ID: 1090438197

View in Genome Browser
Species Human (GRCh38)
Location 11:126704317-126704339
Sequence CTGGTAGGAAGCATGTTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090438193_1090438197 22 Left 1090438193 11:126704272-126704294 CCCTTAACTGCAGAATGAAGTGA 0: 1
1: 0
2: 2
3: 20
4: 257
Right 1090438197 11:126704317-126704339 CTGGTAGGAAGCATGTTTGTCGG 0: 1
1: 0
2: 0
3: 13
4: 166
1090438194_1090438197 21 Left 1090438194 11:126704273-126704295 CCTTAACTGCAGAATGAAGTGAG 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1090438197 11:126704317-126704339 CTGGTAGGAAGCATGTTTGTCGG 0: 1
1: 0
2: 0
3: 13
4: 166
1090438192_1090438197 23 Left 1090438192 11:126704271-126704293 CCCCTTAACTGCAGAATGAAGTG 0: 1
1: 0
2: 0
3: 13
4: 191
Right 1090438197 11:126704317-126704339 CTGGTAGGAAGCATGTTTGTCGG 0: 1
1: 0
2: 0
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090438197 Original CRISPR CTGGTAGGAAGCATGTTTGT CGG Intronic
900987315 1:6080665-6080687 CAGAAAGGCAGCATGTTTGTGGG - Intronic
902157913 1:14504589-14504611 CTGGGAGGAATAATTTTTGTAGG + Intergenic
905441786 1:38000610-38000632 CAGGAACAAAGCATGTTTGTGGG + Intronic
911103692 1:94113714-94113736 CTTGAAGGAAGCATGTTGGTAGG - Intronic
911684234 1:100756461-100756483 TTGTTGGGAACCATGTTTGTTGG + Intergenic
912077539 1:105894352-105894374 CTGGAAGGCTGCATGTTTGTGGG - Intergenic
912858795 1:113194839-113194861 CAGGCAGTAAGCATGTTTCTGGG + Intergenic
913509402 1:119548284-119548306 CTGCTGGGAAGCATGTATGGAGG + Intergenic
914852503 1:151325531-151325553 TAGGTAGAAAGTATGTTTGTGGG - Intronic
917170658 1:172169709-172169731 TTACTAGAAAGCATGTTTGTAGG + Intronic
918652179 1:186978931-186978953 CGTGTGGGAAGCATGATTGTGGG - Intronic
919559907 1:199104140-199104162 TTGGTAGGTTGCATGTTTCTAGG + Intergenic
921175504 1:212590517-212590539 CTGGTTGGTGGCATGTGTGTGGG + Intronic
921907880 1:220514201-220514223 CTGCTTGGAAGCATTTTTGGAGG + Intergenic
921982339 1:221272361-221272383 CTGGTAGGAGGCTTGATTGGAGG - Intergenic
922986750 1:229871920-229871942 CTGGTAGGATGCCTTCTTGTAGG + Intergenic
1064816154 10:19264973-19264995 TTGGTAGGTTGTATGTTTGTAGG + Intronic
1065122582 10:22543708-22543730 CTGGCTGGGATCATGTTTGTGGG + Intronic
1066393516 10:34997815-34997837 CTGCTGGGAAGCAGGTTTTTCGG + Intergenic
1067272324 10:44803188-44803210 CAGGTAGGAAGCAAGTTGGAGGG - Intergenic
1068303045 10:55170581-55170603 CTGGTAGAAAGCATAATTGATGG + Intronic
1070214298 10:74360850-74360872 CTTGTAGGCAGCATGTATCTGGG + Intronic
1070903448 10:80050858-80050880 CAGGAAGCAAGCATGTTTGAGGG - Intergenic
1073896504 10:108166378-108166400 CTGGGACGGAGAATGTTTGTTGG + Intergenic
1078622205 11:12918987-12919009 CTGGAAGGAAGGATATTTGGGGG + Intronic
1080835388 11:35935793-35935815 CTTGTCGGAAGGTTGTTTGTAGG + Intergenic
1080965852 11:37213520-37213542 TTGGTAGGATGCATGTGTCTAGG + Intergenic
1084489762 11:69471858-69471880 CTGGGAGGAAGCAGGTATGGGGG + Intergenic
1085030555 11:73268662-73268684 CTTGCAGGAAGCATGGTTGGTGG - Intronic
1086130246 11:83393960-83393982 TCTGTAGGAAGCATGATTGTGGG - Intergenic
1086368032 11:86128221-86128243 GTGGTAGGAGGAATGTTTGATGG + Intergenic
1089815407 11:121168748-121168770 CTGGCGGTAAGGATGTTTGTAGG - Exonic
1090130803 11:124140282-124140304 ATGCTAGGAAGCTTGTTTTTAGG + Intronic
1090438197 11:126704317-126704339 CTGGTAGGAAGCATGTTTGTCGG + Intronic
1091724056 12:2833557-2833579 CAGGTTGGAAGCATGTCTGCAGG - Intronic
1091930089 12:4389040-4389062 CTGGAAGTAAGAATATTTGTAGG - Intergenic
1098130225 12:67342302-67342324 TTGGTAGGTTGTATGTTTGTAGG + Intergenic
1099078260 12:78140027-78140049 CTGGTAGGGCTCATGCTTGTAGG + Intronic
1101314605 12:103617738-103617760 CAGGTAACAGGCATGTTTGTGGG - Intronic
1103240881 12:119412424-119412446 CTGATAAGAAGGATGTGTGTTGG - Intronic
1107031954 13:35862309-35862331 GAGATAGGAAGCAGGTTTGTTGG - Intronic
1108781307 13:53838603-53838625 TTGGTAGGTTGCATGTTTCTAGG + Intergenic
1111314632 13:86537077-86537099 CTGGTAGAAAGCATATATCTAGG + Intergenic
1111981346 13:95018766-95018788 CTGTTAGGAATTATGTTTCTAGG + Intergenic
1113142730 13:107173269-107173291 TTGGGGGGAAGCATGTTTGCTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1124236831 15:27996709-27996731 TTGGTAGGTTGCATGTTTCTAGG - Intronic
1124862004 15:33450861-33450883 AAGGTAGGACGCATGTTTGGTGG + Intronic
1124895747 15:33775769-33775791 CTGGTGGGCAGCATGCGTGTGGG - Intronic
1125117386 15:36111050-36111072 TTTCTAGGAAGCATTTTTGTTGG - Intergenic
1125915119 15:43479839-43479861 CTGGTATGAAACATGTTTTCTGG - Exonic
1126122493 15:45266135-45266157 GTGGCAGGAAACATCTTTGTGGG + Exonic
1127749524 15:62019891-62019913 GTGGTAGGAAACATGTTTTGGGG - Intronic
1128570386 15:68729388-68729410 CTGGTAGGGAGCATGGCAGTGGG - Intergenic
1129459216 15:75691822-75691844 CTGGTATGGAGCATCTCTGTAGG + Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1130299487 15:82668906-82668928 CTGCAAGGTAGCATGTATGTTGG - Intronic
1130580112 15:85129457-85129479 CTGGTAGGTTGCATGTTTCTAGG + Intronic
1134639251 16:15816619-15816641 CTGATATGAGGCATGTGTGTTGG + Intronic
1137459463 16:48647099-48647121 CTTGTAGGCAGCATGTATTTGGG + Intergenic
1143266538 17:5642242-5642264 CTGGTTGGACTGATGTTTGTAGG - Intergenic
1146755462 17:35428419-35428441 CTGTTAGAAAGCATCTTAGTGGG + Intronic
1149650958 17:58276152-58276174 CTGGGAAGAAGCATGCGTGTTGG + Intronic
1151346153 17:73502983-73503005 CTTTTGGGAAGCATATTTGTAGG - Intronic
1156703131 18:39848626-39848648 CTAATAGGATGCAGGTTTGTAGG - Intergenic
1156965481 18:43086381-43086403 TTGGTAGGTTGCATGTTTCTAGG - Intronic
1157591372 18:48838087-48838109 CTGATAGGGAGCAAGTTTGGGGG - Intronic
1158063038 18:53370175-53370197 TTGGTTGGTAGTATGTTTGTAGG + Intronic
1159084817 18:63776609-63776631 CTGGTATGAAGCATAGTTTTTGG + Intronic
1162478858 19:10916403-10916425 ATGGTAGGAAACATGTTTCCTGG - Exonic
1166459016 19:42969587-42969609 CTGGAAGGAAGTATCTTTTTGGG + Intronic
925113630 2:1357737-1357759 CTGGTAGGTTGTATGTTTCTAGG + Intronic
928082683 2:28324882-28324904 CTGGTAGTAAGCCTGTTAGAAGG + Intronic
929547047 2:42862675-42862697 CAGGTAGGAAGGAGGTGTGTTGG + Intergenic
931722916 2:65080447-65080469 CTGGAACAAAACATGTTTGTAGG - Intronic
931835251 2:66092355-66092377 CTTGGGAGAAGCATGTTTGTTGG - Intergenic
932102517 2:68913592-68913614 CTGTGAGGCAGCAGGTTTGTGGG + Intergenic
935585176 2:104794218-104794240 GTAGTAGGAATCATGTTGGTGGG + Intergenic
936111827 2:109671135-109671157 CTGGTAGGAAGCAGCAGTGTGGG - Intergenic
937180205 2:119988620-119988642 CTGGTAGGTTGTATGTTTCTGGG - Intergenic
937194325 2:120137619-120137641 CTGGTAGGCTGCATGTGTCTAGG - Intronic
938190003 2:129270045-129270067 TTGGTAGGTTGCATGTTTCTAGG - Intergenic
940545723 2:155081864-155081886 CTGGTAGGCAGAATGTTGCTAGG + Intergenic
941058026 2:160810770-160810792 CTGGCAGGAAGCATGTTGTCGGG + Intergenic
942107336 2:172645813-172645835 CTGGCAGAAAGGATGTTTGTTGG + Intergenic
943305488 2:186256122-186256144 TTGGTGGGAAGCTTGTTTGTAGG - Intergenic
944185024 2:196938653-196938675 CTTGTAAGAAGGATGGTTGTGGG + Intergenic
946642986 2:221804230-221804252 CAGGTGGCAGGCATGTTTGTAGG + Intergenic
946984550 2:225257338-225257360 CTTGTAGGAAGGATGATTGGTGG - Intergenic
1169389455 20:5177774-5177796 CTGGGAGGCAGCCTGTCTGTTGG - Intronic
1169878865 20:10325671-10325693 ATGGTAGGAGACATGTTTGTTGG - Intergenic
1171139439 20:22728493-22728515 CTGGCAGGAAGTAAGTCTGTGGG - Intergenic
1173430608 20:42983916-42983938 CTGATTGGAAGAATGTGTGTTGG - Intronic
1173450061 20:43156119-43156141 CTGGGAGGAACCTTGTTTGGGGG + Intronic
1173850823 20:46216633-46216655 TTGGTAGGAAGCATGGTTGGAGG + Intronic
1174006502 20:47415339-47415361 CTGGGAGCCAGAATGTTTGTTGG + Intergenic
1175486066 20:59347261-59347283 CAGGGAGGAAGCATCTTTGAAGG - Intergenic
1177379741 21:20324366-20324388 TTGGTAGGCTGCATGTTTCTAGG + Intergenic
1177970402 21:27782145-27782167 CTGGTAGGTTGCATGTTTCTAGG - Intergenic
1178199265 21:30385154-30385176 ATGGGAGGAAGCATGTTTTGAGG - Intronic
1178541882 21:33458781-33458803 CTGGTATGAAGCATATCTGAAGG - Intronic
1178749037 21:35283247-35283269 CTGACAGGAAGCAGGTCTGTGGG - Intronic
1180647218 22:17349242-17349264 CTGGGGCAAAGCATGTTTGTTGG - Intergenic
1182143630 22:27983426-27983448 CTGGTGAGAAGCATGTGTTTCGG + Exonic
1185160930 22:49229418-49229440 CTGTTAGGAGGCAAGTTCGTGGG - Intergenic
951607537 3:24452584-24452606 GTGGAAGGAAGCATGTTTCTCGG - Intronic
951662504 3:25085424-25085446 CTAGTAAGAAGCATGTTTGGGGG + Intergenic
953197563 3:40748712-40748734 CTGGGATGAAGCATGATTTTAGG + Intergenic
953501617 3:43441428-43441450 TTGGTAGGTTGCATGTTTCTAGG - Intronic
956622050 3:71231289-71231311 CAAGAAGGAAGCATGTTTGCAGG - Intronic
958920909 3:100104248-100104270 CTGGTAGGAGGCCCCTTTGTGGG + Intronic
960844695 3:121994854-121994876 CTGGGTGGAAGAAAGTTTGTGGG + Intronic
961103345 3:124220754-124220776 GAGGCAGGAAGCATGTTTGTGGG - Intronic
962447296 3:135478473-135478495 TTGGTAGGATGTATGTTTCTAGG + Intergenic
963825305 3:149946544-149946566 CTGGTAGGCTGTATGTTTCTAGG + Intronic
963941042 3:151096572-151096594 CTGGCAGAAAGCATTTTGGTGGG + Intronic
965635205 3:170773705-170773727 CTAGTAGGAAATGTGTTTGTAGG + Intronic
966281229 3:178231805-178231827 CTGGTAAGAGGCATGCTTCTAGG - Intergenic
969882507 4:10186768-10186790 CTGAGAGGAAGTATGTATGTTGG + Intergenic
971888727 4:32488839-32488861 TTGGTAGGCAGCATTTTCGTAGG + Intergenic
973588568 4:52416968-52416990 CTGCCAGGAAGTATGTTTGAAGG + Intergenic
978565276 4:110074582-110074604 CTGATAGGAATCACATTTGTTGG + Intronic
981116235 4:140994097-140994119 CTGGAAGCATGCATGTTTCTGGG - Intronic
982318416 4:154055842-154055864 CTTGTAGGCAGCATATTTTTTGG + Intergenic
983455670 4:167960619-167960641 CTGGTAGGCAGCATGTCTTCGGG - Intergenic
983521373 4:168712407-168712429 CTGGAGGGAAGCAGGCTTGTGGG + Intronic
986263493 5:6170603-6170625 TTGGTAGGTTGCATGTTTCTAGG - Intergenic
986862043 5:11937889-11937911 CTGGTAGGTTGTATGTTTCTAGG - Intergenic
987240256 5:15989916-15989938 TTGGTAGGATGTATGTTTCTAGG + Intergenic
989083252 5:37648577-37648599 TTGGTAAAAACCATGTTTGTTGG - Intronic
993982232 5:94557056-94557078 CTGGTAGGAAACATCATTTTGGG + Intronic
994120689 5:96109244-96109266 CTGATAGAAAGCATGTTGGGAGG - Intergenic
994673845 5:102796271-102796293 ATGTTAGGAACCAGGTTTGTCGG + Intronic
996402006 5:123072900-123072922 CAGTTATGTAGCATGTTTGTTGG + Intergenic
999286864 5:150399339-150399361 CTGGGATGGAGCCTGTTTGTAGG + Intronic
1000911905 5:167032406-167032428 CTGGTAGGAGGGATTTTTGAAGG + Intergenic
1002395189 5:178946984-178947006 TTGGTAAGAATCATGTGTGTGGG + Exonic
1002882308 6:1263683-1263705 CTGATAAGCGGCATGTTTGTTGG - Intergenic
1010887991 6:81267918-81267940 CTGGTAGGTTGTATGTTTCTAGG - Intergenic
1010956047 6:82091962-82091984 CTGGAAGGAGGCATGATTTTGGG - Intergenic
1011716409 6:90109663-90109685 CTGGAAAGAAGCAGGTTTGGAGG - Intronic
1012045876 6:94272411-94272433 GGGGTGGGAAGCATGTCTGTGGG - Intergenic
1014817925 6:125955277-125955299 CTGCTAGGAATTATGTTTCTTGG - Intergenic
1018974583 6:168555415-168555437 CTGGTGGGAAGCTTGATGGTGGG - Intronic
1019183296 6:170206439-170206461 GTGTTAGCAAGCATGTGTGTGGG + Intergenic
1021103858 7:16615246-16615268 CTGGTAAAAAGGATGTATGTGGG - Intronic
1024768664 7:52691610-52691632 ATGTTAGGAAGCATGGTGGTGGG + Intergenic
1025731917 7:64114974-64114996 CAGGTAGGATGCAGGCTTGTTGG - Intronic
1027591919 7:80128829-80128851 CTAGAAGGAACCATGTTTGGAGG - Intergenic
1028505964 7:91570439-91570461 TTGGTAGGAAGAATGATTGAAGG + Intergenic
1032501050 7:132400166-132400188 CTGGTATGAAGCTTGGTTCTGGG - Intronic
1035029472 7:155848172-155848194 CAGGTAGGAGGCAGGTGTGTGGG + Intergenic
1037100316 8:15035580-15035602 CTGGTAGGCAGCATATTGTTCGG - Intronic
1037418119 8:18673495-18673517 ATGGTTGGAAGCATGTCTCTTGG + Intronic
1037835726 8:22213795-22213817 CTGGAAGAACCCATGTTTGTGGG - Intergenic
1037925103 8:22838326-22838348 CTGTTAGGAAACAGGTTTTTTGG + Intronic
1038998162 8:32948848-32948870 CTGGTAGGTTGTATGTTTCTAGG + Intergenic
1041161252 8:55046438-55046460 CTTGTAGGCAGCATGTAGGTGGG - Intergenic
1042074433 8:64974978-64975000 CTGGTAGGTTGTATGTTTCTAGG + Intergenic
1043486301 8:80702194-80702216 CTGGGTGCAAGCATGCTTGTAGG + Intronic
1043996501 8:86824323-86824345 CTGGGAGGATTCATGTTAGTGGG - Intergenic
1047083275 8:121488464-121488486 TTGGTAGGTAGTATGTATGTAGG - Intergenic
1047316668 8:123741087-123741109 CTGGAAGGATGCATGCTTGGAGG + Intergenic
1050151143 9:2621209-2621231 CTGGTAGGTAGCATCTTCTTCGG - Intergenic
1052263333 9:26543197-26543219 CTGGGAGGAAGTATGTGTCTAGG - Intergenic
1052404693 9:28044756-28044778 CAGGTGGGAAGCATGTGTCTTGG + Intronic
1053383755 9:37670371-37670393 ATGGTAGAAAGCATGTATGAGGG + Intronic
1056328065 9:85497889-85497911 TTGGTAGGCAGTATGTTTTTAGG - Intergenic
1059413944 9:114151767-114151789 CTGGCAGGAAGACTGCTTGTGGG + Intergenic
1059783225 9:117551839-117551861 GTGGTAGGAAGCATCTTTGGGGG + Intergenic
1061634790 9:131900660-131900682 CTGGCAGAAAGCATGTGTGTGGG + Intronic
1061635451 9:131905528-131905550 CTGGAAGGACGCAGTTTTGTTGG - Intronic
1061830809 9:133293195-133293217 CTAGTAGGAAGAATCTTGGTTGG - Intergenic
1186185583 X:7016720-7016742 CTGGAAGGAAGTATCTTTTTGGG + Intergenic
1188058669 X:25573355-25573377 CTTGTAGGATGTATGTTTCTGGG + Intergenic
1189170873 X:38908169-38908191 CTGGTAGGATGCATTTTAATTGG + Intergenic
1192481297 X:71488509-71488531 CTGGTAGGTAGTTTCTTTGTGGG + Intronic
1193862876 X:86692855-86692877 CTGGTATTAATCATGTTTATTGG + Intronic
1201776757 Y:17673994-17674016 CAGGTTGGAAACATGTTTTTTGG - Intergenic
1201824799 Y:18231998-18232020 CAGGTTGGAAACATGTTTTTTGG + Intergenic