATCTCAGGTCAATTTAGG - Intergenic
979102581 4:116639286-116639308 GTGAAAACGAAAATGATTTTTGG - Intergenic
979494785 4:121371072-121371094 GTGAAAACAAACATGGATTGTGG - Intronic
980083796 4:128370691-128370713 GTGAAAACAAACATGGAATTTGG + Intergenic
981689955 4:147497448-147497470 TAGAAAACACAGAGGAATCTAGG + Intronic
981776755 4:148377526-148377548 AGGAAAAAGCAGATGAATTTGGG + Intronic
981907284 4:149936080-149936102 TTGACAACATAGATGAATTTGGG - Intergenic
981969214 4:150646238-150646260 GTGAAGACAAAGATGACTTCAGG + Intronic
982100655 4:151964474-151964496 GTGTAAACTCTGATTAATTTAGG - Intergenic
982351621 4:154421687-154421709 GTTTAAACACAGATGAGTTCGGG - Intronic
983603179 4:169553422-169553444 GAGAAAACCCAAATGAACTTGGG + Intronic
983764173 4:171455266-171455288 GAGAAAACATAGATTAACTTGGG - Intergenic
983971806 4:173884502-173884524 TTAATGACACAGATGAATTTTGG - Intergenic
984498726 4:180531917-180531939 GTAAAAATACAGATGGAATTTGG - Intergenic
985810826 5:2083273-2083295 GGGGAAAAAAAGATGAATTTTGG + Intergenic
986677431 5:10198705-10198727 GTAGAAACACAGATGAAAATTGG - Intergenic
986998651 5:13636267-13636289 GTGATAATATAGATGAACTTTGG + Intergenic
987429697 5:17817426-17817448 TTGTAAACACAGATGATTTAAGG - Intergenic
988204061 5:28111321-28111343 GTAAAAACAAATCTGAATTTAGG - Intergenic
988580168 5:32461919-32461941 GTGAAAACGCAGTGGGATTTAGG - Intergenic
989147770 5:38265572-38265594 GTGAAATCAAAGATGAGTTTGGG - Intronic
990014648 5:51044942-51044964 GTGCAAAAAAAAATGAATTTTGG - Intergenic
990045768 5:51428880-51428902 TTGAAAACACAGATAAATAAAGG + Intergenic
990356252 5:54969075-54969097 GTGAAAACCAAGATGTATTTAGG - Intergenic
990496461 5:56353209-56353231 GAGAAAACACATAGGTATTTTGG + Intergenic
991361927 5:65829919-65829941 GGGAAAACACAGAAAAGTTTTGG - Intronic
991610518 5:68445197-68445219 TTGAAAACTCACAGGAATTTGGG - Intergenic
991907820 5:71529745-71529767 GTCACAACATGGATGAATTTTGG + Intronic
992180369 5:74190711-74190733 GGGAAAACCTAGATGACTTTGGG - Intergenic
992937482 5:81724212-81724234 CTGAATACACAAATTAATTTGGG + Intronic
993458043 5:88147211-88147233 GTGAAAACACAGAGTATTATTGG - Intergenic
993478755 5:88396930-88396952 GTCAAAACCAAGATGCATTTGGG + Intergenic
993775339 5:91987837-91987859 GTGATAACCTAGATGACTTTGGG + Intergenic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
995167096 5:109056416-109056438 GTCAAAACACAGATGAGCCTGGG + Intronic
995240837 5:109884320-109884342 GTGAAAACTCAGACGAAACTCGG - Intronic
996040276 5:118801427-118801449 GGGAAAATATAGATGGATTTGGG - Intergenic
996514227 5:124351975-124351997 GAGTAAATACTGATGAATTTTGG - Intergenic
997163346 5:131632725-131632747 CTGAAAACAGAAATGAACTTGGG + Intronic
997999463 5:138612599-138612621 ATGACAACATGGATGAATTTGGG - Intronic
998629744 5:143884820-143884842 GTGAATATACAGGTGAATGTAGG - Intergenic
999620667 5:153469711-153469733 GTGAAAACACTGTGGAATGTTGG + Intergenic
999798724 5:155012790-155012812 GAGAAAACCTAGATGAATTCAGG - Intergenic
1000486553 5:161851710-161851732 CTGGAAAGACATATGAATTTAGG + Intronic
1000608686 5:163351855-163351877 GCCAGAACACAGATGAATTGGGG + Intergenic
1001678842 5:173541192-173541214 GTGACAACATGGATGAATCTGGG + Intergenic
1002305674 5:178281196-178281218 ATCTAAAAACAGATGAATTTGGG + Intronic
1004305180 6:14494376-14494398 TTGACTACACAGATCAATTTAGG + Intergenic
1004935168 6:20500306-20500328 GTGAAAACATAGATGAACCTTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005200219 6:23336238-23336260 GGGAAGTCACAGATGAATGTGGG + Intergenic
1005339709 6:24831701-24831723 ATGAAAACAGACATAAATTTTGG + Intronic
1005456487 6:26024678-26024700 GTGAAAACAAAGACCAGTTTGGG + Intergenic
1008184745 6:48374863-48374885 GTCATAACACAGATACATTTTGG - Intergenic
1008358849 6:50590815-50590837 ATGTAGACACAGATGATTTTAGG - Intergenic
1009450278 6:63791975-63791997 TTGAAAGGACAGATCAATTTGGG + Intronic
1009532738 6:64842062-64842084 GTGCAAACACTGATGATATTTGG - Intronic
1012068395 6:94578949-94578971 ATAAAAACAAATATGAATTTTGG - Intergenic
1012340463 6:98116054-98116076 GTAAAAACGTAGATAAATTTTGG + Intergenic
1013017270 6:106171428-106171450 CACAAAACACAAATGAATTTTGG + Intergenic
1013114707 6:107093805-107093827 GAGAAAACATAGATGACCTTGGG + Intronic
1013653714 6:112223899-112223921 GTGAAAACACAGAGGCTATTGGG + Intronic
1014608197 6:123505408-123505430 GCGATACCACAGATGATTTTTGG - Intronic
1014874163 6:126635490-126635512 GTGAAAACAAGGATGGATATGGG - Intergenic
1015107128 6:129550087-129550109 ATGAAAAGAAAGACGAATTTTGG + Intergenic
1016070098 6:139728062-139728084 GTAAAAATACATATGAATATTGG - Intergenic
1016264064 6:142211349-142211371 GAGAAAATCCAGATGACTTTGGG + Intronic
1017460400 6:154644317-154644339 GAGTCAAAACAGATGAATTTTGG - Intergenic
1017511249 6:155116284-155116306 GTGAATACTCATATGAATTAAGG + Intronic
1018302023 6:162413544-162413566 GTGAAAATACAGATAATGTTTGG - Intronic
1019258983 7:69682-69704 CTGCAAACACACGTGAATTTGGG - Intergenic
1019496509 7:1342883-1342905 GTGGACACACAGATGAGATTTGG - Intergenic
1020457652 7:8392539-8392561 GTGAAAAGACACAGGAATTAGGG + Intergenic
1020783207 7:12540993-12541015 GTGAGAACATTGATGAATTCTGG + Intergenic
1020822773 7:12990971-12990993 TGCTAAACACAGATGAATTTTGG + Intergenic
1021549364 7:21853389-21853411 TTGAAAAGACAGAGTAATTTGGG - Intronic
1021659031 7:22899826-22899848 GAGAAAAAAAAGATTAATTTGGG - Intergenic
1022231541 7:28418491-28418513 GTGAAATGACTCATGAATTTGGG - Intronic
1023756305 7:43420866-43420888 CTGAAACCACAGATCAATTTGGG - Intronic
1023893097 7:44407859-44407881 GTAGAAACACAGATCAATTCAGG + Intronic
1024873715 7:53995890-53995912 GTGATAACATAGATAAATGTGGG - Intergenic
1025105687 7:56170382-56170404 GTGAAAACAGAAATGGCTTTGGG - Intergenic
1025319431 7:58078389-58078411 GTGAAGACATAAAAGAATTTTGG + Intergenic
1025477848 7:60948859-60948881 GTGAAGACATAAAAGAATTTTGG + Intergenic
1025554282 7:62285086-62285108 GTGAAGACATAAAAGAATTTTGG - Intergenic
1025560499 7:62368188-62368210 GTGAAGACATAAAAGAATTTTGG + Intergenic
1025797186 7:64749551-64749573 GTGAAAACCCAGGTAAGTTTGGG + Intergenic
1026314780 7:69218895-69218917 GTGAAAACAGAAATGGCTTTGGG - Intergenic
1027821142 7:83046222-83046244 GAGATAACACATATAAATTTTGG + Intronic
1028117784 7:87020704-87020726 GTGAAAACTCAGTGGCATTTAGG - Intronic
1030137045 7:106263630-106263652 ATGAAAACACAGATTTACTTAGG + Intronic
1030585631 7:111415062-111415084 GTCAAAACAGAGATGATTCTGGG + Intronic
1031229646 7:119089200-119089222 CTAAAAACATAGATGAATCTGGG - Intergenic
1031537528 7:122953659-122953681 GTGATACCACAGAGGAATTGTGG + Intergenic
1033033538 7:137848542-137848564 GTGAAAAATCAGAAGTATTTTGG - Intergenic
1033060494 7:138101847-138101869 TTGAATCTACAGATGAATTTGGG - Intronic
1033425688 7:141241943-141241965 CTTAAAACACATCTGAATTTGGG + Intronic
1033968642 7:147010358-147010380 TTGAAAAAAATGATGAATTTTGG + Intronic
1035176953 7:157058305-157058327 GTGAAAATGCTGATGCATTTCGG + Intergenic
1036155262 8:6336238-6336260 GTCAGAACACAGAGGATTTTGGG - Intergenic
1036198079 8:6739355-6739377 TTGAAGATATAGATGAATTTGGG + Intronic
1037009933 8:13829033-13829055 GCCATTACACAGATGAATTTTGG + Intergenic
1037390080 8:18384166-18384188 GATTAAACTCAGATGAATTTTGG - Intergenic
1037414341 8:18633114-18633136 GTGAAAAGACCAATGACTTTAGG - Intronic
1039353170 8:36784635-36784657 GTGAAGTCAGAGATGAGTTTGGG + Intronic
1039924959 8:41921394-41921416 GAGAAAACATAGATGACCTTGGG + Intergenic
1040420399 8:47234518-47234540 GGGAAAACTTAGATGACTTTGGG + Intergenic
1040633401 8:49242280-49242302 GTGACAACATGGATGAATCTGGG - Intergenic
1040643350 8:49367822-49367844 GTTAAAGTACAAATGAATTTAGG + Intergenic
1042400969 8:68346571-68346593 GCAAAAACACAGAGGATTTTAGG - Intronic
1042924263 8:73951363-73951385 GTAAAAACATAGAAGAATTGTGG + Intronic
1043210433 8:77507477-77507499 GTGAAAACCCAGAAACATTTAGG - Intergenic
1043266108 8:78269391-78269413 GAGAAAATATAGATGACTTTGGG + Intergenic
1043298606 8:78698611-78698633 GTTAAAAGACAAATGAACTTAGG - Intronic
1043311176 8:78861304-78861326 TAGAAAACAAGGATGAATTTCGG - Intergenic
1043549371 8:81352388-81352410 GTGACAACATAGATAAATCTAGG - Intergenic
1043650893 8:82590444-82590466 GGAAAAACACAAATGAATATGGG + Intergenic
1043912199 8:85875965-85875987 GTTGAAACACAGCTCAATTTTGG - Intergenic
1044897389 8:96906811-96906833 GTCACATCACATATGAATTTTGG + Intronic
1045822127 8:106351528-106351550 GTGGAGACACAGATGCATTCGGG + Intronic
1046531743 8:115455014-115455036 TTGAAAACACAAAGGAACTTGGG - Intronic
1046583357 8:116120945-116120967 CTGAGAACATTGATGAATTTTGG + Intergenic
1047090777 8:121573392-121573414 GTGAAAACACTGGGGAAATTAGG - Intergenic
1047343600 8:124006053-124006075 GTTAAAAGACAGAGGAATTTTGG - Intronic
1047565092 8:126035207-126035229 GTGAAGACACTGATGAAGCTGGG - Intergenic
1048510293 8:135055798-135055820 GTGGAACCTAAGATGAATTTTGG - Intergenic
1048978993 8:139693022-139693044 GTGAAAACTCAGGTGAGGTTGGG - Intronic
1049930061 9:447724-447746 GAACAAACACAGATGAATTGTGG + Intronic
1050029398 9:1369354-1369376 GTCATAACACAGATACATTTTGG + Intergenic
1051002205 9:12297406-12297428 GTGGAAACACAGAGGGTTTTAGG - Intergenic
1052237406 9:26228215-26228237 GTAAAAACACAGATCACTTATGG + Intergenic
1052472821 9:28921665-28921687 TTTAAGACACAGATGATTTTAGG - Intergenic
1052506810 9:29365782-29365804 GTGAAAAAACATTTGAAATTTGG + Intergenic
1052631661 9:31048906-31048928 GAGACAGAACAGATGAATTTGGG + Intergenic
1055939016 9:81631740-81631762 ATGAAATCACAGAAGAAATTTGG - Intronic
1056273793 9:84973009-84973031 TTGAAAGCTCAGATGAAGTTTGG - Intronic
1058778805 9:108312320-108312342 GTGAAGGCAGTGATGAATTTGGG + Intergenic
1058804597 9:108578787-108578809 GGGAAGACACAGATGACGTTTGG - Intergenic
1059288601 9:113200691-113200713 GTTAAAACACTGATAAAATTGGG - Intronic
1059425727 9:114219886-114219908 GTGAACACACAGCAGATTTTAGG + Intronic
1059973093 9:119687546-119687568 GTGAAAACATAGAGAAATTTAGG + Intergenic
1060280164 9:122210287-122210309 ATGAAAACACATATTTATTTAGG - Intronic
1060446464 9:123693106-123693128 GTGTATATATAGATGAATTTTGG + Intronic
1060570661 9:124636492-124636514 GAGAAAACATAGATGACCTTGGG - Intronic
1060632370 9:125171024-125171046 GTGAAAACACACATGGATCATGG + Intronic
1185536497 X:866689-866711 GTGTAAAGACAAATGACTTTGGG + Intergenic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1186076717 X:5887584-5887606 GTGAGAAGACAGAGGAAGTTGGG - Intronic
1187329499 X:18323935-18323957 GTGACAACAGAAATGATTTTTGG - Exonic
1187626095 X:21115527-21115549 ATGAAAACAGAGATGTAATTAGG + Intergenic
1188134502 X:26478433-26478455 TTGAAACCATAGATCAATTTGGG - Intergenic
1188217637 X:27498846-27498868 GTGACAACACAGATCAACCTAGG - Intergenic
1188442536 X:30227394-30227416 GCAACAACACAGATGAACTTGGG - Intergenic
1188787515 X:34366280-34366302 GTGATAACACATGTGAATTTTGG + Intergenic
1189579207 X:42387834-42387856 GAGAAAAAAGAGATAAATTTGGG + Intergenic
1190123748 X:47685266-47685288 GTGAAAACATTGATAAGTTTGGG - Intergenic
1190492437 X:50995531-50995553 TTGAATATACAGATCAATTTTGG - Intergenic
1192109282 X:68347875-68347897 GAGAAAAGACACATGGATTTTGG + Intronic
1192175578 X:68882871-68882893 GTAGAAACAGAGATGAGTTTGGG - Intergenic
1192263993 X:69525937-69525959 GTGAAAAAACAGGTGAAAATAGG - Intronic
1193542246 X:82787020-82787042 GAGAAAACTCTGATGAATATGGG + Intergenic
1194382720 X:93215500-93215522 GTGAATACACAGATGCACTGTGG + Intergenic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1196280889 X:113822472-113822494 ATGAAAAAACTGATGAATCTAGG - Intergenic
1197274021 X:124457000-124457022 TTGAAAACAAAAATGAATTCCGG - Intronic
1199030009 X:142986630-142986652 GTGAGATCACAGATGAAATACGG + Intergenic
1199059387 X:143336497-143336519 GGTAAAACACAGATGTATTTGGG + Intergenic
1199291370 X:146108385-146108407 GTGAATTTACAGATTAATTTTGG - Intergenic
1201400947 Y:13603174-13603196 GTGAGGACCCAGATGATTTTGGG - Intergenic