ID: 1090435498

View in Genome Browser
Species Human (GRCh38)
Location 11:126683622-126683644
Sequence ATGATTGGCCAGGGCATTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090435493_1090435498 8 Left 1090435493 11:126683591-126683613 CCTGACAATACTAAGTGTTCAAC 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1090435498 11:126683622-126683644 ATGATTGGCCAGGGCATTGACGG 0: 1
1: 1
2: 0
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090435498 Original CRISPR ATGATTGGCCAGGGCATTGA CGG Intronic
901068978 1:6507936-6507958 ATGGCTGGCCAGGCCATGGATGG - Intronic
904037276 1:27565523-27565545 ATGTTTGTCCAGGGCATGGGTGG - Intronic
904812448 1:33172321-33172343 AGGATGGGCCAGGGCATTGCAGG + Intronic
908915793 1:69124688-69124710 AGGATAGGCCTGGGCATTGAAGG + Intergenic
912591985 1:110831604-110831626 ATGATTGCCTAGGGCTTGGAGGG + Intergenic
912725781 1:112057846-112057868 ATGAGTATCCAGGGCTTTGAAGG - Intergenic
916078963 1:161220227-161220249 ATGAATGGCGAGGGTCTTGAAGG + Intronic
919517677 1:198547267-198547289 ATGATTGCCCAGGCCACTTATGG + Intergenic
919539297 1:198828701-198828723 ATGATTGACCAGAGATTTGATGG - Intergenic
920206542 1:204296439-204296461 ATGATGGTGCAGGGCATTGGAGG - Intronic
920252440 1:204630674-204630696 GGGAATGGCCAGGGCATTGGAGG - Intronic
920791208 1:209094741-209094763 CTGATTGGGCAGGGGATTGTGGG - Intergenic
1067249630 10:44575751-44575773 ATGACTGCCCAGGGCATAGAGGG - Intergenic
1068776679 10:60874985-60875007 ACGAGTGGCGTGGGCATTGACGG - Exonic
1072618117 10:97063123-97063145 ATGAGTGGACAAGGCAATGAGGG + Intronic
1073107737 10:101042125-101042147 AAGATTGGCCAGGGCACTAGTGG + Intergenic
1074970489 10:118532568-118532590 ATGATGGCACAGGACATTGAAGG - Intergenic
1078116905 11:8462817-8462839 ATGATTTGGCAGGGCGGTGATGG - Intronic
1078669484 11:13352275-13352297 ATAAATGGCCAGGGGAATGAAGG + Intronic
1080639649 11:34151403-34151425 ATTAAAGGACAGGGCATTGATGG - Exonic
1082013794 11:47469348-47469370 TTGAGTGGCCAGGGCCTGGATGG - Intronic
1085385665 11:76156888-76156910 ATGTTTGGCCTGGGCTGTGAAGG + Intergenic
1087345817 11:96969501-96969523 ATGCCAGGCCAGGGTATTGAAGG + Intergenic
1090395070 11:126413670-126413692 ATGGTGGGCCAGGGCGTGGACGG + Intronic
1090435498 11:126683622-126683644 ATGATTGGCCAGGGCATTGACGG + Intronic
1091901229 12:4145641-4145663 ATGACTGGCCATGAAATTGAAGG - Intergenic
1092086971 12:5770610-5770632 GTGTTTGGCCAGGGTATTGGTGG - Intronic
1093065396 12:14652873-14652895 ATCAGGGGCCAGGGCAATGAGGG + Intronic
1096810309 12:54165124-54165146 ATGATTGGAAAGGGAATTAAGGG - Intronic
1101304646 12:103515583-103515605 ATGAGAGGCCAGAGCACTGAGGG - Intergenic
1102191035 12:110988534-110988556 AGGGATGGCAAGGGCATTGATGG - Intergenic
1102500906 12:113351869-113351891 GTGATTGGCCAGGGGGTGGAGGG - Intronic
1103790729 12:123468993-123469015 ATGGTAGACCAGGGCATTGTAGG + Intronic
1105782527 13:23716659-23716681 AGGGTGGGCCAGTGCATTGAGGG + Intergenic
1112066476 13:95798574-95798596 ATGATGGTCCAGGGCTTTGATGG - Intergenic
1113884178 13:113649277-113649299 ATGATTTGGCAGGGAACTGACGG + Exonic
1115025936 14:28746321-28746343 ATGATTGGTCATGGAATTTAAGG - Intergenic
1115453839 14:33578568-33578590 ATGATAAGCCAGGCCTTTGATGG - Intronic
1116075733 14:40108445-40108467 ATGATGTCCCAGGGCAGTGATGG - Intergenic
1119515649 14:75246241-75246263 CTGATTGGCCAGGCCATCTATGG + Intronic
1121715276 14:96069522-96069544 ATGATTAGCCAGGGCAGGCATGG + Intronic
1123506253 15:20942812-20942834 AGGGTGGGCCAGTGCATTGAGGG + Intergenic
1123563479 15:21516516-21516538 AGGGTGGGCCAGTGCATTGAGGG + Intergenic
1123599731 15:21953802-21953824 AGGGTGGGCCAGTGCATTGAGGG + Intergenic
1126877180 15:53056284-53056306 ATGAATCTCCAGGGCAATGATGG - Intergenic
1129039250 15:72671264-72671286 ATGATTGGCCACGGGAGTGCTGG + Intergenic
1131376969 15:91932930-91932952 ATGCTTGGCCATGGCCTTGGGGG + Intronic
1132448200 15:101948973-101948995 TTTAATGGCCAAGGCATTGATGG - Intergenic
1202971837 15_KI270727v1_random:243653-243675 AGGGTGGGCCAGTGCATTGAGGG + Intergenic
1133644633 16:7752944-7752966 TAGTTTGCCCAGGGCATTGAAGG - Intergenic
1135109605 16:19680553-19680575 ATTGTTGGGCAGGTCATTGAAGG + Intronic
1135793722 16:25422152-25422174 AAGTTTGGCCAGGCCAGTGAGGG - Intergenic
1140631190 16:76854487-76854509 ACTATTTGCCAGGGAATTGATGG + Intergenic
1143265731 17:5635718-5635740 GTGATTGGCCCTGGCCTTGATGG + Intergenic
1144816042 17:18036132-18036154 AGGAATGGCCATGCCATTGAAGG - Intronic
1145231710 17:21177868-21177890 CTGATTGGCAAGGTCAATGAGGG - Intronic
1145924118 17:28633185-28633207 GTGAGTGACCAGGGCACTGAGGG - Intronic
1148888137 17:50788325-50788347 AGGATTCGCCAGTGCATTGGAGG + Intergenic
1151012607 17:70517793-70517815 ATGATTGTCCAGAGGATGGATGG + Intergenic
1153975111 18:10262517-10262539 ATGTTTGGCTTGGGCATTGTGGG - Intergenic
1154107390 18:11534303-11534325 AGGGTGGGCCAGTGCATTGAGGG + Intergenic
1154170248 18:12046283-12046305 AGGGTGGGCCAGTGCATTGAGGG - Intergenic
1155642340 18:28033233-28033255 ATCATTGACAAAGGCATTGAGGG - Intronic
1156633309 18:38996143-38996165 CTGATTAGCCAGGGTATTGCAGG + Intergenic
1160637067 19:83579-83601 TTTAATGGCCAAGGCATTGATGG + Intergenic
1161103316 19:2431988-2432010 CTGAACGCCCAGGGCATTGAAGG - Intronic
1161492068 19:4567628-4567650 GTGAGTGGCCACGGCATGGACGG - Intergenic
1162109661 19:8393325-8393347 CTGATTGGCCAGGGCCTCTAGGG - Intronic
1166211485 19:41309342-41309364 CTCAGTGGCCAGGGCTTTGATGG - Intronic
1168387651 19:55979020-55979042 TTGACTGGGCAGGGTATTGAGGG - Intronic
1168489172 19:56793526-56793548 ATGATTGGACAGTGGAGTGAAGG + Intronic
927026242 2:19071963-19071985 AAGATTGACCCTGGCATTGAGGG - Intergenic
927771694 2:25867827-25867849 ATGATCGGCAAGGGCATTCCAGG - Intronic
928734177 2:34266673-34266695 AGCATGGGCCAGGGCAATGATGG - Intergenic
929059236 2:37906319-37906341 ATGGAAGGCCAGGGCAGTGATGG + Intergenic
930999714 2:57765323-57765345 ATGCATGGCCAGGGTATTGAAGG - Intergenic
931008628 2:57881574-57881596 ATGATTGGCAAAGGCCTAGAAGG - Intergenic
931825347 2:65994731-65994753 CTGAGTGGCCAGGGTATTAATGG - Intergenic
937991125 2:127663162-127663184 GCGAGTGGCCAGGGCACTGATGG - Intronic
938001087 2:127738667-127738689 ATGATTAGACAGGGAATTGTCGG - Intronic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
943479107 2:188395985-188396007 ATGATTAGCCAGGGTGTTGCAGG + Intronic
1170484545 20:16803341-16803363 TTGATGAGCCATGGCATTGATGG - Intergenic
1175010096 20:55726216-55726238 ATGATTGGCCTGGGTTTGGAGGG + Intergenic
1175453900 20:59095205-59095227 TTGATTGGCCAGGAGACTGAAGG - Intergenic
1177819085 21:26011545-26011567 ATGATTGTCCTGTGCATTGTAGG - Intronic
1178289754 21:31357033-31357055 AAGATGGGCCAGGGAGTTGAGGG - Intronic
1181365242 22:22371425-22371447 ATGATAGGCCAGGGCAAGCAGGG + Intergenic
1183042344 22:35191734-35191756 ATCAGTGCCCAGGGCATTGGGGG - Intergenic
952747124 3:36791977-36791999 ATGCTGGGCTAAGGCATTGAAGG + Intergenic
954123746 3:48516748-48516770 AAGATGGGGCAGGGCATTGCCGG - Intergenic
955345848 3:58161330-58161352 AGGATTGGTCAGGGCCTTAAAGG + Intronic
961820642 3:129574018-129574040 ATGTTTGGCCATGTCATTGGTGG + Intronic
962493825 3:135919856-135919878 GTGACTGGCCAGGATATTGATGG + Intergenic
962744057 3:138384359-138384381 ATGATGGGCTTGGGCATTGGTGG + Intronic
964053935 3:152428728-152428750 AGGAGTGGCCAGGGCATTCACGG + Intronic
966851847 3:184169737-184169759 AAGCTTGGCCAGGGCCTTCAAGG + Intronic
970770791 4:19609989-19610011 TTGATTGGCTGGGGCATTGGGGG + Intergenic
975645003 4:76537343-76537365 ATGATTGCCTAGGGCCTTGAAGG + Intronic
975729000 4:77319571-77319593 ACAATTGGCCTTGGCATTGAAGG + Intronic
976099172 4:81542302-81542324 ATGAATGGCTTGGGAATTGAAGG - Intronic
980811189 4:137882678-137882700 ATGCTGGGCCAATGCATTGAAGG + Intergenic
985388850 4:189473352-189473374 ATGATTGGCCAGTTCAGTGTTGG + Intergenic
987149745 5:15026871-15026893 ATTATTGACCAGGACATTGTGGG + Intergenic
987941701 5:24547428-24547450 ATTCTTGGCCAGGGGCTTGAAGG + Intronic
997197910 5:131991903-131991925 CTGATTGGCCAGTGCTTTCAAGG + Intronic
998471482 5:142387125-142387147 ATGGTGGGCCAGGGCCCTGAGGG - Intergenic
1001802032 5:174552720-174552742 ATGGTTGAGCAGGGCATGGAGGG - Intergenic
1002346952 5:178554727-178554749 TTGATGGGCCAGGTCATTGGTGG - Intronic
1003046652 6:2739627-2739649 CTGATTTGCCAGTCCATTGAGGG - Intronic
1004468736 6:15909268-15909290 ATGATAAGTCAGGGCATTTAGGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1007777208 6:44230421-44230443 ATGAGTGGCCAGGGCCTAGCAGG + Exonic
1009736257 6:67679892-67679914 ATTGTTGGCCAGGGCATCCAGGG - Intergenic
1011702446 6:89968235-89968257 CTGATTGTCCAGGTCATAGAAGG - Intronic
1014138084 6:117910462-117910484 ATGAGTGGACAGGGCAATGTGGG - Intronic
1014280069 6:119432385-119432407 CTGATTTGTCAGGGTATTGAGGG - Intergenic
1018443924 6:163837777-163837799 ATGATTGGACAGGGCAGAAAGGG - Intergenic
1021044852 7:15909807-15909829 ATGTCTTGCCTGGGCATTGAGGG - Intergenic
1021608042 7:22429117-22429139 ATCATTATCCAGGGCACTGAAGG + Intronic
1024799990 7:53065797-53065819 AAGATTGCTCAGGGGATTGAAGG + Intergenic
1029970567 7:104784895-104784917 ATGATTGTCAAGGGCAGGGAAGG + Intronic
1030268215 7:107642723-107642745 ATGCTGGGGCTGGGCATTGAGGG + Intergenic
1031235894 7:119175953-119175975 CTGAATGGCCAGGCCACTGAAGG - Intergenic
1035040212 7:155921544-155921566 ATGCATGGCCTGGGCATTGCAGG + Intergenic
1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG + Intergenic
1036499263 8:9298226-9298248 CTGATTGGCCAGTGCTTTGTGGG - Intergenic
1036651804 8:10648970-10648992 AGGAGGGGCCAGGGCAGTGAGGG + Intronic
1037532689 8:19793169-19793191 GTGCTTGGCTAGGGCATTTAAGG - Intergenic
1043276425 8:78400876-78400898 ATGAATGGCCATGGGATGGATGG + Intergenic
1043986283 8:86696170-86696192 CTGATTAGCCAGGGCGTTGCAGG + Intronic
1044534923 8:93347436-93347458 ATGAGAGGCAAGGGAATTGATGG + Intergenic
1046034944 8:108829540-108829562 ATCACTGGCCATGGCTTTGAGGG - Intergenic
1048354523 8:133642271-133642293 ATGCTTGGGCCGGGCATAGAAGG - Intergenic
1048878890 8:138857384-138857406 GTGTTTGGCCAGGGCATGGAAGG - Intronic
1055091365 9:72366819-72366841 AGGCTTGCCCAGGGCACTGAAGG + Intergenic
1055449247 9:76416092-76416114 ATGATGGGCCAGGGCAGTTTTGG - Intergenic
1056245950 9:84695719-84695741 ATAATTGGGCAGGTCAGTGAAGG - Intronic
1058091690 9:100813088-100813110 ATGATTGGAGACAGCATTGAAGG + Intergenic
1058327713 9:103718804-103718826 TTGATTGGTCAGGGCAAGGAGGG + Intergenic
1059008431 9:110429708-110429730 ATTATTGGTCAGGGGATTTAAGG + Intronic
1185650590 X:1645301-1645323 AAAATTTGACAGGGCATTGATGG - Intergenic
1187521934 X:20021617-20021639 ATGATTGGAGATGGAATTGAAGG - Intronic
1190872594 X:54437063-54437085 ATGGTTGCCCAGGGCTTGGATGG - Intergenic
1191183498 X:57586447-57586469 ATCCTTGGCCAGAGCATGGAAGG + Intergenic
1191213884 X:57915951-57915973 ATCCTTGGCCAGAGCATGGAAGG - Intergenic
1192200857 X:69065890-69065912 GTGAGAGGGCAGGGCATTGACGG + Intergenic
1194224858 X:91244330-91244352 ATGATTAGCCAGGGTATTGCGGG + Intergenic
1196632227 X:117954914-117954936 AAAATTGGCCTGAGCATTGAAGG - Intronic
1197543773 X:127798481-127798503 ATGAGTGGACAGGGAATTGGGGG + Intergenic
1199656903 X:150005480-150005502 TTGATTGTCCAAGGCATAGATGG + Intergenic
1199743375 X:150756550-150756572 ATGGGTGGCCAGGGCATGGTTGG + Intronic
1200561320 Y:4707640-4707662 ATGATTAGCCAGGGTATTGCGGG + Intergenic