ID: 1090435029

View in Genome Browser
Species Human (GRCh38)
Location 11:126679470-126679492
Sequence TGACCTCTGTTTTATAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 334}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090435027_1090435029 -5 Left 1090435027 11:126679452-126679474 CCTTTAAGGGAGCTACTATGACC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG 0: 1
1: 0
2: 0
3: 40
4: 334
1090435026_1090435029 -4 Left 1090435026 11:126679451-126679473 CCCTTTAAGGGAGCTACTATGAC 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG 0: 1
1: 0
2: 0
3: 40
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090435029 Original CRISPR TGACCTCTGTTTTATAAAGG AGG Intronic
901270422 1:7948901-7948923 TGATCCCTGTTTTATAGATGGGG + Intergenic
901460483 1:9388302-9388324 TGTCCTCTTTTTTATAGAGGGGG + Intergenic
901828171 1:11876073-11876095 TGATTTCTGTTGTATAAATGAGG + Intergenic
903185087 1:21624381-21624403 TCACCTCTGTTTTACAGATGAGG + Intronic
904489303 1:30848364-30848386 TGACCTCTATTTCATAGACGAGG - Intergenic
904882740 1:33713110-33713132 TTATCTCTGTTTTATAAACAAGG + Intronic
906331853 1:44892034-44892056 TGGCCCCTATTTTATAAAGAAGG + Intronic
907197986 1:52702932-52702954 ATACCTCCTTTTTATAAAGGAGG + Intergenic
908036556 1:60060689-60060711 TAATCTTTGTTTTTTAAAGGGGG - Intronic
908124718 1:61018957-61018979 TGACTTCTGTTTTATCTTGGTGG - Intronic
908575943 1:65460208-65460230 TGATCTCTGTTTTATAGCTGAGG + Intronic
909777972 1:79507497-79507519 TGAACTCTGTCTTTCAAAGGTGG - Intergenic
910199838 1:84688541-84688563 TGACACCGGTTTTATAAAGTAGG - Intronic
910324622 1:85991404-85991426 TAAACTATGTTTTAAAAAGGAGG + Intronic
910375230 1:86561630-86561652 AGACCTCTGTTTTATCAATCAGG - Intronic
911326890 1:96479148-96479170 TTACCTCTATTTTAAAAATGAGG + Intergenic
911472991 1:98341396-98341418 TGATCTCAGTTTTACAAGGGAGG - Intergenic
914216449 1:145634676-145634698 TTACCTCTATTTTACAAATGAGG - Intronic
914374074 1:147057153-147057175 TTATCCCTGTTTTATAGAGGAGG - Intergenic
914469020 1:147957334-147957356 TTACCTCTATTTTACAAATGAGG - Intronic
915608478 1:156970777-156970799 TGATCTCCATTTTATAAATGAGG + Intronic
917552276 1:176045008-176045030 TGACCTCCATTTTATAAATAAGG + Intronic
919399676 1:197096881-197096903 AGATCTCTGTTTTATAAAAAAGG + Intronic
919963303 1:202494307-202494329 TTATCTCTGTTTTATAGATGAGG + Intronic
920281346 1:204846047-204846069 TGACTTCTGATTTAAAAATGGGG + Intronic
920432576 1:205928220-205928242 TCACTCCTGTTTTACAAAGGAGG + Intronic
920713030 1:208313509-208313531 TGTCCTCAGTTTCACAAAGGGGG + Intergenic
921290196 1:213650001-213650023 TGACCCCTGTTTTACACATGAGG + Intergenic
922351986 1:224741847-224741869 TGATCTCTCTTTTATAGATGAGG + Intergenic
923050765 1:230389942-230389964 TCCCCTCCCTTTTATAAAGGAGG + Intronic
924859638 1:247907882-247907904 TCACATCTGTCTTACAAAGGAGG + Intergenic
1063300812 10:4847243-4847265 TTCCCTCTGTTTTAAAAAGAAGG - Intronic
1063756199 10:9012006-9012028 TGACTTCCGTTTAATAAGGGAGG - Intergenic
1063783446 10:9352943-9352965 TGAGCTTGCTTTTATAAAGGAGG + Intergenic
1063959390 10:11294382-11294404 TGCCCTGTGTTTTATAAGTGTGG - Intronic
1067894488 10:50164245-50164267 TTATCCCTGTTTTACAAAGGAGG - Intergenic
1068824232 10:61415551-61415573 TTATCTCTATTTTATCAAGGAGG + Intronic
1070180972 10:74013699-74013721 TTACCTTTGTTTTACATAGGAGG - Intronic
1070210163 10:74309732-74309754 AGACCTGTGTTTTAGACAGGTGG + Intronic
1070519755 10:77242137-77242159 TGACCTCAGTTTCAAAAAGATGG + Intronic
1070773403 10:79095979-79096001 TCCCCTCTGTTTTATAGGGGAGG + Intronic
1070799653 10:79237844-79237866 TCACCCTTGTTTTACAAAGGAGG + Intronic
1072162142 10:92778059-92778081 TTACCCCTGTTTTATAGATGAGG - Intergenic
1072919934 10:99568306-99568328 TTATTTCTGTTTTATAAATGAGG - Intergenic
1073649616 10:105344353-105344375 TTACCTAATTTTTATAAAGGAGG + Intergenic
1074046864 10:109847295-109847317 GGGCCTCTGTTTTAAAAAGAAGG + Intergenic
1074084492 10:110197717-110197739 TGATATTTGTTTTATGAAGGTGG - Intergenic
1074837256 10:117308785-117308807 TTATCTCTGTTTTATATATGAGG - Intronic
1075261335 10:120965915-120965937 TTACATGTGTTTTATAGAGGAGG + Intergenic
1076204220 10:128582192-128582214 TGACATCTGTTTCCTGAAGGTGG + Intergenic
1077407017 11:2387206-2387228 TCAGCTCTGTTTTATAGAGGGGG + Intronic
1078297345 11:10086640-10086662 TTATACCTGTTTTATAAAGGAGG - Intronic
1078357617 11:10644067-10644089 TGAGCTCTTTTTTATAATGATGG + Intronic
1079130447 11:17744162-17744184 CGACCTCTGTATTTTACAGGTGG - Intronic
1079397712 11:20079831-20079853 TGACTTCTGTTTTGTAAAGTGGG + Intronic
1079926102 11:26493618-26493640 TGACTTCAGTATTCTAAAGGTGG - Intronic
1080111710 11:28575407-28575429 TCACCCCTGTTTTACAGAGGAGG + Intergenic
1081946474 11:46999326-46999348 TTATCTCTGTTTTATAGAGGAGG + Intronic
1082938315 11:58677070-58677092 TGACTTCTTTTTTATAACAGGGG + Intronic
1083116008 11:60460326-60460348 TCACCTGTGTTTTATAGAAGAGG - Intronic
1083295302 11:61712133-61712155 TGACTGCTGTTTTATAGGGGAGG + Intronic
1085366827 11:75955512-75955534 TTACCTCGGTTTTTAAAAGGTGG - Intronic
1085811447 11:79686073-79686095 TGGCCTGTTTTTTTTAAAGGGGG - Intergenic
1085869631 11:80334099-80334121 TGTCCTCCGTTTTACAAATGAGG + Intergenic
1085905624 11:80758321-80758343 TTACCTCAGTTTTACAGAGGAGG + Intergenic
1086669141 11:89526412-89526434 TCATCTCTGTTTTATAAAGAAGG - Intergenic
1087287751 11:96283797-96283819 TTACCTCTGCTTTATAAAAGTGG + Intronic
1087568874 11:99897498-99897520 TGACATTTTTTTTTTAAAGGAGG - Intronic
1089300771 11:117497485-117497507 TCACCTCTGTTTGATGAAGCAGG + Intronic
1089876215 11:121724132-121724154 TTACTCCTGTTTTACAAAGGAGG - Intergenic
1089980024 11:122764599-122764621 TGACCTCTGTTGATGAAAGGTGG + Intronic
1090039428 11:123276999-123277021 TCACCCCTGTTTTATAGATGAGG - Intergenic
1090101488 11:123801908-123801930 TGACATCAGTTTCTTAAAGGGGG + Intergenic
1090407047 11:126482664-126482686 AGACCTCTGCTTTACCAAGGGGG - Intronic
1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG + Intronic
1091715583 12:2774033-2774055 TTACCTCTGTTTTTCAAATGAGG + Intergenic
1091787105 12:3249727-3249749 TTACCTTTGTTTTATGAATGAGG + Intronic
1091805091 12:3350231-3350253 TTGCTTCTGTTTTATAAATGAGG + Intergenic
1092394962 12:8117801-8117823 AGAGCTCTGTTTCATAAAGTGGG + Intergenic
1093111563 12:15158823-15158845 TGAACTTTATTTTATTAAGGTGG + Intronic
1093444129 12:19234929-19234951 TGATTTATGTTTTTTAAAGGGGG + Intronic
1095206940 12:39449049-39449071 TGACTTGTGTTTTATAAGTGTGG - Intergenic
1095578482 12:43766711-43766733 TCATCTCTATTTTACAAAGGTGG - Intronic
1099569588 12:84299645-84299667 TGATCTCTGGTTTAAAAAAGTGG + Intergenic
1099725007 12:86414459-86414481 TGCCCTGCATTTTATAAAGGAGG - Intronic
1099895316 12:88638766-88638788 TGACCTCTGTTATTTGAGGGAGG + Intergenic
1099946476 12:89250412-89250434 TTAGCTCTGTTTTATAACAGAGG - Intergenic
1100086072 12:90912685-90912707 TTAGATCTGTTTTATAAAGATGG - Intronic
1100594660 12:96061520-96061542 TTATCTCTGTTTTATAGAGGAGG - Intergenic
1100615000 12:96224213-96224235 TGATTCCTGTTTTATAAACGAGG - Intronic
1100878665 12:98992276-98992298 TGACTTCTGAATAATAAAGGAGG - Intronic
1102946112 12:116989848-116989870 TGAACTCTATTTTACAAATGAGG - Intronic
1106806755 13:33316535-33316557 TAATCTCTATTTTATAAATGTGG + Intronic
1108990746 13:56654480-56654502 TCACCTCTGTGTTATATTGGAGG - Intergenic
1109459212 13:62632616-62632638 TGACATTTGTTTTATTAAAGTGG - Intergenic
1113847611 13:113401603-113401625 GGACCCCTGATTTATAGAGGAGG + Intergenic
1115873787 14:37837697-37837719 TTACCTTTGTTTTATAGATGAGG + Intronic
1116954634 14:50911419-50911441 TTTCCTCTGTTTTATAGAGCGGG + Intronic
1117191500 14:53296637-53296659 TGACCTATGTTTTGTGAAGACGG + Intergenic
1117453065 14:55870940-55870962 TCACCTCCATTTTATGAAGGAGG + Intergenic
1119732099 14:76957395-76957417 TCACCTCTATTTTATAAGTGTGG - Intergenic
1120176326 14:81297287-81297309 TTACCTCTATTTTAGTAAGGGGG + Intronic
1120444017 14:84570957-84570979 TGACTTCTGTTTAATATATGTGG - Intergenic
1121190030 14:92019000-92019022 TTACCTCTATTTTATAAATAAGG - Intronic
1121260631 14:92563509-92563531 TGATCTCTATTCTATAAGGGAGG + Intronic
1121607424 14:95251592-95251614 TTATCTCTGTTTTGTAGAGGAGG + Intronic
1124127654 15:26951664-26951686 TAACCTCTATTTTATAAACAGGG + Intergenic
1125162178 15:36657814-36657836 CTACTTCTGTTTTATAAAGGTGG + Exonic
1125747383 15:42006191-42006213 TGACCTCTGTCCTAGCAAGGAGG + Intronic
1126652935 15:50944295-50944317 TTACCTCTGTCATATACAGGAGG + Intronic
1126711593 15:51462758-51462780 TGACCTCTTCCTTATAAAAGTGG - Intronic
1127557182 15:60099195-60099217 TGACCTCCGTTTTACAAGGGAGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128151267 15:65364950-65364972 TGCCCTCTGGTTCAGAAAGGAGG - Intronic
1128232760 15:66047097-66047119 TGACCTCTGCCTTTTAAAGGAGG + Intronic
1128798249 15:70480121-70480143 TGATCTCTGTTTTACAGACGAGG - Intergenic
1129707930 15:77805258-77805280 TGTACTCTGTTTTAGAGAGGAGG - Intronic
1130083152 15:80752506-80752528 CCACCTCTGTTTTATCAAGGAGG - Intronic
1130136198 15:81183850-81183872 TGACCACCGTTTTGCAAAGGAGG - Intronic
1133431513 16:5741039-5741061 TCACCTCTGTTTTGTAGATGGGG + Intergenic
1133974893 16:10593670-10593692 TGACCCCTGTTTTACAGATGAGG + Intergenic
1134242153 16:12513998-12514020 TGAACTCTGCTTTATAACGGGGG - Intronic
1138085129 16:54126637-54126659 TGAGCACTGTTGTATAAAAGAGG + Intergenic
1138336412 16:56257082-56257104 TGATCTCTGTTTTATTAAAAGGG - Intronic
1138408134 16:56815322-56815344 ATAGCTCTGTTTTAGAAAGGTGG + Intronic
1138942990 16:61812898-61812920 TGATTTCAGTTTTATAAAGAAGG - Intronic
1139194737 16:64905815-64905837 TTACCTCTATTTTATTAATGAGG + Intergenic
1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG + Intronic
1141373637 16:83509570-83509592 TGACCTCTGATTTAAAGAGTGGG + Intronic
1141398531 16:83726237-83726259 TGACCTCTGTTTTTTAGATGGGG + Intronic
1142887282 17:2920596-2920618 TGAGCTCCGTTCTATAAATGAGG - Intronic
1144740996 17:17582147-17582169 GGACCTCTGTTGTATGAAGGAGG - Intronic
1145783965 17:27582179-27582201 GGATCTCTGTTTTACAGAGGAGG - Intronic
1145976391 17:28986502-28986524 TGGCCTCTGTCTTATAGATGGGG + Intronic
1146833098 17:36087460-36087482 TCACCACTGTTTTCTAAATGTGG - Intergenic
1146847622 17:36194081-36194103 TCACCACTGTTTTCTAAATGTGG - Intronic
1147500478 17:40958555-40958577 TGGCCTCTGTTTCATAAATGTGG + Exonic
1148533049 17:48413670-48413692 TGACCTTGGTTAAATAAAGGAGG - Intronic
1149880150 17:60281650-60281672 TTATCCCTGTTTTACAAAGGAGG + Intronic
1150501444 17:65654533-65654555 CGACCTCTGTTGTTTGAAGGTGG + Intronic
1151195297 17:72426966-72426988 TGATCTCCATTTTATAAATGTGG + Intergenic
1151324533 17:73370755-73370777 TGATTTCTTTTTTAGAAAGGGGG + Intronic
1151362576 17:73597392-73597414 TGATCTCAGTTCTATAAAGCAGG + Intronic
1153726295 18:7959057-7959079 TCACCTCTGTTTTATAGATAAGG - Intronic
1155581512 18:27313394-27313416 TGTATTCTGTTTTATAAAAGAGG - Intergenic
1156371954 18:36479151-36479173 TAACCTCTGTTTTACAGAGATGG + Intronic
1156484160 18:37454317-37454339 TGGGCTCTGTTCTATGAAGGAGG + Intronic
1156632961 18:38992640-38992662 TGAACTTTGATTTCTAAAGGTGG - Intergenic
1158360903 18:56671970-56671992 TGACCTGTCTTTTTTAATGGAGG + Intronic
1158653215 18:59306173-59306195 TGGCCTCTCCTTAATAAAGGAGG - Intronic
1159602430 18:70441433-70441455 TTATCTCTATTTTATAAATGAGG - Intergenic
1161314554 19:3611747-3611769 TGACCCCCCTTTTATATAGGAGG + Exonic
1164823163 19:31265571-31265593 TGGCCTCAGTTTGCTAAAGGGGG - Intergenic
1165959322 19:39521070-39521092 TGACGTCTATTTTATGGAGGAGG - Intergenic
1166145323 19:40830578-40830600 TGACCTGTCTTTTAGAAGGGTGG + Intronic
1167523158 19:49969044-49969066 TGATCTGTGTTTTGTAAATGAGG - Intergenic
1167954979 19:53057324-53057346 TGAGCTCTGTTTTCTGAATGTGG - Intergenic
925254271 2:2468872-2468894 TGACCTCTGCTTGATCTAGGTGG + Intergenic
926263677 2:11293367-11293389 TGAACTCTTTTTTACAAACGAGG - Intronic
928104075 2:28456371-28456393 TGAGCTCTGTTTTACAAGGAGGG - Intergenic
928202158 2:29254824-29254846 TGTCCTCCATTTCATAAAGGAGG + Intronic
929244653 2:39687982-39688004 TTACCTCTGTTTTACAGAGAAGG - Intronic
929663957 2:43818870-43818892 TGATCTCTTTTTTATAAATGAGG + Intronic
930048298 2:47193160-47193182 TTAGCTCTGTTTTACAAATGAGG + Intergenic
930048837 2:47197972-47197994 TTATCTCTATTTTATATAGGAGG - Intergenic
931123700 2:59250064-59250086 TGTCCTCTGGGTGATAAAGGAGG + Intergenic
931596879 2:63956779-63956801 TGTCCTCTGTTGTAGAATGGCGG + Intronic
931641073 2:64381716-64381738 TTACCTCTGTTGTATAGATGAGG + Intergenic
931969900 2:67574553-67574575 TTAGCTCTGTTTTATAAAGAAGG - Intergenic
932099146 2:68880656-68880678 TCATCTCTGTTTTACAAATGAGG + Intergenic
935010958 2:99135685-99135707 TCATCCCTGTTTTATAAATGAGG - Intronic
936024384 2:109020335-109020357 TGATCTCTGTTTTGTAAACCGGG - Intergenic
936449039 2:112619633-112619655 TGCCCTCTGTTTTATGGATGTGG - Intergenic
936706848 2:115085654-115085676 GGAACACTGTTTTTTAAAGGGGG - Intronic
937182026 2:120005215-120005237 TTATCTCTATTTTATAAATGAGG + Intergenic
940066487 2:149635745-149635767 TTATCTCTGTCTTATAAATGAGG + Intergenic
940098631 2:150007667-150007689 TCACCTTTATTTTATAAGGGTGG + Intergenic
940290409 2:152072951-152072973 TTACCTCTGTTTTATAGGGTTGG + Intronic
940357468 2:152760990-152761012 TTACCTCAGTTTTAGAAAGATGG + Exonic
940560343 2:155287757-155287779 TTACCTCTGTTTTCTCAAGCAGG - Intergenic
940994041 2:160127902-160127924 TTCCCTCTGTTTTATAGATGAGG - Intronic
941250402 2:163154339-163154361 TGTCCTCTATTTTCTGAAGGTGG - Intergenic
941371805 2:164674524-164674546 TTACCTCTGTCTTATAAATGAGG - Intronic
941398804 2:165005177-165005199 TGGTTTCTGCTTTATAAAGGTGG + Intergenic
941993996 2:171584255-171584277 TTATCTCTGTTTTATAAGTGAGG + Intergenic
942909887 2:181230544-181230566 TCAACTTTGTTTTATTAAGGAGG - Intergenic
943474207 2:188334322-188334344 TTATTTCTGTTTTACAAAGGAGG + Intronic
943607651 2:189995266-189995288 TTAAGTCTGTTTTATAAATGTGG + Intronic
944511330 2:200469057-200469079 TTACCTCTGTTTTACAGATGGGG - Intronic
944981032 2:205120249-205120271 TTACTTCTGTTTTATAGAGGTGG + Intronic
946491544 2:220153588-220153610 AAACCTCTGTTTTATTAAGTAGG + Intergenic
946670988 2:222104355-222104377 TGCCCTCTGTTAGATAAAGACGG + Intergenic
946822235 2:223642250-223642272 TGAGCTCTGTTTTATGAACAAGG + Intergenic
946985328 2:225265847-225265869 TGACCTCTCATTTATAGATGAGG - Intergenic
947187426 2:227467595-227467617 TTACCGCTGTTTTATATATGAGG - Intergenic
948056142 2:235010453-235010475 TGACCTCTATTTCACAAATGAGG - Intronic
1170210859 20:13845207-13845229 TGACCTCTGTTTAACACAGGAGG - Intergenic
1172931453 20:38589155-38589177 TTACCTCTGTTTTACACATGGGG + Intergenic
1173047178 20:39523666-39523688 AGGCAGCTGTTTTATAAAGGAGG + Intergenic
1173957121 20:47042192-47042214 TCACGTCTATTTTATAGAGGAGG + Intronic
1174576148 20:51539054-51539076 TCACCCCTGTTTTATGGAGGAGG - Intronic
1174750567 20:53107337-53107359 TGATATCTGTTTTATAGATGAGG - Intronic
1177060350 21:16365891-16365913 TTAGCTTTGTTTTAAAAAGGAGG - Intergenic
1179828817 21:43983313-43983335 AACCCTCTGTTTTTTAAAGGTGG + Exonic
1183100663 22:35581949-35581971 TTACCTCTGTTTTATGGATGAGG - Intergenic
1183991162 22:41597844-41597866 TCACCACTGGTTTATAAAGATGG - Intergenic
949919267 3:8988459-8988481 TGACCTCTGTTAGTGAAAGGGGG + Intronic
950978305 3:17274243-17274265 TGACCTCTGATTAAACAAGGAGG - Intronic
952727254 3:36599725-36599747 GGAGCTCCGTTTTAAAAAGGAGG - Intergenic
953571476 3:44075159-44075181 TGACCTCTGTTTTACAACAGGGG - Intergenic
956124851 3:66001563-66001585 TTATCCCTGTTTTATACAGGGGG + Intronic
956286682 3:67617726-67617748 TATCCTCTATTTTATAAATGAGG - Intronic
956428758 3:69163806-69163828 TAACCACTATTTTATAAAGATGG + Intergenic
956621853 3:71229019-71229041 AGACCTGTATTTTATAAAGGGGG + Intronic
958645690 3:96870332-96870354 GGAGCTCTGATTTCTAAAGGCGG + Intronic
958730623 3:97956865-97956887 TGATCTCTGTTTTAATAAAGAGG + Intronic
960456555 3:117879798-117879820 TGGTCTCTGCTTTATAAAGCAGG - Intergenic
960796983 3:121497899-121497921 TTACCTCTCTTTTGTAAAGAAGG - Intronic
961975176 3:131016771-131016793 TGACCTCTGTGTTTTATAGGAGG + Intronic
962048586 3:131787846-131787868 TGCCCTTTATCTTATAAAGGTGG + Intronic
962527388 3:136249114-136249136 TGACCAATGTTTGATCAAGGAGG - Intergenic
962658869 3:137580359-137580381 TCATCTCTGTTTCATAAAAGAGG + Intergenic
962813965 3:138982050-138982072 TGATCCCTGTTTTATAGATGAGG - Intergenic
963278538 3:143357744-143357766 TGATCCCAGTTTTATAAATGAGG - Intronic
964174401 3:153808478-153808500 TGAACTCTTTTTTATAAAGTAGG + Intergenic
964657083 3:159079222-159079244 TGAACTCTGTTTTAAACTGGGGG - Intronic
964953313 3:162323862-162323884 AGACCTCTTCTTTAGAAAGGAGG + Intergenic
966218136 3:177523602-177523624 TAACCTCAGTTTTATAGAAGTGG - Intergenic
966260674 3:177974918-177974940 TGACCTCTGTTAAACTAAGGTGG - Intergenic
967223088 3:187265647-187265669 TGACCTCTGTTTCCTATAGAAGG - Intronic
967344638 3:188441183-188441205 TGAGCTCCATTTTATAAAGATGG + Intronic
968957232 4:3725634-3725656 TCAGCCCTGTTTTATAGAGGGGG + Intergenic
970380747 4:15505010-15505032 TTACCCCTGTTTTATAGAGGCGG - Intronic
970918892 4:21369713-21369735 TTACCTCTATTTTACAAAAGAGG + Intronic
971154726 4:24069120-24069142 TGATCTCTACTTTATAAAGAGGG + Intergenic
971282514 4:25252587-25252609 TGACCTTTGTTTTGGAAAAGAGG - Intronic
971629291 4:28969118-28969140 ATACCTCTATTTTATAAATGAGG + Intergenic
973116684 4:46469008-46469030 TTATCTCTGTTTTATAGAAGAGG - Intronic
974416902 4:61619828-61619850 TGAACTCTGTGTTATGGAGGAGG + Intronic
974830880 4:67187952-67187974 TACCCTTTGTTTTATAAATGAGG - Intergenic
975274961 4:72486175-72486197 TCATTTCTGTTTTATAAATGAGG + Intronic
976130216 4:81876195-81876217 TTTCCTCTGCTTTATAAAAGAGG - Intronic
976577590 4:86692591-86692613 AGACCACTGTTTTATTCAGGTGG - Intronic
977286614 4:95115769-95115791 TTACCTCTGTTTTTCAATGGAGG - Exonic
978171783 4:105680101-105680123 TCATCTGTGTTTTATAAAGGAGG + Exonic
979186170 4:117796704-117796726 TGTCTTCTATTTTATAAACGAGG + Intergenic
980331212 4:131414256-131414278 TAAACTCTGTTTGAAAAAGGCGG - Intergenic
981508481 4:145528925-145528947 TTACCTCTACTTTATAAAAGTGG - Intronic
983787479 4:171751789-171751811 TGGTCTCTGTTTGAGAAAGGAGG - Intergenic
984876704 4:184374870-184374892 TGATTTCTGTTTTATATTGGTGG + Intergenic
986835187 5:11629366-11629388 TGACAGCTGTTTTCTACAGGTGG + Intronic
987285536 5:16452559-16452581 TCATCTCTGTTTTATAAATGAGG + Intronic
987629289 5:20446920-20446942 TTACATCTGTTTTCTAAAGGTGG - Intronic
987731993 5:21785664-21785686 TGTCTTCTGTTCTATGAAGGTGG + Intronic
987743386 5:21938312-21938334 TGACCTCTGTGTTTTAAATGAGG - Intronic
988168927 5:27630573-27630595 TGACCTTTGTATTATAAGGGGGG - Intergenic
988454941 5:31379223-31379245 TGGCCCATGGTTTATAAAGGAGG - Intergenic
988533773 5:32048520-32048542 TCTCCTCTGTTTTCTCAAGGGGG + Exonic
990894636 5:60685497-60685519 TGTACTCTATTTTTTAAAGGGGG + Intronic
991609431 5:68435280-68435302 TTAACTCTGTTTTATAGATGAGG + Intergenic
991617251 5:68509706-68509728 TTACATCTATTTTATAAAGGAGG + Intergenic
991749526 5:69786187-69786209 TGACCTCTGTGTTTTAGATGAGG + Intergenic
991763583 5:69948453-69948475 TGACCTCTGTGTTTTAGATGAGG - Intergenic
991783742 5:70169676-70169698 TGACCTCTGTGTTTTAGATGAGG + Intergenic
991801106 5:70366005-70366027 TGACCTCTGTGTTTTAGATGAGG + Intergenic
991827494 5:70644041-70644063 TGACCTCTGTGTTTTAGATGAGG - Intergenic
991842813 5:70823513-70823535 TGACCTCTGTGTTTTAGATGAGG - Intergenic
991876188 5:71170051-71170073 TGACCTCTGTGTTTTAGATGAGG + Intergenic
992889112 5:81187694-81187716 TGCCCTCTGACTTATTAAGGTGG + Intronic
993156942 5:84237569-84237591 GGACTTCTGTCTTATAAATGAGG + Intronic
993994054 5:94699062-94699084 ATACTTCTGTTTTAAAAAGGGGG - Intronic
994010717 5:94899194-94899216 TGACATCTGTTTTATACTGATGG + Intronic
996524536 5:124464214-124464236 TAAGCCCTATTTTATAAAGGAGG + Intergenic
996989947 5:129617007-129617029 TGACTTCTATTTTACAAATGAGG - Intronic
997621355 5:135298368-135298390 TAACCTCTGTTTTACAGATGAGG - Intronic
998684862 5:144512847-144512869 TGATCTCCATTTTATAAATGAGG - Intergenic
999245868 5:150154416-150154438 TTACCTCCGTTTTATACATGAGG - Intronic
999302369 5:150499127-150499149 TGACCTCTGTTTTCTTAAAAGGG - Intronic
999619469 5:153457923-153457945 ATACCTCTGTATGATAAAGGAGG + Intergenic
999740294 5:154544869-154544891 TCATTTCTGTTTTATAAATGAGG - Intergenic
1001007942 5:168071163-168071185 TCACCTCTGGTTTATAGATGAGG - Intronic
1003157292 6:3607591-3607613 AAACCTGTGTTTTATAAAGGAGG + Intergenic
1005315482 6:24599246-24599268 TGACCTGTGTTATACAAAGATGG + Intronic
1005323779 6:24680202-24680224 TGACCTCTTCTGTAGAAAGGAGG - Intronic
1007663344 6:43499916-43499938 TTACCTCAGTTTTATAAATGAGG + Intronic
1007688904 6:43685161-43685183 TGTCCTCATTTTTATAAATGAGG - Intronic
1008618334 6:53247292-53247314 TGACCCCTGATTTGTAGAGGAGG + Intergenic
1010198363 6:73262189-73262211 TCACCTCTGGTTTACAAAGAAGG - Intronic
1010603061 6:77854835-77854857 TTTCCTCTGTTTTATAGATGAGG + Intronic
1011840854 6:91497041-91497063 TGAACTCTGTTTTATTAATAAGG + Intergenic
1014695458 6:124615199-124615221 TGGTATCTATTTTATAAAGGGGG - Intronic
1015206686 6:130648363-130648385 TTACCTCTCTTTTATATATGAGG + Intergenic
1015848856 6:137551186-137551208 AGACCTCTGTCTCATAAATGAGG - Intergenic
1016559209 6:145375929-145375951 TGACCTGTGTTTTCCAAAGAGGG - Intergenic
1017030981 6:150221715-150221737 TTACCTCCATTTTATAGAGGAGG - Intronic
1017446713 6:154512636-154512658 TGACCTTTCTTTTATAATTGTGG - Intergenic
1017694314 6:156999357-156999379 TGACCTTCGTTTTATACATGAGG - Intronic
1018281456 6:162190349-162190371 TGGACTCTGTTTTCTAAAGTGGG - Intronic
1019987700 7:4669771-4669793 TTACCCCGGTTTTATAAATGAGG - Intergenic
1022012045 7:26316670-26316692 TGATCACTGTTTTATAGATGAGG + Intronic
1023504340 7:40884598-40884620 TGACCTCTGCTTGAAAAATGCGG - Intergenic
1024504587 7:50151129-50151151 TGAGCTCTGTTTCATAATGAAGG - Intronic
1027606616 7:80307417-80307439 TTACCCCTATTTTATAAATGAGG + Intergenic
1028247436 7:88498142-88498164 TGATGTCTGTTTTATAAAAAAGG - Intergenic
1028309696 7:89316135-89316157 GGATCTCTGTGTTACAAAGGTGG + Intronic
1028420181 7:90624095-90624117 TCATCTCTGTTTTGTAGAGGTGG + Intronic
1028611095 7:92712265-92712287 TGAACTCTATCTTATAAATGGGG + Intronic
1028772435 7:94641656-94641678 TTACTTCTGATTTATTAAGGTGG - Intronic
1029960147 7:104681691-104681713 TTACCCCTGTTTTACAAAGAAGG + Intronic
1029982739 7:104894463-104894485 TGTCTTCTGTTTTATGAATGTGG - Intronic
1030592532 7:111499796-111499818 TGGGCTCTTTTTTAAAAAGGAGG + Intronic
1031426871 7:121615854-121615876 TGACCTAGGAATTATAAAGGAGG - Intergenic
1032792256 7:135251251-135251273 TGATTCCTGTTTTATAGAGGAGG + Intronic
1033186778 7:139233286-139233308 TGACCTCAGATTTATAAAGAAGG - Intronic
1033818106 7:145100124-145100146 TCACCTCTGCTTTATAGATGTGG + Intergenic
1034123799 7:148652900-148652922 TGACCTCTGTTATAGAAAATGGG - Intergenic
1035037906 7:155907339-155907361 TTACCTCTGTTCTACAGAGGGGG + Intergenic
1035679571 8:1478130-1478152 TGCCCTCTGTTTTTTAAATCTGG + Intergenic
1038125119 8:24664799-24664821 TTATCTCTGTTTTATAAATGAGG - Intergenic
1038589997 8:28828483-28828505 TCACTTCTATTTTATGAAGGAGG + Intronic
1038624260 8:29175430-29175452 TTTCCTCTGTTTTAAAATGGAGG + Intronic
1039135180 8:34314228-34314250 TGACTTCGGTGTGATAAAGGAGG + Intergenic
1039194011 8:35010024-35010046 TTAATTCTGTTTTATAAAGCAGG + Intergenic
1041663991 8:60424768-60424790 AGACCTCTTTTCTAGAAAGGAGG - Intergenic
1042121590 8:65494259-65494281 TTACCTCTGTTCTATAAATGGGG + Intergenic
1042632397 8:70832713-70832735 TTAGCTCTGTTTTACAAATGAGG + Intergenic
1042827936 8:72997128-72997150 TGACCTCCCTTTTACAAAGAAGG + Intergenic
1043234586 8:77846844-77846866 TGACCTTTTTTTTTTTAAGGAGG + Intergenic
1045758503 8:105573912-105573934 TAACCCCTATTTTATAAAAGAGG - Intronic
1046083807 8:109406384-109406406 TGACCTCTGGTCTATAAAACCGG + Exonic
1046169178 8:110483172-110483194 TGTACTCTGCATTATAAAGGTGG + Intergenic
1046224927 8:111265627-111265649 TGAACTGTGGTTTATAAAGCAGG - Intergenic
1046726415 8:117679274-117679296 TGACCCTTATTTTATAAATGAGG - Intergenic
1047799797 8:128296913-128296935 TCATCTCTATTTTATAAATGAGG + Intergenic
1047923189 8:129656241-129656263 TCAGCTCTGTTTAATACAGGAGG - Intergenic
1048212022 8:132462706-132462728 TGGCCCCTGTTTTATCAATGGGG - Intronic
1048259959 8:132936969-132936991 TGACTCCTGTTTTACTAAGGAGG - Intronic
1048530438 8:135243136-135243158 TAACCTCTGTTTTGTAGAGCAGG - Intergenic
1049141196 8:140955995-140956017 CGACCTCTGTTTTGTACAGTTGG - Intronic
1050560897 9:6833590-6833612 TCAACACTGTTTTATAAATGAGG - Intronic
1050583015 9:7080876-7080898 TGACCACTAGTTTATAAAAGAGG + Intergenic
1050824062 9:9921864-9921886 TTACCTCCATTTTATAAATGAGG + Intronic
1051558043 9:18406873-18406895 TGACCCCTGTTTTACAAATGAGG - Intergenic
1051756833 9:20410423-20410445 TGATCTCCATTTTATAAAAGAGG + Intronic
1053259230 9:36647312-36647334 TGACATCTCTTTCAAAAAGGTGG + Intronic
1054235806 9:62556474-62556496 TGACCACTTTTTAATAAAAGTGG - Intergenic
1054903511 9:70393684-70393706 TGAGCTCTGTTCTGAAAAGGAGG - Intronic
1055423121 9:76164366-76164388 TTACATCTATTTTATAAATGAGG - Intronic
1055620721 9:78122298-78122320 TGACCTGAATTTTATAGAGGAGG + Intergenic
1057330241 9:94107325-94107347 TTATCTCTGTTTTACAAAGGAGG + Intronic
1058373037 9:104292438-104292460 TCATGCCTGTTTTATAAAGGAGG + Intergenic
1058624212 9:106917444-106917466 TGGCCTCTGTTGTATACAGTTGG - Intronic
1059868057 9:118538783-118538805 TTAACTCTATTTTATAAATGAGG + Intergenic
1060254475 9:122015045-122015067 TGATCTCTGATTTACAAATGAGG - Intronic
1188691463 X:33134171-33134193 TGAGCTCTGTTTGATGAAGGAGG - Intronic
1188926332 X:36049195-36049217 TCATCTCTGTTTTATAGAAGAGG + Intronic
1188960379 X:36483867-36483889 TAACTTCTGTTTTATTGAGGAGG - Intergenic
1192261446 X:69508102-69508124 TGATCCCTGTTTTACAAATGAGG - Intronic
1193965702 X:87983421-87983443 TGACTTCTCTATTATACAGGTGG - Intergenic
1194377120 X:93150489-93150511 TAAACTCTGTTTTATATTGGGGG + Intergenic
1194804185 X:98307014-98307036 TTATCTCTGTTTTATAAATGAGG + Intergenic
1195316509 X:103684753-103684775 TCACCTCTGTTTCATATACGAGG + Intronic
1196199080 X:112865248-112865270 TGTCATCTGTTTTAAAAAGCAGG + Intergenic
1196393786 X:115237713-115237735 TGATCTCTGGTTTATAGATGAGG - Intergenic
1196931753 X:120688474-120688496 TGCCCTCTCTATTATAAAAGAGG + Intergenic
1196988274 X:121298976-121298998 AGGCCTCTGATCTATAAAGGAGG + Intergenic
1197634212 X:128896560-128896582 TCACAACTGTCTTATAAAGGTGG - Intergenic
1197696306 X:129554056-129554078 TGGCATCTGTTTGATAAAAGGGG + Intronic
1197802869 X:130370543-130370565 AGACCCCTGTTGTATAAAGTAGG + Intronic
1198619233 X:138488214-138488236 TGACCTGTGTTGTACAAAGATGG - Intergenic
1200204903 X:154308838-154308860 TGACCTGAGTTTTATAAACCAGG + Intronic
1201766398 Y:17576962-17576984 TGGCCACTGTTATTTAAAGGTGG - Intergenic
1201835154 Y:18329027-18329049 TGGCCACTGTTATTTAAAGGTGG + Intergenic
1202298953 Y:23390195-23390217 TTATCTCTGTTTTATAGATGAGG + Intergenic
1202571856 Y:26280403-26280425 TTATCTCTGTTTTATAGATGAGG - Intergenic