ID: 1090436309

View in Genome Browser
Species Human (GRCh38)
Location 11:126689525-126689547
Sequence CCAGGTGACAAGAAGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090436309 Original CRISPR CCAGGTGACAAGAAGGCAGC TGG (reversed) Intronic
901399475 1:9006119-9006141 CCAGGTGACACACAGGCAGTGGG + Intronic
902366326 1:15976763-15976785 CCATGTGACAAAAAGGCAAGGGG - Intergenic
902533538 1:17105777-17105799 CCAGGTGACTGCAATGCAGCTGG - Intronic
902710019 1:18232725-18232747 CTAGGTGTCAAGAATACAGCAGG - Intronic
903000446 1:20261885-20261907 CCAGGTGACATGGATGGAGCTGG + Intergenic
903326067 1:22569259-22569281 ACAGGAGACAAGAGGGCATCAGG - Intronic
905006582 1:34714747-34714769 CCAGGAGACAAGGAGGTAGAAGG - Intronic
905490605 1:38340622-38340644 AAAGATGTCAAGAAGGCAGCTGG + Intergenic
906127828 1:43438327-43438349 CCAGGTGTCCAGTAGGCAACTGG + Intronic
906588356 1:47000801-47000823 ACAGGTGGGAAGAAGGCAGGTGG + Intergenic
906668182 1:47636413-47636435 CCAGGGGAAATGAAGGCAGAGGG - Intergenic
907270391 1:53287767-53287789 CCAGGGGATGGGAAGGCAGCAGG + Intronic
907952813 1:59200142-59200164 ACAGGTGCAATGAAGGCAGCAGG + Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911324074 1:96448247-96448269 GCAGTGGACAAGAAGGCTGCTGG + Intergenic
912609381 1:111028011-111028033 CCTGGTGACAAGAAGAAGGCAGG - Intergenic
915075422 1:153304576-153304598 GAAAGTGACCAGAAGGCAGCAGG - Intronic
915229496 1:154435041-154435063 CCAGGTGACACTGAGCCAGCGGG - Exonic
915991557 1:160522516-160522538 GCAGGAAACAAGAAGCCAGCTGG + Intronic
916575839 1:166065652-166065674 CCAGATGACAGGAAGGCATCTGG - Intronic
916723325 1:167501745-167501767 CAAGGAGACCAGAAGGCAGGAGG + Intronic
917631865 1:176898310-176898332 CGAGGGGACCAGAAGGCAGTGGG - Intronic
917872660 1:179255845-179255867 ACTGATGACAAGAAGGCGGCTGG + Intergenic
918123122 1:181557135-181557157 CCAGGTGACAGGGAGGAAGGTGG - Intronic
919789039 1:201278221-201278243 ACAAGTGGCAAGAAGGCAGGAGG + Intergenic
920299201 1:204978051-204978073 CCAGGTGATGTGAAGGGAGCAGG - Intronic
920533713 1:206723617-206723639 CCAGAGGACAGGAAAGCAGCCGG - Intronic
920568165 1:206992936-206992958 CCAGGTGACAGCTATGCAGCAGG - Intergenic
920775405 1:208932011-208932033 CCAGGTGATATGGAGGCTGCTGG + Intergenic
920819142 1:209364209-209364231 TAAGGTGACAAAAATGCAGCGGG + Intergenic
922051029 1:221990764-221990786 CCAGGTGATATAAAGGCTGCTGG + Intergenic
922241406 1:223757593-223757615 CCAGGTCACAGGGAGGCAGCGGG - Intronic
923072123 1:230575426-230575448 CCAGGTGACATGGATGCTGCTGG - Intergenic
923078637 1:230632874-230632896 GGAGGTGACAAGTAGGCAGTTGG + Intergenic
923302800 1:232657908-232657930 CCATGTGACATGGAGGCAGTTGG + Intergenic
924453285 1:244198436-244198458 CCAGCTGGCAAGAAGGCACTTGG - Intergenic
1063288110 10:4712382-4712404 CCAGGAGGCAGGAAGGTAGCAGG - Intergenic
1063650946 10:7936130-7936152 CCAGGGGACAACAAGGAAGACGG + Intronic
1065308845 10:24395014-24395036 CCAGGTGACATGGATGCTGCAGG + Intronic
1065974016 10:30826945-30826967 CCAGGTGGCAAGAACACAGTGGG + Intronic
1066710165 10:38224565-38224587 CCAGTGGAAAAGAAGGCGGCCGG - Intergenic
1067116143 10:43436948-43436970 CCAGCGGACAAGAGGGCAGCTGG + Intronic
1068558013 10:58480506-58480528 CCTTGTGGTAAGAAGGCAGCTGG + Intergenic
1069882718 10:71603593-71603615 CCGGGTGCCAAGCAGGCAGCAGG + Intronic
1072052876 10:91723955-91723977 GGAGATGTCAAGAAGGCAGCTGG - Intergenic
1072306116 10:94108755-94108777 CCATGGGACTGGAAGGCAGCAGG - Intronic
1072415721 10:95245288-95245310 CCAGGTGACAGGGAGGAAGAAGG - Intronic
1072555607 10:96512195-96512217 CCAGGTTACTAGGAGGCAGGAGG - Intronic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1074165709 10:110872167-110872189 CGGGGCTACAAGAAGGCAGCCGG - Intronic
1074333877 10:112548675-112548697 GCAGTGGACAAGAAGGCTGCTGG - Intronic
1075717529 10:124565778-124565800 CAAGGTCACAGGAAGGCAGGGGG + Intronic
1076386660 10:130062008-130062030 CCAGGGGACAACAAGGCCACGGG + Intergenic
1077490529 11:2858936-2858958 CAAGCTGACAAGAAGACACCAGG + Intergenic
1078249706 11:9607060-9607082 CCATGTGACAAGGAGGAAGGTGG - Intergenic
1078756793 11:14218634-14218656 CATGGTGACAAGTAGGCAACGGG + Intronic
1080335055 11:31186164-31186186 CCAGGTCACATGAAGCCAGTAGG - Intronic
1081469831 11:43359281-43359303 CCAGGAGACAAGTGGGGAGCGGG - Intronic
1081539110 11:44017257-44017279 CTAGGTTAGAAGAAGGGAGCAGG + Intergenic
1082107505 11:48236371-48236393 CAAGGTGACAGGAAGGCTGGGGG - Intergenic
1082947645 11:58776639-58776661 GCAGGAGACAAGAAAGCAGGAGG - Intergenic
1083210710 11:61183678-61183700 GCAGGTGAAAAGAAGGCCGAAGG - Intergenic
1083785967 11:64947440-64947462 CCAGTTGAGAAGAAAGCAGTAGG - Exonic
1084150073 11:67284008-67284030 ACAGGTGATAAGAAGGGAGAGGG - Intronic
1084461298 11:69298070-69298092 CCAGGTGGCAGGGAGGCAGCCGG - Intronic
1084607592 11:70181424-70181446 CCAGATTACAGGAAGGCTGCAGG + Intronic
1085020751 11:73205333-73205355 CCAGGTGCCCAGAATACAGCAGG - Intergenic
1085958210 11:81427211-81427233 CCAGGTGACAAGATGGCTAAGGG + Intergenic
1086354535 11:85981187-85981209 CCAGGTGAAAAGAAGTTAACTGG - Exonic
1089038811 11:115426056-115426078 TCAGGTGACAAGGAGGCAGGAGG + Intronic
1089110026 11:116048199-116048221 ATAGGGGACAAGAAGGCAGTGGG + Intergenic
1089358149 11:117869286-117869308 CAAGCTGCCAGGAAGGCAGCTGG + Intronic
1089644582 11:119870306-119870328 GGAGGTGACCAGCAGGCAGCTGG - Intergenic
1089681039 11:120119159-120119181 CCAGAGGAGAAGAAGGCAGTGGG + Intronic
1090240282 11:125176765-125176787 CAAGGTGAGAGGAAGACAGCTGG + Intronic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1090971267 11:131645206-131645228 CAAGGTGATAAGAAAGCAGCAGG + Intronic
1091320206 11:134644123-134644145 ACAGGTGTAAAGAAAGCAGCCGG + Intergenic
1091694325 12:2617728-2617750 CCCAGTGAAAACAAGGCAGCTGG - Intronic
1092931416 12:13319424-13319446 TCAGGTGAGGTGAAGGCAGCAGG - Intergenic
1093551230 12:20413956-20413978 AGAGGTGACAGGAAGGCAGGAGG + Intronic
1094147124 12:27242431-27242453 GCAGGTCACAAGACAGCAGCTGG + Intergenic
1095097975 12:38158104-38158126 CAAAGTGGCAAGAAGGCCGCCGG + Intergenic
1096631174 12:52927569-52927591 CCAGTTGGCAGGCAGGCAGCAGG - Intronic
1100635497 12:96431316-96431338 GCAGGGGAGAAGAAGGCAGGAGG + Intergenic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102898939 12:116621147-116621169 GCAGGTGACAAGGAGGCAGCGGG - Intergenic
1103215985 12:119201881-119201903 CCAGCTGGCTAGAAGGCAGTTGG - Intronic
1103598217 12:122037201-122037223 GCAGGTGACAAAGAGGCAGTGGG - Intronic
1104094617 12:125545687-125545709 CATGGTGGCAAGATGGCAGCTGG - Intronic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284633 13:18994145-18994167 CCAGAAGGCAAGAAGGCAGAAGG + Intergenic
1105474360 13:20718017-20718039 CCAGGTGACGAGAACTCAGAGGG + Intronic
1105968329 13:25404758-25404780 GCAGGTGTCCAGCAGGCAGCTGG + Intronic
1106024027 13:25940456-25940478 CCAGAGGACGGGAAGGCAGCAGG - Intronic
1106276704 13:28215826-28215848 GCAGTGGACAAGAAGGCTGCTGG + Intronic
1106405824 13:29471922-29471944 CCTGGTGACCAAAAGGGAGCTGG - Intronic
1107074542 13:36308855-36308877 ACAGGTGACAAGAAGTGAGTTGG + Intronic
1112048254 13:95619324-95619346 GCAGTGGACAAGAAGGCTGCTGG + Intronic
1112375254 13:98833810-98833832 CTATGTGATGAGAAGGCAGCAGG - Intronic
1113180311 13:107617692-107617714 ACAAGTGCAAAGAAGGCAGCTGG + Intronic
1113522293 13:110949519-110949541 CCAGGGGACAAGCAGGCTGAGGG - Intergenic
1113766574 13:112884904-112884926 CCAGGTAACACGCATGCAGCAGG - Exonic
1113818595 13:113194211-113194233 CCAGGCGCAAAGAAGTCAGCAGG - Intronic
1113869906 13:113553018-113553040 CCAGGAGAGGAGAAGGCAGCAGG - Intronic
1115108546 14:29791041-29791063 CCAGGTGACTAAAAGACAGTAGG + Intronic
1115980928 14:39050654-39050676 CCAGGAGTCAAAAAGGAAGCCGG + Intronic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1118909449 14:70049151-70049173 CCAGCTGCCCAGAAGACAGCTGG - Intronic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1119484949 14:74981088-74981110 ACAGGAGACCAGCAGGCAGCAGG - Intergenic
1120214039 14:81662807-81662829 GCAGGGGACAAGAAGCCTGCTGG + Intergenic
1120672816 14:87383970-87383992 CCAGGTGATAAGAAGCTAGAAGG - Intergenic
1121009067 14:90509351-90509373 CCAGGTCTCATGGAGGCAGCTGG - Intergenic
1121020090 14:90574791-90574813 CCAGGGGACAAGCAGTCAGTGGG - Intronic
1121112464 14:91321521-91321543 CCAGGGCTCAAGAAGGCGGCAGG + Intronic
1121439030 14:93937189-93937211 CCAGGTGACACCAAGGCTGTTGG - Intronic
1121591675 14:95118385-95118407 CCTGGGGACAAGAAAGCATCAGG - Intronic
1121916431 14:97840272-97840294 CCAGGAGACCAGAAGGCATCTGG - Intergenic
1125522183 15:40354456-40354478 CCAAATGAAAAGAAGGGAGCAGG + Intronic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126865961 15:52937188-52937210 GCAGTGGACAAGAAGGCTGCTGG - Intergenic
1127541097 15:59939737-59939759 TCAGGTGACAAGCAGCAAGCTGG - Intergenic
1128657010 15:69469869-69469891 CCTGGGGCCAAGAAGGCTGCTGG - Intergenic
1128868272 15:71132924-71132946 CCAGGGGAGGAAAAGGCAGCTGG - Intronic
1129142358 15:73611580-73611602 CCAGGAGATAAGAAGGAAGGAGG + Intronic
1129589811 15:76905193-76905215 CCAGGGGACAAAATGGCGGCGGG - Intronic
1129896681 15:79113588-79113610 CAAGGTCACAAGATGGCTGCTGG + Intergenic
1130377057 15:83338556-83338578 CCAGCTGCCAGGTAGGCAGCTGG - Intergenic
1131154658 15:90067516-90067538 CCAGGTGACGACAAGGACGCAGG + Exonic
1131365790 15:91838120-91838142 CCAGGGGCCAAGAAGTCATCTGG - Intergenic
1131626472 15:94125886-94125908 TCAGGTGGCAAGTTGGCAGCTGG - Intergenic
1132532682 16:461039-461061 CCTGGTGCCAAGAAGGCTGCGGG - Intronic
1132631770 16:921206-921228 CCAGGTAAGTAGAAGGCAGGAGG + Intronic
1133226257 16:4341877-4341899 CTAGGTGACAGGTGGGCAGCTGG - Intronic
1134849314 16:17468121-17468143 CCAGGAGACCAGAAGGGGGCAGG - Intronic
1135149899 16:19996283-19996305 CCAGTTGACAAGGAGGGAGAGGG - Intergenic
1135829102 16:25757852-25757874 CCAGGTGCCATCAAGGGAGCTGG - Intronic
1137575079 16:49594093-49594115 CCAGCTGAAAGGCAGGCAGCTGG - Intronic
1138055663 16:53830601-53830623 CAAGGAGCCAGGAAGGCAGCTGG + Intronic
1138194071 16:55039803-55039825 CCAGGTGACTCCAATGCAGCTGG - Intergenic
1138475702 16:57269570-57269592 CCACGAGGCAGGAAGGCAGCCGG + Intronic
1138512122 16:57514971-57514993 CCAGGTGACACCAAGACAGCAGG - Intronic
1139648524 16:68349386-68349408 AAAGGTGACAGGATGGCAGCTGG - Intronic
1140613865 16:76635228-76635250 CCAGGGGACAAAATGGCGGCAGG + Intronic
1140663268 16:77207889-77207911 CCAGATGAGAAGAAGGAAGCAGG - Intronic
1140716686 16:77733004-77733026 ACAGGTGAAAAGAAGGCTGATGG - Intronic
1141232042 16:82177106-82177128 CCAGCTGAAAAGAAGGCTGCTGG + Intergenic
1142008366 16:87701005-87701027 CCAGGTGCCAAGGAGGTTGCTGG + Intronic
1142699454 17:1650170-1650192 AGAGGTGACAGGTAGGCAGCCGG + Intergenic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143172170 17:4936713-4936735 CTAGGGGACAGGCAGGCAGCAGG - Intergenic
1143383019 17:6508121-6508143 CCAGGTGCCAAGAGGCCAGGAGG + Intronic
1143413543 17:6728050-6728072 CCTGCTGTCCAGAAGGCAGCAGG - Intergenic
1143920601 17:10328345-10328367 CCAGGTGACCAGGAGCCCGCAGG - Intronic
1144672047 17:17138340-17138362 CCAGGTGGAGAGAAGGCGGCTGG + Intronic
1144741547 17:17585474-17585496 GCAGTGGACAAGAAGGCTGCTGG + Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146661221 17:34666325-34666347 CCAGGTGGGAAGGAGGCAGCAGG - Intergenic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1149773256 17:59338046-59338068 CCAGGTAACAGGAATGCAGGTGG - Intronic
1150031440 17:61740400-61740422 CCAGGTGATACGAATGCACCTGG + Intronic
1150155877 17:62852546-62852568 CCAGGTGGCAGGGAGGAAGCAGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151544494 17:74784459-74784481 GTAGGTGACTAGCAGGCAGCTGG + Intronic
1152107716 17:78340848-78340870 CAAGGGGGCAAGAGGGCAGCTGG + Intergenic
1152230962 17:79113914-79113936 CCAGGTGTCCAGGAGGCATCTGG + Intronic
1152237608 17:79146746-79146768 CCACGTGACCAGCAGGCTGCAGG - Intronic
1152259985 17:79261632-79261654 CCAGGTGACACGGAGGCTGCTGG + Intronic
1152703139 17:81829336-81829358 CCAGGTGGGATGAAGGCAGGGGG - Intronic
1153183802 18:2465177-2465199 CAAAGAGACAAGAAGGGAGCAGG + Intergenic
1153851592 18:9100413-9100435 CAATGAGACAAGAAGGCTGCTGG + Intergenic
1154040182 18:10847212-10847234 CCAGATGACATGACGGCAGCCGG + Intronic
1155178560 18:23323402-23323424 GCAGGTGAAAAGCAGGCAACAGG - Intronic
1156008766 18:32472100-32472122 CCAGGCCACGAAAAGGCAGCGGG - Intergenic
1157909955 18:51607364-51607386 CCAGGTGACAAAAAGAAAACTGG + Intergenic
1158398375 18:57097710-57097732 CTAGGTAACAAGAAGGGAGGAGG + Intergenic
1158634763 18:59146979-59147001 CCAGGTGACACGAAAGCTGCTGG - Intronic
1159173753 18:64807706-64807728 GCAGGTGGCATGAACGCAGCAGG + Intergenic
1160567329 18:79795104-79795126 CCAGTTTACAAGATGACAGCGGG + Intergenic
1161545584 19:4878313-4878335 CCAGGGAACAAAGAGGCAGCCGG - Intergenic
1161589104 19:5120786-5120808 CCAGGTGCCATGCAGGGAGCAGG + Intronic
1161769129 19:6221976-6221998 CCAGGTTACAAGAAGCCAGTGGG + Intronic
1161791395 19:6362143-6362165 CCAGGTGTCAGGAAGGAAGTCGG - Intronic
1163274810 19:16276912-16276934 CCAGGTGACACGGAGCCAGCAGG + Intergenic
1163518044 19:17776595-17776617 CAGGGTGACAAGAAGGCTGAAGG + Intronic
1163634198 19:18430883-18430905 CCAGGTGACACAATGGCCGCAGG + Exonic
1165097270 19:33416521-33416543 CCAGGTGAGCAGGAGGGAGCAGG - Intronic
1165216083 19:34273836-34273858 CCAGGTGGCGAGAAGGAAGATGG + Intronic
1165368291 19:35383984-35384006 GCAGCGGACAAGAAGGCAGCTGG + Intergenic
1165742008 19:38210323-38210345 CCAGGAGAGAGGAAGGGAGCAGG - Intergenic
1167096496 19:47377424-47377446 CCAGGTGCCAAGGGCGCAGCAGG + Intronic
1167135575 19:47613322-47613344 CCAGGTCTCAAGAATGCAGAAGG + Intronic
1168121757 19:54255701-54255723 CCAGGTGAGAAGGAGGCCCCGGG - Intronic
1168687754 19:58358585-58358607 CCTGGGGACAGGAAGGCAGCAGG + Exonic
925382154 2:3436131-3436153 ACAGGTGATAAGACTGCAGCTGG + Intronic
925451485 2:3973235-3973257 CCAGGGGAAGAGAAGGCACCCGG + Intergenic
926681200 2:15665343-15665365 GGAGGTGACAAGGAAGCAGCAGG + Intergenic
927212141 2:20645509-20645531 CCAGGGGAAAAGAAGGCAGGTGG + Intronic
928380162 2:30810731-30810753 CCAGGGCACAAGAAGGAACCGGG - Intronic
928437562 2:31265431-31265453 CCAGAAGACAATAAGGGAGCTGG - Intronic
928619338 2:33072607-33072629 GCAGGTGAAAGGAAGGCAGAAGG + Intronic
929589088 2:43133611-43133633 CCAGGTGACCTGGAAGCAGCTGG + Intergenic
929924831 2:46199519-46199541 GCAGCTGAGTAGAAGGCAGCTGG - Intergenic
932182400 2:69659792-69659814 GCAGGTGACAGAAAGGAAGCAGG + Intronic
932731775 2:74226850-74226872 ACAGCTGACAGGAAGGCAGAAGG + Intronic
934900359 2:98154975-98154997 CCAGGTGTCAGGAAGGTACCAGG + Intronic
935207119 2:100905786-100905808 ACAGGTGACAAGCAAGCAGTGGG - Intronic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936937279 2:117850474-117850496 TCATGTGAAAAGAAAGCAGCTGG + Intergenic
937952808 2:127401435-127401457 CCAGGTGAGAAGCAGGGAGCTGG - Intergenic
939052136 2:137319960-137319982 CCAGGCCACAAGAATGTAGCTGG - Intronic
939529165 2:143335932-143335954 CCAGGGGAGAGGAAGGAAGCTGG + Intronic
940168891 2:150805294-150805316 CCAGGTGACAATGAAGCTGCTGG + Intergenic
941790407 2:169546625-169546647 CCAAGTGAGGAGAAGGGAGCAGG + Exonic
943626197 2:190202764-190202786 CCAGGTGGCAACATGGAAGCAGG + Exonic
944497973 2:200327952-200327974 CGAAGTGACAAGAACTCAGCTGG - Intronic
945601826 2:211877179-211877201 CCAGCTGACAAGAAGCAAGAAGG - Intronic
948075389 2:235161802-235161824 CCAGGTGACATGAAGGAATGTGG + Intergenic
948391728 2:237616287-237616309 CCAGGTGAAATGGAGGCTGCAGG + Intergenic
948493217 2:238327199-238327221 TCAGGTACCAAGAAGCCAGCAGG - Intronic
948667511 2:239545779-239545801 CCAGGTGACAGGAGGGAAGGCGG - Intergenic
1169078140 20:2775025-2775047 TCAGGTGACACGAAGGCTGTCGG - Intergenic
1169394886 20:5220402-5220424 CCTGCTGAGAAGAAGTCAGCAGG - Intergenic
1170601277 20:17843367-17843389 CCAGTTGCCAATGAGGCAGCTGG + Intergenic
1170885736 20:20338496-20338518 CCAGGTGGCAAGGAGGAGGCGGG - Intronic
1171351739 20:24507753-24507775 CCAGAAGAGAAGCAGGCAGCAGG + Intronic
1171426196 20:25050298-25050320 GGAGGTGACAGGCAGGCAGCGGG - Intronic
1172036969 20:32018040-32018062 CCAGGTGAGCAGCAGGCAGCGGG - Exonic
1172583454 20:36065800-36065822 CCAAGGGACAGGCAGGCAGCAGG + Intergenic
1172781816 20:37441188-37441210 GCAGCTGACAAAAAGGCAGATGG - Intergenic
1173678281 20:44857208-44857230 CCAAGTGACAAGGAGACAGGAGG - Intergenic
1174133957 20:48365969-48365991 CCTGGTGACAAGAAAATAGCAGG - Intergenic
1174301962 20:49588996-49589018 CCAGGTGCTAGGGAGGCAGCAGG + Intergenic
1174701419 20:52612916-52612938 GCAGTTCACAACAAGGCAGCTGG - Intergenic
1176063350 20:63181830-63181852 CGAGGTGCCAGGAAGGTAGCAGG + Intergenic
1176073320 20:63237778-63237800 CCAGGTGGCAAGAAGGAGGAGGG - Intronic
1176428464 21:6562607-6562629 CCAGGTGACAGGGATGGAGCTGG - Intergenic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1178926864 21:36783299-36783321 CCAGATGATTAGAATGCAGCTGG + Intronic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179657753 21:42855720-42855742 CCAGGTGACAGCAGTGCAGCTGG + Exonic
1179703954 21:43170923-43170945 CCAGGTGACAGGGATGGAGCTGG - Intronic
1180204602 21:46250548-46250570 CCAGCTGACAGCATGGCAGCTGG - Intronic
1180918905 22:19508324-19508346 GCTGTTGACAAGAAGGCACCCGG + Intronic
1181104517 22:20565919-20565941 CCCGGTGTCAGGAAGGCAGCTGG + Intronic
1183260376 22:36791041-36791063 CAAGGTAACAAGGAGCCAGCAGG + Intergenic
1184024058 22:41840868-41840890 TCAGGTGACAAGGAGGCTGATGG - Intronic
1184087951 22:42276827-42276849 CCAGGGGAGCAGAAAGCAGCAGG + Intronic
1184538875 22:45106719-45106741 CCCTGAGACATGAAGGCAGCTGG + Intergenic
1185079742 22:48702967-48702989 CAAAGGGACAAGCAGGCAGCAGG - Intronic
1185369871 22:50456052-50456074 TCTGGTGCCTAGAAGGCAGCTGG - Intronic
950008671 3:9706898-9706920 CCAGGTGACTGGGAGGCAGGAGG + Intronic
950021821 3:9792839-9792861 AAAGGTGACAAGAAGGCCGAAGG + Intronic
950135362 3:10577100-10577122 CTAGGTGACAATGAGGCTGCTGG - Intronic
950901243 3:16499708-16499730 GCAGGTGCCAAGGAGGCGGCAGG - Intronic
953052649 3:39359852-39359874 GCAGTGGACAAGAAGGCTGCTGG + Intergenic
953774448 3:45803558-45803580 CCAGGAGACTGAAAGGCAGCAGG - Intergenic
954401797 3:50322968-50322990 CCAGGTGACAGGAAGGCTATGGG + Intronic
954979643 3:54733309-54733331 CCTTGTGCCAAGAGGGCAGCTGG + Intronic
955566888 3:60257029-60257051 CCAGGTGGCAGGAAGGAAGGAGG - Intronic
956764958 3:72477087-72477109 CCAGGTGACATCAATGCTGCTGG + Intergenic
957011531 3:75011202-75011224 CCAGGTGTCAAGATGACTGCCGG + Intergenic
959534665 3:107470963-107470985 CCAGCTCTGAAGAAGGCAGCGGG + Intergenic
959904336 3:111693882-111693904 CCAGGTGAGATGAAGCCAGGAGG + Intronic
960290892 3:115883161-115883183 ACTGGTAACAAGAAGGCAACGGG + Intronic
961463965 3:127070340-127070362 CCAGGTGACAAGCACGCCACTGG + Intergenic
961791205 3:129378149-129378171 TCAGGTGTCATGAAGGCAGCAGG - Intergenic
962742479 3:138371991-138372013 TAAGGTGACCAGGAGGCAGCTGG - Intronic
962792735 3:138826258-138826280 GCAGTGGACAAGAAGGCTGCTGG + Intronic
963475717 3:145801147-145801169 GCAGGTGACAAGAATGCACTAGG + Intergenic
963789961 3:149573587-149573609 CAAGGTGACAATAGGGTAGCTGG + Intronic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
965308334 3:167096781-167096803 CCAGGTGACATTGATGCAGCTGG - Intergenic
967150405 3:186643512-186643534 CCAGGAGATAAGAATGCTGCTGG + Intronic
967959883 3:194912022-194912044 CCAAGCGAAAACAAGGCAGCTGG - Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
969298139 4:6281492-6281514 CCAGGCCACAAGAAGGCTGAGGG + Intronic
969363885 4:6682772-6682794 CCATGTAACATGATGGCAGCAGG + Intergenic
970776547 4:19681073-19681095 CCAGATGAGAGAAAGGCAGCAGG + Intergenic
972583933 4:40419479-40419501 CCTGGGGCCAGGAAGGCAGCAGG + Intergenic
972625787 4:40797366-40797388 GGAGATGTCAAGAAGGCAGCTGG - Intronic
975675634 4:76824732-76824754 CCAGTTTCCAAGATGGCAGCTGG - Intergenic
977829284 4:101571323-101571345 ACAGGTGGCAATAAGGGAGCAGG - Intronic
978155570 4:105486009-105486031 GCAGTGGACAAGAAGGCTGCTGG + Intergenic
979831743 4:125314233-125314255 CCAGGTGACTAGGGGGCAGGAGG - Intergenic
980602818 4:135046779-135046801 GCAGTGGACAAGAAGGCTGCTGG + Intergenic
982370599 4:154628670-154628692 GAAGATGTCAAGAAGGCAGCTGG - Intronic
982734622 4:158992746-158992768 CCAGGTCCCAACAGGGCAGCAGG + Intronic
982856255 4:160385810-160385832 CCAGGTGCCATGAATGCAGCAGG - Intergenic
983921433 4:173349818-173349840 CCAGGTGTTCAGAAGGCAGTGGG + Intergenic
985287335 4:188349654-188349676 CCAGCTGAGAAGAAAGCTGCCGG - Intergenic
985305815 4:188538360-188538382 CCACATGACAAGGAGGCAGGGGG + Intergenic
985726640 5:1519764-1519786 CCAGGTCATCAGAAGGCAGCTGG + Intronic
987107217 5:14651987-14652009 GCAGTGGACAAGAAGGCTGCTGG - Intergenic
987223969 5:15820528-15820550 CCAGGAGACAAGGAGGAACCAGG - Intronic
989365497 5:40651383-40651405 TCAGGTGAAAAGAGGGCAGGAGG - Intergenic
989632003 5:43495122-43495144 GCAGTGGACAAGAAGGCTGCTGG - Intronic
989772490 5:45161401-45161423 CAAGGTGACCAGAAGACAGTGGG - Intergenic
989783997 5:45305112-45305134 AGAGGTGAAAAGAAGGCAGAAGG + Intronic
990280248 5:54242632-54242654 CCTGGTGGCAAGATGGCTGCCGG - Intronic
993634895 5:90331761-90331783 TCAGGTCACAAGCTGGCAGCTGG - Intergenic
996780359 5:127179792-127179814 GCAGTGGACAAGAAGGCTGCTGG - Intergenic
998446814 5:142205006-142205028 CCAGGTGAGATGAGGGCACCAGG + Intergenic
999112181 5:149131299-149131321 CCATGTGACATAATGGCAGCTGG + Intergenic
1003381290 6:5626507-5626529 CCAGGTGACAAGTTGACAGTGGG - Intronic
1003877158 6:10448604-10448626 CCAGGTGACACCAATGCTGCTGG - Intergenic
1003978868 6:11370740-11370762 CCATGTGCCAAGAACACAGCAGG + Intronic
1005265799 6:24111062-24111084 CCAGGAGATAGGCAGGCAGCAGG + Intergenic
1005440063 6:25857865-25857887 CCAGAGGACAAGAAGGGACCTGG - Intronic
1005746818 6:28846227-28846249 GCAGGTGAAAGGAAGGCAGGAGG - Intergenic
1006561630 6:34917912-34917934 CCAGGTGAAAGGAGGGCAGCTGG - Intronic
1006596939 6:35200558-35200580 CCAAGTGACATCCAGGCAGCAGG - Intergenic
1006795185 6:36727688-36727710 CCAGGTGAGCAGATGGCTGCTGG + Exonic
1006898174 6:37483901-37483923 CCAGGTGACACGCAGGTAGGGGG + Intronic
1007078483 6:39082825-39082847 CAAGATGACAAGGTGGCAGCAGG - Intronic
1007415221 6:41687700-41687722 CCAGGTGAGAACAAGGAAGAGGG + Intronic
1007833012 6:44653255-44653277 CCCAGTGACAGGATGGCAGCGGG + Intergenic
1010228899 6:73517859-73517881 GCAGTGGACAAGAAGGCTGCTGG - Exonic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1011771914 6:90682786-90682808 CCAGGTAAGGAGAAGGCAGCTGG + Intergenic
1013818348 6:114125791-114125813 CGTGTTGACAAGAAGTCAGCAGG - Intronic
1016369599 6:143358740-143358762 TCATATGACAAGAAGGCAGAGGG + Intergenic
1016814792 6:148293532-148293554 ACAGCTGTCAAGAAGGCAGGTGG - Intronic
1017175986 6:151505259-151505281 CCAGGTCCCAAGAGGGCAGGCGG + Intronic
1018639262 6:165891592-165891614 CCAGGGGACTAGATGGCTGCAGG + Intronic
1018860231 6:167705882-167705904 CCAGCTTCCTAGAAGGCAGCGGG + Intergenic
1019365461 7:630387-630409 GCAGGTGGCAGGCAGGCAGCGGG + Intronic
1019484889 7:1284915-1284937 CCAGGGGACAAGCAGGGAGAAGG + Intergenic
1019764003 7:2836381-2836403 GCAGGTGGAAAGAAGGCGGCAGG + Intronic
1021616843 7:22510661-22510683 GCAGTGGACAAGAAGGCTGCTGG - Intronic
1021762929 7:23918962-23918984 ACATGTGAAAAGAAGCCAGCAGG - Intergenic
1022183003 7:27940096-27940118 GCAGGTGAGAGGAGGGCAGCAGG - Intronic
1023482592 7:40650177-40650199 GCAGGTGACAACATGACAGCAGG + Intronic
1025095518 7:56092783-56092805 CCAGGTGATAGGCAGGGAGCGGG - Intronic
1026602863 7:71791071-71791093 CCAGGTAAGAAGTAGGAAGCTGG + Intronic
1027492924 7:78853103-78853125 TCAGGGGTCAAGAATGCAGCAGG + Intronic
1028259209 7:88640351-88640373 GCAGTGGACAAGAAGGCTGCTGG + Intergenic
1029683516 7:102129049-102129071 CCAGGTGCCTTGCAGGCAGCAGG - Intronic
1030298106 7:107948801-107948823 CCCGGTGGCACGAGGGCAGCAGG - Intronic
1032689138 7:134265354-134265376 AGAGGTGAAAAGAAGGCAGATGG + Intergenic
1032854249 7:135821206-135821228 GCAGGAGACAAGTAAGCAGCTGG - Intergenic
1032856496 7:135838018-135838040 CCAGGTGACAAGAACGTTCCAGG + Intergenic
1032951673 7:136921647-136921669 AGGGGTGACAAGAAGGCAGTGGG - Intronic
1033021958 7:137734521-137734543 CCACTTAACAAGAAGGCAGCTGG - Intronic
1033778972 7:144647235-144647257 GCAGTGGACAAGAAGGCTGCTGG - Intronic
1034350820 7:150413706-150413728 CCAGGTGACACCAACGCTGCTGG - Intergenic
1034934446 7:155189813-155189835 CCAGGTGACTGGAAGTTAGCTGG - Intergenic
1035132675 7:156669876-156669898 CCAGGTGACAGGAGGGCGGGCGG + Intronic
1035428203 7:158796676-158796698 ACCGCGGACAAGAAGGCAGCAGG + Intronic
1035575109 8:699350-699372 CCAGGAGAGAAGAAGGCCGCTGG - Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037603141 8:20415714-20415736 CCAGGTGGTAAGAAGGGAGAGGG + Intergenic
1037686263 8:21142016-21142038 CCAGATGAGAAGCAGGCAGCAGG + Intergenic
1038893671 8:31756325-31756347 CCAGGTGACTAGCAGGAAGCAGG + Intronic
1039449583 8:37661290-37661312 GCAGGTGACAAACAGGCAGTTGG + Intergenic
1039557961 8:38490319-38490341 CCAGGTGACAGGTAAGCAGTGGG - Intergenic
1041847923 8:62352982-62353004 TCAAGTAACAAGAAGGCAGATGG - Intronic
1046222702 8:111236470-111236492 CAATGTGACATGAAGGCTGCTGG - Intergenic
1046708050 8:117477773-117477795 CCAGGAGGCAGGAAGGCAGTGGG + Intergenic
1046744824 8:117865542-117865564 CCAGGTTACAAGAAGGATGAAGG - Intronic
1048313170 8:133341993-133342015 CCACGGGAAAACAAGGCAGCAGG + Intergenic
1048498118 8:134952203-134952225 CCAGGGGACAGGATGGCAGAAGG - Intergenic
1049181546 8:141225695-141225717 CCGGGAGACAAGAAGGCACAGGG + Intronic
1049183402 8:141235191-141235213 CCAGGTGATATGAAACCAGCAGG + Intronic
1049726272 8:144147965-144147987 GCGGGTGGCCAGAAGGCAGCGGG + Intergenic
1050186538 9:2981080-2981102 CCTGGTGACAAGAAGGAGGCAGG - Intergenic
1050339370 9:4620408-4620430 CCAGGTGATATGAATGCTGCTGG - Intronic
1050744772 9:8862612-8862634 CCAGTAGAAAAGGAGGCAGCTGG + Intronic
1052228435 9:26118112-26118134 CCAGGAGTCAAGAAATCAGCTGG + Intergenic
1053355849 9:37444875-37444897 CCAGATGACAACTAGGCAGCAGG + Intronic
1056831426 9:89920286-89920308 GCAGGAGAAGAGAAGGCAGCTGG + Intergenic
1057504090 9:95618345-95618367 CCAGGTGACAGGAAGTGATCTGG + Intergenic
1057700728 9:97361662-97361684 CCAGGTGCCAGCGAGGCAGCAGG - Intronic
1059356068 9:113700403-113700425 CCAGGTGATAACAAGGGAGAAGG + Intergenic
1059447568 9:114348370-114348392 CCAGCAGACAAGAAAGAAGCGGG + Intronic
1059853582 9:118370201-118370223 CCAGGTGACGACAATGCTGCTGG - Intergenic
1060136333 9:121158851-121158873 ACAGGTGACAAGTCAGCAGCAGG + Exonic
1060516278 9:124267751-124267773 CCAGGGGCCAAGAAGGCATGTGG - Intronic
1060831698 9:126721712-126721734 CCTGGTGGCAAGATTGCAGCTGG - Intergenic
1061433347 9:130545024-130545046 CTAGGAGACAAAAAGGCAGGCGG + Intergenic
1061512220 9:131068270-131068292 CCAGGAGGGAAGAAGGCATCGGG + Intronic
1061596703 9:131635174-131635196 CTAGGTGACCAGGAGGCAGTGGG - Intronic
1061784796 9:133020803-133020825 GCAGTGGACAAGAAGGCTGCTGG + Intergenic
1185485182 X:476669-476691 CCAGTTTAGAAGAAGGCAGTGGG + Intergenic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1186663795 X:11698040-11698062 CCAGGTGACATTGAGGCTGCTGG - Intergenic
1186677601 X:11835414-11835436 CCAGATAGCACGAAGGCAGCAGG + Intergenic
1186818940 X:13266655-13266677 CCAGGGGACAAGCAGCCAGATGG + Intergenic
1187285041 X:17897132-17897154 CCAGTTGACAACCAGGCTGCTGG - Intergenic
1188141908 X:26561074-26561096 CCAGGTAACAAGTGTGCAGCAGG - Intergenic
1188552012 X:31374933-31374955 CCAGCAGCCAATAAGGCAGCAGG - Intronic
1188897037 X:35681487-35681509 ACAGGTGACTTGAAGGCAGCCGG - Intergenic
1189236849 X:39493826-39493848 CCAGGTGACATGGATGCTGCTGG - Intergenic
1190163597 X:48053032-48053054 CAAGGGGAGAGGAAGGCAGCAGG - Intronic
1192171613 X:68859040-68859062 CCAGTTGAAGAGAAGGCAGTGGG + Intergenic
1193773941 X:85620512-85620534 CCTGGTGACTAGCAGGGAGCAGG - Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195423175 X:104698139-104698161 GCAGCTGACAACATGGCAGCTGG + Intronic
1197286860 X:124605848-124605870 CAAGATGAGAAGAAGTCAGCTGG - Intronic
1197835791 X:130692505-130692527 CCAAGAGTCAAGAAGGCAGTGGG - Intronic
1198850810 X:140963788-140963810 CCAGGTGATAAACAGGCACCTGG + Intergenic
1200146432 X:153928539-153928561 GCACGTGACCAGCAGGCAGCCGG - Intronic
1201763319 Y:17560459-17560481 TAAAGTGTCAAGAAGGCAGCGGG + Intergenic
1201838234 Y:18345531-18345553 TAAAGTGTCAAGAAGGCAGCGGG - Intergenic