ID: 1090447809

View in Genome Browser
Species Human (GRCh38)
Location 11:126779199-126779221
Sequence CTGGACTCCTTGGTAAGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090447804_1090447809 0 Left 1090447804 11:126779176-126779198 CCTCATTGTCCATACATGGAAGT 0: 1
1: 0
2: 1
3: 12
4: 181
Right 1090447809 11:126779199-126779221 CTGGACTCCTTGGTAAGGTTTGG 0: 1
1: 1
2: 0
3: 9
4: 150
1090447802_1090447809 25 Left 1090447802 11:126779151-126779173 CCTTGCTTACACATCTTCAGGTG 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1090447809 11:126779199-126779221 CTGGACTCCTTGGTAAGGTTTGG 0: 1
1: 1
2: 0
3: 9
4: 150
1090447801_1090447809 26 Left 1090447801 11:126779150-126779172 CCCTTGCTTACACATCTTCAGGT 0: 1
1: 0
2: 3
3: 22
4: 185
Right 1090447809 11:126779199-126779221 CTGGACTCCTTGGTAAGGTTTGG 0: 1
1: 1
2: 0
3: 9
4: 150
1090447806_1090447809 -9 Left 1090447806 11:126779185-126779207 CCATACATGGAAGTCTGGACTCC 0: 1
1: 0
2: 0
3: 3
4: 110
Right 1090447809 11:126779199-126779221 CTGGACTCCTTGGTAAGGTTTGG 0: 1
1: 1
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090447809 Original CRISPR CTGGACTCCTTGGTAAGGTT TGG Intronic
905959538 1:42032356-42032378 TTGCACTTCTTGGTCAGGTTGGG - Intronic
909363768 1:74796243-74796265 ATGGACTCCTGGATGAGGTTGGG - Intergenic
912517359 1:110224794-110224816 CTGGGCTCCTGGGAAAGGTATGG + Intronic
913550964 1:119916351-119916373 TTTGCCTCCTTGGCAAGGTTAGG + Exonic
916084296 1:161257391-161257413 CTGGACTTCTGGGTCAGGTGGGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917596677 1:176536257-176536279 CTGGACTGCTAGGTAGGGTCCGG + Intronic
919853268 1:201688224-201688246 CTGGGCTCCTTGGTGGGGTGAGG + Intronic
922763228 1:228145073-228145095 CTGGACTCCTGGGTGGGGTGGGG + Intronic
922965701 1:229689171-229689193 CTGGGCTCCTTGGTAGGCCTGGG + Intergenic
1063685629 10:8235157-8235179 TTGGAATCATTGGTAAAGTTCGG - Intergenic
1066045064 10:31587783-31587805 CTGGGCTTCTTGGTAGGGTGGGG - Intergenic
1068793625 10:61053769-61053791 TTGGAGTCCTTTGTAAGTTTGGG + Intergenic
1075938525 10:126365806-126365828 CTGTGCTCCTTGATATGGTTTGG - Intronic
1079283870 11:19111693-19111715 CTGGACTCCTAGACCAGGTTAGG - Intergenic
1080389409 11:31830642-31830664 CTGGTCTGCTTTGTAAGGTAAGG + Intronic
1082661513 11:55917797-55917819 GTCTACTCCCTGGTAAGGTTTGG - Intergenic
1083057437 11:59836180-59836202 ATGGCCACCTTGTTAAGGTTGGG + Intronic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1089655530 11:119944241-119944263 CTGGACTCCGTGGACAGGTCTGG - Intergenic
1090447809 11:126779199-126779221 CTGGACTCCTTGGTAAGGTTTGG + Intronic
1090702704 11:129310725-129310747 CTGGACTTCTGGGTCAGGTGGGG + Intergenic
1093554070 12:20449782-20449804 CTGGATTACTTGGTCAGTTTTGG + Intronic
1095372383 12:41484657-41484679 TTGGACTCCTTGGTTTGGTCAGG - Intronic
1096383861 12:51181570-51181592 ATGTACTCCTTGGAAATGTTTGG + Intergenic
1097427989 12:59470949-59470971 CTGGACTTCTGGGTCAGGTGGGG + Intergenic
1101217151 12:102596035-102596057 CTGAACTCCTTGGTCAGGGGAGG + Intergenic
1101522866 12:105501278-105501300 CTGGGCTTCTGGGTCAGGTTGGG - Intergenic
1101927657 12:108985982-108986004 CTCCACTCCTTGGCAAGGCTGGG + Intronic
1108113461 13:47102450-47102472 CTGGACTTCTGGGTCAGGTAGGG + Intergenic
1109503069 13:63263733-63263755 CTGGACTTCTGGGTCAGGTGGGG + Intergenic
1110083543 13:71347007-71347029 CAGAACTCCTTGATATGGTTTGG - Intergenic
1111160150 13:84384159-84384181 CGGGACCCCTTGGTATGATTGGG + Intergenic
1111948068 13:94686414-94686436 CTTGACTCCTGGGCATGGTTTGG + Intergenic
1113726332 13:112605423-112605445 CTGAGCTCCATGGAAAGGTTGGG - Intergenic
1114772190 14:25440630-25440652 CTGGACTTCTGGGTCAGGTGGGG - Intergenic
1119087815 14:71753417-71753439 CTGAGCTCATGGGTAAGGTTGGG + Intergenic
1119605644 14:76013976-76013998 CTGGATTACTTGGTCAGTTTTGG - Intronic
1127323367 15:57868769-57868791 CTGGGCTACTTGGTCAGGTGGGG - Intergenic
1127554172 15:60071178-60071200 CTGGACCTCTTGGGAAGGGTGGG + Intergenic
1128596821 15:68959591-68959613 CTGGACTTCTAGGTCAGGTGGGG + Intronic
1128942758 15:71801970-71801992 CTGGACTTCTGGGTCAGGTGGGG + Intronic
1130348505 15:83069603-83069625 CTGGACTTCTGGGTAGGGTGAGG - Intergenic
1130923224 15:88366258-88366280 CTGGACTTCTGGGTCAGGTGCGG + Intergenic
1131908788 15:97173049-97173071 CTGGACTTCTGGGTCAGGTGGGG + Intergenic
1132002900 15:98197663-98197685 GTGAACTCCTTGGTAAGTGTGGG - Intergenic
1134316987 16:13127666-13127688 CTGGGCTCCAGGGTAAGCTTAGG + Intronic
1135394460 16:22120700-22120722 CTGATCTTCATGGTAAGGTTAGG + Intronic
1139837116 16:69847899-69847921 CTTGACTCCCTGCTATGGTTTGG - Intronic
1141326702 16:83066911-83066933 CTGAACCCCTTGGTAAAGTTAGG - Intronic
1141468318 16:84221720-84221742 CTGGAACCCGTGGAAAGGTTGGG + Exonic
1141492243 16:84381951-84381973 CTGGACTCCTTGTCAGTGTTAGG + Intronic
1143152632 17:4816877-4816899 CTGGACTCCTTGGGACACTTGGG - Intronic
1150063831 17:62092027-62092049 CAGGACTCATTGGTTAGGTTGGG - Intergenic
1153399186 18:4664580-4664602 ATAGACTCCTTGGTATGTTTTGG - Intergenic
1155102608 18:22627546-22627568 CTGGACTCCTAGAATAGGTTAGG - Intergenic
1155325991 18:24665448-24665470 CTTGACACTTAGGTAAGGTTAGG + Intergenic
1160060994 18:75528718-75528740 TTGAACTCCTAGGTATGGTTGGG - Intergenic
1161062582 19:2222548-2222570 CTCAACTCCATGGTAAGGATGGG + Exonic
1166755400 19:45187536-45187558 CTGGTCTCCTTGGGACTGTTGGG + Intronic
1167703750 19:51066106-51066128 CTGGAGTACTTGGTATGGTTAGG - Intergenic
927929852 2:27037084-27037106 CCGAAGCCCTTGGTAAGGTTGGG - Exonic
928808656 2:35194821-35194843 TTGAAGTCCTTGGTAAGGTGAGG + Intergenic
929950194 2:46404209-46404231 CTGGACTCCACTGTAAGGCTAGG - Intergenic
931926922 2:67083925-67083947 ATGGACTCCATTGTAAGTTTTGG - Intergenic
932871982 2:75409986-75410008 CTGGAGTCTTTGGGGAGGTTTGG - Intergenic
933797000 2:85927656-85927678 GTGGACTCTGTGGAAAGGTTGGG - Intergenic
935381980 2:102462209-102462231 GTGGACATCTTGGTAGGGTTAGG - Intergenic
937789359 2:125942835-125942857 CTGGACTCCTGAGTCAGGTGGGG - Intergenic
940073311 2:149713547-149713569 GTGGACTCTTTGGTTAGATTAGG + Intergenic
940600364 2:155851108-155851130 CTGAACTCCTTGGTCAATTTAGG + Intergenic
942909815 2:181229507-181229529 CTGGACTCCTTGTTGGGGTCAGG + Intergenic
943899381 2:193412692-193412714 CTGGACTTCTGGGTCAGGTGGGG - Intergenic
948512147 2:238475645-238475667 CTGGAATCCTGGTTAAGGTCTGG - Intergenic
1169443639 20:5653547-5653569 CTGGACTCTTTGATGAGATTAGG - Intergenic
1171348091 20:24481348-24481370 CTGGAGTCCTTGCCCAGGTTGGG + Intronic
1172911977 20:38416337-38416359 CTGGACAGCTTGGTGTGGTTGGG - Intergenic
1173003318 20:39121187-39121209 CTGGATTCAATGGGAAGGTTTGG - Intergenic
1179375239 21:40844918-40844940 CTGAACTCCTTGGAAAGGCCTGG - Intronic
1179546701 21:42117279-42117301 CTGGATTCCTTGTTATGGCTGGG + Intronic
1181038395 22:20180568-20180590 CTGAACTCCTAGGTCAGGGTCGG + Intergenic
1182539657 22:31031827-31031849 CTGGACATCTTGGTTATGTTAGG + Intergenic
1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG + Intronic
1184755476 22:46513404-46513426 TTGGACTTCTTGGTATGGTCAGG - Intronic
1184948089 22:47818469-47818491 CTGGACTTCTTGCTGAGCTTTGG - Intergenic
951089460 3:18555539-18555561 CCTGAATCCTTGGTAAAGTTTGG + Intergenic
951784692 3:26404525-26404547 CTGGGCTCCTTGGTATTATTGGG + Intergenic
954896691 3:53981041-53981063 CTGTAAACCTTGGTAAGCTTAGG + Intergenic
956584785 3:70852822-70852844 CTGGTCTCTTTGGTAGGATTTGG - Intergenic
956844241 3:73167792-73167814 CTGGTCTTCTTAGTCAGGTTGGG + Intergenic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
963340995 3:144033514-144033536 CTGGAGTCCTTGATAATGTTTGG + Intronic
967372597 3:188764698-188764720 CCAGACTCCTTGGTAATGCTAGG - Intronic
969096419 4:4736010-4736032 CTGGACTTCTTGGAAAGTTTTGG + Intergenic
969158057 4:5230615-5230637 CTGGACACCCTGGAAAGGTCTGG + Intronic
969514992 4:7642168-7642190 CTGGCCTCCTTGCCAAGGTTGGG + Intronic
969697288 4:8741946-8741968 CCGGACTGCCTGGTCAGGTTGGG - Intergenic
971944229 4:33253531-33253553 GTGGAAACCTTGGTAAGTTTGGG + Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
976951637 4:90839698-90839720 CTTAACTACTTGGTAAGATTGGG - Intronic
977640599 4:99354239-99354261 CTGGACTTCTGGGTCAGGTAGGG - Intergenic
980655299 4:135775052-135775074 CTGGGCTCCTGGGTCAGGTGGGG - Intergenic
983084668 4:163428133-163428155 CTGGACTTCTGGGTCAGGTGGGG + Intergenic
983667848 4:170202183-170202205 CTGGAGTCCTTGGGCAGGCTGGG - Intergenic
987676651 5:21083224-21083246 CTGGACTTCTGGGTCAGGTGGGG + Intergenic
988775618 5:34475770-34475792 CTGAGCACCTTGGCAAGGTTGGG + Intergenic
989167492 5:38445949-38445971 CTGAACTCCTTGCAAGGGTTGGG - Intronic
993264373 5:85705068-85705090 CTGGAATTGTTGGTAAGGATAGG + Intergenic
994530875 5:100968776-100968798 CTGGACTCCATCGCAAGGCTTGG - Intergenic
994957110 5:106546172-106546194 TTGGACTCCTTGGTAACATTTGG + Intergenic
997378752 5:133420482-133420504 CTGGATTGCTTGTTAAGATTTGG - Intronic
1000718631 5:164678803-164678825 CAGGACTGGTTGGTAGGGTTGGG + Intergenic
1000777538 5:165439474-165439496 CTGGACTCTTTGTTCAGGTGGGG + Intergenic
1001963697 5:175895587-175895609 TTGCACTCCTTGGCAAGGTGAGG + Intergenic
1003819301 6:9878046-9878068 CTCCACTGCTTGGGAAGGTTTGG - Intronic
1005232903 6:23724897-23724919 CTGGTCTGTTTTGTAAGGTTCGG - Intergenic
1005813559 6:29533118-29533140 CTGGCCACCTTGGTGAGGGTGGG + Intergenic
1009385052 6:63077917-63077939 CTGGACTTCTGGGTCAGGTGGGG - Intergenic
1010551596 6:77230146-77230168 CTGGACTCCATGGTCGGGTATGG - Intergenic
1016482226 6:144495054-144495076 CTGGACTCCTGGGTCTGGTGGGG - Intronic
1016756789 6:147696254-147696276 CTGAACTTCTTAGTGAGGTTGGG + Intronic
1016839556 6:148512682-148512704 CTGGACTCCCAGGTAACGGTGGG - Intronic
1019069838 6:169335237-169335259 GTGAAAACCTTGGTAAGGTTGGG + Intergenic
1020611684 7:10404918-10404940 TTGGTCTCCTTGGTTAGATTAGG - Intergenic
1022479847 7:30735715-30735737 CTGGTCTCCTGTGTAAGGATAGG + Intronic
1023844058 7:44111357-44111379 CTGGCCTCCTTCCTAAGGTGAGG - Intronic
1028196510 7:87913705-87913727 ATGGAGTCCTGGCTAAGGTTTGG - Intergenic
1028699650 7:93762425-93762447 CAGGTCACCTGGGTAAGGTTCGG + Intronic
1031529435 7:122858233-122858255 CTGGACTTCTGGGTAGGGTGGGG - Intronic
1035993718 8:4522024-4522046 CTGGAGTCATTGATACGGTTTGG + Intronic
1037196592 8:16198434-16198456 CTAGAAGCCTTGTTAAGGTTTGG - Intronic
1042668039 8:71229114-71229136 ATGGGCACATTGGTAAGGTTAGG - Intronic
1043256696 8:78147710-78147732 CTGGACTTCTTGGTCAGGTGGGG + Intergenic
1043919781 8:85968153-85968175 CAAGACTCCCTGGTAAGGATGGG - Intergenic
1045678327 8:104632797-104632819 CTGGACTCCTGAGTCAGGTGGGG - Intronic
1047806415 8:128365536-128365558 TTGGACTCAATAGTAAGGTTTGG + Intergenic
1048136664 8:131752877-131752899 TTGGACTCCTGGGCAAGATTAGG - Intergenic
1048366509 8:133743279-133743301 CTGAGCTCTTTGGTAAGGTGAGG + Intergenic
1049209482 8:141378903-141378925 CTGGGCCCCTTGGTAAGGGCTGG - Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1051272482 9:15368752-15368774 CTGGCCTCCTTGGTAGATTTTGG - Intergenic
1055719227 9:79153135-79153157 TTTGACTCCTTGGCAACGTTGGG + Intergenic
1056056424 9:82828701-82828723 CTGGACACCTTGGTGGGTTTGGG + Intergenic
1056645733 9:88410001-88410023 CTTGACAGCTTGGTAAGATTAGG - Intronic
1059733002 9:117075216-117075238 CTGGACTCCTTTGGGAGATTTGG - Intronic
1060558017 9:124519407-124519429 TTGGAGTCCTTTGCAAGGTTTGG - Exonic
1060817075 9:126640629-126640651 CTGGCCTCCTTGGGAAGGGTAGG + Intronic
1188045035 X:25415873-25415895 CTGGAGTCGTAGGTATGGTTTGG + Intergenic
1189617000 X:42794352-42794374 TTGGACCCCTTGGCCAGGTTAGG + Intergenic
1192423597 X:71055662-71055684 CTCAACTCCTTGGCAAGGGTGGG + Intergenic
1192763344 X:74119004-74119026 CTGAACTCTTAGGTAGGGTTAGG - Intergenic
1196853036 X:119956884-119956906 CTGGACTTCTGGGTCAGGTGGGG - Intergenic
1197913478 X:131511137-131511159 TTGGCCTCCTTAGTGAGGTTGGG + Intergenic
1198548475 X:137719479-137719501 GTGGACACCGTGGTAAGGCTTGG + Intergenic
1199169363 X:144717949-144717971 CTGGACTCCTTGGCCAGGGGAGG - Intergenic
1199652314 X:149958613-149958635 CAGGACTCATGGGTAAGGGTGGG - Intergenic
1200534476 Y:4377811-4377833 CTGTACAGCTTGGTAAGGTAAGG + Intergenic
1201052360 Y:9950413-9950435 GTGGACACCTTGGGAAGGTGGGG + Intergenic
1202241136 Y:22770919-22770941 GTGGACACCTTGGGGAGGTTGGG - Intergenic
1202394122 Y:24404662-24404684 GTGGACACCTTGGGGAGGTTGGG - Intergenic
1202476663 Y:25265430-25265452 GTGGACACCTTGGGGAGGTTGGG + Intergenic