ID: 1090434562

View in Genome Browser
Species Human (GRCh38)
Location 11:126676077-126676099
Sequence AAATTCAGTATGTCCCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090434562_1090434566 -9 Left 1090434562 11:126676077-126676099 CCAGTTTGGGACATACTGAATTT 0: 1
1: 0
2: 2
3: 27
4: 206
Right 1090434566 11:126676091-126676113 ACTGAATTTCAGATGGTTTGGGG 0: 1
1: 0
2: 2
3: 34
4: 266
1090434562_1090434569 24 Left 1090434562 11:126676077-126676099 CCAGTTTGGGACATACTGAATTT 0: 1
1: 0
2: 2
3: 27
4: 206
Right 1090434569 11:126676124-126676146 GTTTCATTGTTTGGCCATGTAGG 0: 1
1: 0
2: 1
3: 32
4: 302
1090434562_1090434565 -10 Left 1090434562 11:126676077-126676099 CCAGTTTGGGACATACTGAATTT 0: 1
1: 0
2: 2
3: 27
4: 206
Right 1090434565 11:126676090-126676112 TACTGAATTTCAGATGGTTTGGG 0: 1
1: 0
2: 2
3: 31
4: 266
1090434562_1090434567 0 Left 1090434562 11:126676077-126676099 CCAGTTTGGGACATACTGAATTT 0: 1
1: 0
2: 2
3: 27
4: 206
Right 1090434567 11:126676100-126676122 CAGATGGTTTGGGGACATTCAGG 0: 1
1: 0
2: 0
3: 12
4: 144
1090434562_1090434568 15 Left 1090434562 11:126676077-126676099 CCAGTTTGGGACATACTGAATTT 0: 1
1: 0
2: 2
3: 27
4: 206
Right 1090434568 11:126676115-126676137 CATTCAGGTGTTTCATTGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090434562 Original CRISPR AAATTCAGTATGTCCCAAAC TGG (reversed) Intronic
901264682 1:7901789-7901811 AAACCCAGGATGTTCCAAACTGG - Intergenic
903703194 1:25266148-25266170 ACATTCATTAAGTCCCAAAAAGG + Intronic
903712461 1:25336475-25336497 ACATTCATTAAGTCCCAAAAAGG + Intronic
904888911 1:33763373-33763395 CAATTCAGTAGGTCCAAAATGGG - Intronic
905187848 1:36209543-36209565 TAATTCAGTGTTTCCCAACCAGG - Intergenic
906770950 1:48482783-48482805 TAATTCAGAATTTCCCAAACTGG - Intergenic
912662457 1:111544764-111544786 AAATTGGGTATGTACCAAATTGG - Intronic
912662463 1:111544798-111544820 AAATTGGGTATGTACCAAATTGG - Intronic
912662469 1:111544832-111544854 AAATTGGGTATGTACCAAATTGG - Intronic
912662475 1:111544866-111544888 AAATTGGGTATGTACCAAATTGG - Intronic
912662481 1:111544900-111544922 AAATTGGGTATGTACCAAATTGG - Intronic
912662487 1:111544934-111544956 AAATTGGGTATGTACCAAATTGG - Intronic
912662493 1:111544968-111544990 AAATTGGGTATGTACCAAATTGG - Intronic
912662499 1:111545002-111545024 AAATTGGGTATGTACCAAATTGG - Intronic
912662505 1:111545036-111545058 AAATTGGGTATGTACCAAATTGG - Intronic
912662511 1:111545070-111545092 AAATTGGGTATGTACCAAATTGG - Intronic
913656371 1:120964172-120964194 AAATGTAGTAGGTCCCAAAGGGG + Intergenic
914520923 1:148415401-148415423 AAATATAGTAGGTCCCAAAGGGG + Intergenic
914646333 1:149655902-149655924 AAATATAGTAGGTCCCAAAGGGG + Intergenic
916780956 1:168028882-168028904 AAGTTCAGTATTCCCCACACTGG + Intronic
918581853 1:186140499-186140521 AATGTCAGTTTGTCCCATACTGG + Intronic
921548808 1:216507613-216507635 AAAGCCAATATTTCCCAAACAGG + Intronic
921595217 1:217047304-217047326 AAATTTGGCATGTCCAAAACTGG + Intronic
921987167 1:221324754-221324776 AAATTAATTATATCCCAAAGTGG + Intergenic
922908282 1:229193543-229193565 AAAGTAAGGATGTCCCCAACAGG + Intergenic
923678501 1:236100382-236100404 AAATTCAGCACTTCCAAAACTGG + Intergenic
924118829 1:240775810-240775832 AAATTCAGTCAGTCAAAAACTGG - Exonic
1067213836 10:44284182-44284204 AAAATTAATATGTCCCAAAATGG + Intergenic
1068844842 10:61660214-61660236 CAATTCAGTATGCCCCTAAATGG - Intergenic
1071692086 10:87831538-87831560 AAATTCAGTAGGTATCAAAAGGG - Intronic
1071754490 10:88521455-88521477 CAATTCAGTCTGTCCCTAATGGG + Intronic
1074005922 10:109423120-109423142 ATATCCACTATGACCCAAACAGG + Intergenic
1074286464 10:112102587-112102609 AACTTCAATATGTCCCAAAGAGG - Intergenic
1075989287 10:126820362-126820384 AAGTTCAGTAGCCCCCAAACAGG + Intergenic
1078587447 11:12604862-12604884 ACATTAAGTTTATCCCAAACTGG + Intergenic
1079419481 11:20272634-20272656 AAATACACTATGCCCCAAAAGGG - Intergenic
1079480637 11:20876211-20876233 GAATACAGTATGCCCCCAACAGG - Intronic
1082665714 11:55972955-55972977 ACATTCAGCTTGTCCCAACCTGG - Intergenic
1086107770 11:83165208-83165230 AAATTTAGTTTCTCCCAAAGTGG - Intronic
1086577749 11:88360218-88360240 AAATTCAGTATCTCTCGAATGGG + Intergenic
1089030188 11:115318462-115318484 AAATTCACTATTCCCCAAATAGG - Intronic
1090434562 11:126676077-126676099 AAATTCAGTATGTCCCAAACTGG - Intronic
1090918230 11:131185933-131185955 AAATCCAGTATGCCACCAACTGG - Intergenic
1093693071 12:22128912-22128934 ACTTTCAGTGTGTCCCATACTGG - Intronic
1094190844 12:27696823-27696845 AAATCCAGTCTGCACCAAACAGG - Exonic
1094335790 12:29351369-29351391 AAATTCAGTACATCCTAAAGTGG - Intronic
1094558665 12:31528715-31528737 AAAATCAGTATGTTCAAAACTGG - Intronic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1095144821 12:38713553-38713575 AAATACAGAATGTGACAAACTGG - Intronic
1096909539 12:54968523-54968545 AAATTCTCTCTGTCCAAAACAGG + Intronic
1097920365 12:65066050-65066072 AATTTTAGTATGTCCTAAATTGG - Intronic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1098910063 12:76199758-76199780 AACCTCATTATGTCCAAAACAGG + Intergenic
1099772924 12:87086120-87086142 AAATTATGTTTGTCTCAAACTGG - Intergenic
1100287825 12:93184105-93184127 AAATTCAGTCTGTTCCAAGCAGG + Intergenic
1105625721 13:22110731-22110753 AAATTCCGTATTTCCCAACTAGG + Intergenic
1105631871 13:22177451-22177473 AAATTCCTTGGGTCCCAAACTGG - Intergenic
1106145706 13:27048022-27048044 AAGTTTAGTGTTTCCCAAACTGG + Intergenic
1107064638 13:36199949-36199971 AGGTTCAGTATGTGCCAAGCTGG - Intronic
1107089312 13:36459706-36459728 AAATTCAATATATCCCAAACTGG + Intergenic
1107224288 13:38028432-38028454 AAATTCAATATCTCAAAAACTGG - Intergenic
1107570446 13:41651954-41651976 AAATTCAGAATGTTTCACACTGG - Intronic
1110471266 13:75862699-75862721 ACATTCAGTCTTTCCCAAAGGGG + Intergenic
1111248766 13:85576104-85576126 AAATTTATTATGTCCAAACCTGG + Intergenic
1113232995 13:108236635-108236657 ACAGTCACTATCTCCCAAACTGG - Intergenic
1115194577 14:30782524-30782546 TTATTCAGAATGCCCCAAACTGG + Intergenic
1116854526 14:49939821-49939843 AACTTCAGTATCTACCAGACAGG + Intergenic
1117187117 14:53251296-53251318 AAACTTAGTATGTCCAAAGCTGG + Intergenic
1117301210 14:54430095-54430117 ACATTCAGTGTGGCCCACACTGG - Intronic
1121619767 14:95337986-95338008 AAATTCAACTCGTCCCAAACTGG + Intergenic
1123007644 14:105332096-105332118 ATATTCAGTAAGTCCCAAGGAGG - Intronic
1126755193 15:51918925-51918947 AAATTCATTTTTTCCCAAAGAGG - Intronic
1127159962 15:56172056-56172078 AAAATGAGAATGTACCAAACTGG + Intronic
1128864285 15:71102218-71102240 AAACTCAGTGAATCCCAAACAGG - Intronic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1130789521 15:87138500-87138522 AAATTCAGTATTTAAAAAACTGG + Intergenic
1133872883 16:9705916-9705938 AAATTCAGGAGGTCAGAAACTGG + Intergenic
1135524444 16:23203449-23203471 AAGTTCAGTCTATGCCAAACAGG + Intronic
1138888613 16:61113259-61113281 GCATTCACTATGTGCCAAACAGG + Intergenic
1139238391 16:65364172-65364194 GCATTTACTATGTCCCAAACAGG + Intergenic
1143682718 17:8489401-8489423 AAATTCAGTAATTCCAAATCTGG + Intronic
1145832937 17:27931973-27931995 AAACTCAACATGACCCAAACTGG - Intergenic
1147671450 17:42179161-42179183 CAATTCAGAATATCCCAAAGTGG - Intronic
1148463829 17:47852623-47852645 AGTTTGAGTGTGTCCCAAACGGG - Intronic
1150090170 17:62316993-62317015 AAATTCAATATGACCCCAAATGG - Intergenic
1203164740 17_GL000205v2_random:83534-83556 AATCTCAGTGTGTCCCCAACAGG - Intergenic
1155089915 18:22497191-22497213 AAATTATGTATGTTCCATACTGG - Intergenic
1158070567 18:53465575-53465597 AAATTCAGTAATCCCCGAACAGG - Intronic
1158788635 18:60747016-60747038 AAATTCATTAACACCCAAACAGG + Intergenic
1159000751 18:62972879-62972901 AACATCAGTATGTCTCAAACCGG - Intronic
1159382117 18:67674110-67674132 AAACTTAACATGTCCCAAACTGG + Intergenic
1162109540 19:8392576-8392598 AAGTTCAGCTTTTCCCAAACTGG + Intronic
1162326051 19:10000308-10000330 AAATGGAGCATGTCCCAAAGTGG + Intronic
1162802774 19:13120109-13120131 AAACTCAGTCTGTCCCAAAGGGG - Intronic
1163293149 19:16393925-16393947 AAATTCAGTGTTTCCCGGACCGG - Intronic
1164269624 19:23660086-23660108 AAATTCAGTCTGTCCAAAATGGG + Intronic
1165284546 19:34830898-34830920 AAATTCAGTATATGCCGTACAGG + Intergenic
1165399313 19:35587582-35587604 AAAATCAGAATGTCCCAATGGGG + Intergenic
925521557 2:4752075-4752097 AAATGGAATATATCCCAAACTGG - Intergenic
926180645 2:10640065-10640087 ATCTTCAGTATGCCCCAAAGAGG + Intronic
926367730 2:12148617-12148639 TAATTTAGTATTTCCCACACTGG - Intergenic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
926781553 2:16477224-16477246 AAATTCAGTGTGTATCAAAAGGG + Intergenic
928912103 2:36432496-36432518 AAATTCAGTAGGATGCAAACAGG + Intronic
929125457 2:38519316-38519338 AAGTTCAGTGTTTCCCAAACTGG + Intergenic
930180652 2:48352624-48352646 AAATTCAGTGTGTCCGAAATTGG + Intronic
930640424 2:53848848-53848870 AAATTCATTATATTGCAAACTGG + Intergenic
935067761 2:99665554-99665576 AGATTCAGTCTGTGCCCAACTGG - Intronic
936282410 2:111153553-111153575 GAATTCATTATTTCCCAAAACGG - Intronic
937382845 2:121396572-121396594 AAAGCTAGTTTGTCCCAAACAGG + Intronic
939362981 2:141197683-141197705 AACTGCAGTATGTTCCTAACTGG - Intronic
940130244 2:150372846-150372868 AAATTCAGTGTGAGCCACACAGG + Intergenic
940513865 2:154654577-154654599 CAAATCAGTATGTACAAAACCGG + Intergenic
941721273 2:168815821-168815843 AAAGTCAATATGTCTAAAACAGG + Intronic
942354642 2:175096606-175096628 AAAGTGTGTATGTCCCAAAGAGG - Intronic
942479452 2:176368390-176368412 CAACTCAATATGTCCAAAACTGG - Intergenic
943720192 2:191196239-191196261 AAATTCAAAATGTGCCATACTGG - Intergenic
945944496 2:215981767-215981789 TAAGTGACTATGTCCCAAACTGG + Intronic
947344600 2:229177936-229177958 AAAATCAAAATGCCCCAAACTGG + Intronic
1170697486 20:18672521-18672543 AAATATAGTTTGACCCAAACAGG - Intronic
1170751836 20:19155311-19155333 AAATTCAGTATATTCCACAATGG - Intergenic
1176336877 21:5607262-5607284 AATCTCAGTGTGTCCCCAACAGG + Intergenic
1176390880 21:6213686-6213708 AATCTCAGTGTGTCCCCAACAGG - Intergenic
1176407017 21:6375553-6375575 AATCTCAGTGTGTCCCCAACAGG + Intergenic
1176470539 21:7102488-7102510 AATCTCAGTGTGTCCCCAACAGG + Intergenic
1176494100 21:7484266-7484288 AATCTCAGTGTGTCCCCAACAGG + Intergenic
1176506542 21:7654117-7654139 AATCTCAGTGTGTCCCCAACAGG - Intergenic
1177398443 21:20568753-20568775 AAATTCAGTGTGTTCCAAGGAGG + Intergenic
1179295777 21:40061125-40061147 AAATTCAACATGACCCAAATAGG + Intronic
1180682297 22:17636861-17636883 AACTTAAGTATGTACCAAATTGG + Intronic
1181154592 22:20911310-20911332 TAATTCAGTATAACCCAAAGTGG + Intergenic
949117892 3:350082-350104 AAATTCAGTATGTTACTTACAGG + Intronic
949475332 3:4439755-4439777 GCTTTCAGTATGTCTCAAACTGG + Intronic
949666747 3:6347859-6347881 CAATTTAGTTTGTCCCTAACTGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952001966 3:28796416-28796438 AAATTCACCTTGTCCAAAACTGG - Intergenic
957301504 3:78397567-78397589 AAACTCAGTATTTCCAAATCTGG - Intergenic
957318497 3:78599107-78599129 AAATTCAACAAGTACCAAACTGG + Intronic
958928998 3:100189299-100189321 AAAGGTAGTATGTCCCAAATTGG - Intronic
959641187 3:108638230-108638252 TAATCCAGCATGTCCAAAACTGG + Intronic
959809678 3:110601909-110601931 AAATGCAGTATGTCCCAGTGGGG + Intergenic
962622409 3:137192808-137192830 AAAATCATCATATCCCAAACAGG - Intergenic
962855977 3:139344927-139344949 AAATTTAATGTGTCCCAAATAGG - Intronic
963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG + Intergenic
964576267 3:158172210-158172232 AAACTCAGTGAATCCCAAACAGG + Intronic
964636385 3:158862082-158862104 AAAATTAGTATGTCCCAAATAGG - Intergenic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965258937 3:166454888-166454910 AAATTCAGTAGGTTTCCAACTGG - Intergenic
967944817 3:194795712-194795734 AAATAAAGTATTTCCCAGACAGG - Intergenic
970879801 4:20915586-20915608 AAATTCAGTATGTCCTAGAGTGG - Intronic
971913054 4:32821526-32821548 AACTTCACTGTGTCCCAAAATGG - Intergenic
973980856 4:56307048-56307070 AAAGTGAATATGTCCCAAAGGGG + Intronic
974353897 4:60787065-60787087 AAATTAAGTATTTGCAAAACAGG + Intergenic
974845001 4:67341483-67341505 AAACTCAGGATGTGACAAACTGG - Intergenic
976821993 4:89216993-89217015 AAATGCATTGTGTTCCAAACAGG + Intergenic
977303091 4:95290515-95290537 AGATTCAGTGTTTCCTAAACAGG + Intronic
978595807 4:110375733-110375755 AAACTTAGTATGTCCAAAGCTGG - Intronic
981428238 4:144628779-144628801 AAATTAATTATGTCCCAGAAGGG + Intergenic
984066956 4:175060186-175060208 AAAGTCAGTATTTTCCAAAGTGG - Intergenic
987475797 5:18391478-18391500 AAATTCAGTATGAAACAAACTGG - Intergenic
987506093 5:18775081-18775103 AAAATGAGTATGTACCAAAATGG - Intergenic
987957547 5:24761000-24761022 AAATAAAGTATTTCCCAGACAGG - Intergenic
990171300 5:53052993-53053015 AAATTCAATCTGTCCCACACTGG + Intronic
990667617 5:58091715-58091737 AAATACAGTAAGTACCACACAGG + Intergenic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
992332884 5:75735918-75735940 AAATTCAGTAGGACCTAACCTGG - Intergenic
992860401 5:80903485-80903507 AAATCCATTATGACCCATACAGG - Intergenic
994836351 5:104858808-104858830 AATTTCAGTATGACTCTAACTGG + Intergenic
994963270 5:106632714-106632736 AAATTCAGTTTGTCCCCATTAGG - Intergenic
995447026 5:112255846-112255868 AAATTCAACATGTTCAAAACGGG + Intronic
995757327 5:115521592-115521614 AAATTCAGGAGGCCCCAAAAGGG + Exonic
996182731 5:120439579-120439601 AAATTCAGTTTGGCTCAAAGTGG + Intergenic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
998511318 5:142716793-142716815 TAATTCAGGATGTCTCAACCTGG - Intergenic
998559391 5:143157095-143157117 TAAATCAGCATTTCCCAAACTGG + Intronic
999732615 5:154486107-154486129 AAACCCATTATGTCTCAAACTGG + Intergenic
999934084 5:156466194-156466216 AAATTCAGTGTTTCCTTAACTGG + Intronic
1000556422 5:162731712-162731734 AACCTCAGTATTTCCTAAACAGG - Intergenic
1001442269 5:171752213-171752235 AAATGCATTATGTCCCATAGAGG + Intergenic
1002394113 5:178940241-178940263 CAATTCCGTATGTGACAAACAGG + Intergenic
1002530972 5:179844915-179844937 AAACACAGTAAATCCCAAACTGG - Intronic
1003180977 6:3791297-3791319 CCATTCAGTGTTTCCCAAACTGG - Intergenic
1005217550 6:23548975-23548997 AAATTCAGCAAAGCCCAAACAGG - Intergenic
1005401361 6:25437633-25437655 ACACTCAGTATGTCCCACACTGG + Intronic
1009387064 6:63098232-63098254 TAAGTCAGTATATTCCAAACTGG + Intergenic
1011103403 6:83749979-83750001 AAATTCAATAGGTCCAAACCTGG + Intergenic
1013184025 6:107741671-107741693 AAATGCAGAAGGTCCCAAAAAGG - Intronic
1013480227 6:110546646-110546668 AAACTCAGTATGTTCAAAAGTGG + Intergenic
1013885447 6:114959441-114959463 TAATACAGTATGTCTCAAACAGG + Intergenic
1014707491 6:124765678-124765700 AAATTCAGTATCTACCAAGGGGG - Intronic
1014757366 6:125316342-125316364 AAATTCACTATGACCTAAATTGG + Intergenic
1014941862 6:127450212-127450234 AAATTCACTTTGTCCTAAATCGG + Exonic
1015281215 6:131435797-131435819 AAATAAAGTATTTCCCACACAGG + Intergenic
1015853717 6:137601433-137601455 AAATTCAGTATTTCAGAAATAGG - Intergenic
1017473310 6:154761953-154761975 AAATTCAGTATTTTGCATACAGG - Intronic
1018722640 6:166584624-166584646 AAACTCAGTATACCCCAATCTGG + Intronic
1021298076 7:18934313-18934335 AAATTCATTATGGCCAATACAGG + Intronic
1021382907 7:19989984-19990006 CCTTTCAGTATGACCCAAACAGG - Intergenic
1021423350 7:20470548-20470570 AAATTCAGAATGCCCCAAGCTGG - Intergenic
1021800020 7:24295776-24295798 AAGTTCAGTATGTCCAAAATTGG + Intergenic
1022289223 7:28985121-28985143 AAATTCAGTTTCTCTCTAACTGG - Intergenic
1022891636 7:34706977-34706999 AAAATCAGTTTCTCTCAAACAGG + Intronic
1023602566 7:41894419-41894441 AAATGAGGTGTGTCCCAAACTGG - Intergenic
1026587760 7:71670359-71670381 AAAGTCAAAATTTCCCAAACAGG - Intronic
1030235165 7:107251031-107251053 AAAATCAGCAGATCCCAAACAGG + Intronic
1031787435 7:126051393-126051415 AATTTCAGGTTATCCCAAACAGG - Intergenic
1033903834 7:146176513-146176535 AAATTCAGTTTATCATAAACAGG + Intronic
1035177209 7:157060041-157060063 AAATTCACCCTGTCCCAAACTGG + Intergenic
1037241961 8:16787221-16787243 AAATTCAGTGTTTGCCATACCGG - Intergenic
1039322016 8:36442620-36442642 AATTCCAGTATATCCCAAGCAGG - Intergenic
1042236621 8:66619608-66619630 AAATTCAACATGTTCCAAAATGG - Intergenic
1043290917 8:78599528-78599550 AAGCTCAGTATTTCCCAGACTGG + Intronic
1043629339 8:82308994-82309016 AAATTCAGTATCTCATATACTGG - Intergenic
1044970028 8:97610382-97610404 AAAGTTAGTATGTCTCAATCTGG - Intergenic
1046446911 8:114333642-114333664 AAATTCAGAATATCCCATTCAGG - Intergenic
1047037527 8:120955885-120955907 ACATTCAGTCTGTCCAGAACTGG + Intergenic
1047777550 8:128085749-128085771 AATTTCAATATCTCCAAAACAGG - Intergenic
1050342963 9:4659155-4659177 AAATGAAGAATGTACCAAACTGG - Intronic
1051914847 9:22196486-22196508 AATTTCATTATGTACCCAACAGG + Intergenic
1052144597 9:25033086-25033108 AAATACAGTGAGTCCCAAACAGG + Intergenic
1056234441 9:84578443-84578465 AAGCTCAGTAAGTCCCAAATAGG + Intergenic
1056341439 9:85636825-85636847 AAATACAATAAATCCCAAACAGG + Intronic
1058070071 9:100592663-100592685 CAATTCAGTGTGTCCACAACAGG - Intergenic
1059776461 9:117480295-117480317 CAATTCCGTATGTCCCAGTCTGG - Intergenic
1059853087 9:118365084-118365106 AGATTCAGTAAGTCAGAAACTGG + Intergenic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1060683075 9:125582962-125582984 AAAATCAGTATGTCATACACTGG + Intronic
1203424776 Un_GL000195v1:27640-27662 AATCTCAGTGTGTCCCCAACAGG - Intergenic
1186629636 X:11335185-11335207 AAATTCAGCTTGTCCCCAAATGG + Intronic
1187916123 X:24153569-24153591 AAATCCAGTATTACCCAAATTGG + Intronic
1188573404 X:31617000-31617022 AAATTCAGTATGACCCAAATAGG - Intronic
1190088656 X:47418487-47418509 AAAGTCAGTATACCCCAGACTGG - Intergenic
1195513307 X:105742829-105742851 AAATTTAGCTTGTCCCAAACAGG + Intronic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1198453688 X:136793996-136794018 AAACTCAGTATGACCCAAATTGG + Intergenic
1199735124 X:150678935-150678957 ACATTCAGCATATCCCAAACTGG - Intergenic