ID: 1090449753

View in Genome Browser
Species Human (GRCh38)
Location 11:126796116-126796138
Sequence TTTTGCTAATGCAATAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090449751_1090449753 4 Left 1090449751 11:126796089-126796111 CCATGGGGTCCATGGATCTTATT 0: 1
1: 0
2: 2
3: 11
4: 174
Right 1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG 0: 1
1: 0
2: 2
3: 18
4: 274
1090449746_1090449753 28 Left 1090449746 11:126796065-126796087 CCTTTCAATGGGACACGTTTTTA 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG 0: 1
1: 0
2: 2
3: 18
4: 274
1090449752_1090449753 -5 Left 1090449752 11:126796098-126796120 CCATGGATCTTATTTTAGTTTTG 0: 1
1: 1
2: 0
3: 45
4: 522
Right 1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG 0: 1
1: 0
2: 2
3: 18
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090449753 Original CRISPR TTTTGCTAATGCAATAAAGT TGG Intronic
902130270 1:14254269-14254291 TTTTGCTAATACAATGCACTTGG + Intergenic
903105187 1:21072160-21072182 CTTTTCTAAGGTAATAAAGTTGG + Intronic
903391748 1:22969256-22969278 TTTTGGTTATAGAATAAAGTAGG + Intergenic
903986048 1:27229535-27229557 TTTTGCTATTATAATACAGTTGG + Intergenic
906969973 1:50502400-50502422 TTTTGCTAATAAAATCAAGCGGG - Intronic
907412246 1:54290903-54290925 TTTTGCTAATGGTGTAAACTAGG - Intronic
907469127 1:54661052-54661074 TTTTGCTCATTTAAAAAAGTTGG + Intronic
908304600 1:62799227-62799249 TTTTGTTACAGAAATAAAGTGGG + Intronic
908491991 1:64654231-64654253 TTTGGCAAATGCAACAAAGCTGG - Intronic
908983719 1:69990931-69990953 TTTTACAAAGGCAATAGAGTTGG + Intronic
909345454 1:74580219-74580241 TATTGCTAAATTAATAAAGTGGG - Intronic
910857296 1:91708245-91708267 TTTTGATAAAGCAATACAATAGG + Intronic
911439609 1:97908899-97908921 TTTTGCTTGGGCAATAAAGTTGG - Intronic
911549430 1:99261922-99261944 TTTTGCTATTGAAATTAGGTGGG + Intergenic
911932129 1:103918081-103918103 TGTTGCCATGGCAATAAAGTAGG - Intergenic
911966552 1:104379473-104379495 TTTTGGTATTGGAATAATGTTGG - Intergenic
911994356 1:104745524-104745546 TTTTCCTGATGCAAGAAAATTGG + Intergenic
916724717 1:167512615-167512637 TTTTCCCAATGCAATAATGGGGG - Intronic
916996666 1:170308819-170308841 TTTGGCTCATGCAATGGAGTAGG - Intergenic
917189999 1:172405634-172405656 TTTTGATAATGGAATTAATTAGG - Intronic
918839954 1:189522191-189522213 TTTTTCTAATGCAAAGATGTGGG - Intergenic
921565574 1:216713799-216713821 TTTTGCTAATGTAACAGTGTTGG + Intronic
922855228 1:228769385-228769407 TTTAGTTAATGCACCAAAGTTGG + Intergenic
923756030 1:236791953-236791975 ATTTGCTACTGCTATACAGTAGG + Intergenic
923938164 1:238788233-238788255 TTTAGCTAAAGGAATAAAATTGG - Intergenic
924157183 1:241190808-241190830 TATTGCTAATGCAATAAGATGGG - Intronic
924187744 1:241513614-241513636 GATTGCTAATGCAATAATGAAGG - Exonic
1065439845 10:25740774-25740796 TTTTACTATTGAAATTAAGTTGG + Intergenic
1067998148 10:51299509-51299531 TTTTGCTCATTCTTTAAAGTAGG + Intronic
1068212396 10:53937354-53937376 TTTTGCATTTGCAATAAAATAGG + Intronic
1069322915 10:67195239-67195261 TTTTACTAATGAAATAAATATGG + Intronic
1072087445 10:92094288-92094310 TTTTTTTCATGCAATAAAGGTGG - Intronic
1073668686 10:105562738-105562760 ATTTGCTCATGCATTAAAATGGG + Intergenic
1073718067 10:106131213-106131235 TTTAGGTACTGCAAAAAAGTAGG + Intergenic
1073937775 10:108654739-108654761 TTTTGAAAATGCAATTCAGTGGG + Intergenic
1079910211 11:26300395-26300417 CTTTGCAAATGCTATAAAATGGG - Intergenic
1079929990 11:26546508-26546530 TTTTGTTCCTGCAATAAAGATGG - Intronic
1084391589 11:68880760-68880782 TTATGCTAATGAGATAAATTAGG - Intergenic
1085930879 11:81082150-81082172 TTTTTATCATGAAATAAAGTTGG + Intergenic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1086865966 11:91980738-91980760 TATTGCTAATGGCATACAGTGGG + Intergenic
1087518529 11:99199720-99199742 TTTGGCTAATGCAATATTGGAGG - Intronic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1090942800 11:131403014-131403036 TTTTTCTACTGCAATTAAATTGG - Intronic
1090980108 11:131712551-131712573 TTTTGAAAATGCAAAGAAGTAGG - Intronic
1091411982 12:247434-247456 ATTTGCTGAAGCAATAAAGGAGG + Intronic
1094276265 12:28679364-28679386 ATTTGCTAACACAAGAAAGTAGG + Intergenic
1094392640 12:29968749-29968771 TATTGGTAAGGCAATAAAATTGG - Intergenic
1095629787 12:44362131-44362153 TTTTGCAAAGGAAATAAACTAGG - Intronic
1096857779 12:54497527-54497549 TTTTGGTAAGGCTATGAAGTGGG - Intergenic
1097390193 12:59002248-59002270 TTGTGCTAAGGCAATAAAACCGG + Intergenic
1097423928 12:59418053-59418075 TTTTACTTATGTTATAAAGTAGG + Intergenic
1097443071 12:59634659-59634681 TTTTGCTAAAGCAACATAGCAGG + Intronic
1098901397 12:76115431-76115453 GTTTGCAAATGCAATGAATTGGG - Intergenic
1102732793 12:115127893-115127915 TCTTGTAAATGCAATATAGTTGG + Intergenic
1103082202 12:118033858-118033880 TTTTGATTATGCAACTAAGTAGG - Intronic
1105646896 13:22329695-22329717 TTTGGTTTATGAAATAAAGTTGG - Intergenic
1105679421 13:22710357-22710379 TTTTGCAAAAGCAACAAACTGGG + Intergenic
1105817972 13:24053855-24053877 TCTTGTTAATGCCATGAAGTAGG + Intronic
1106414273 13:29533317-29533339 TTTTTTTAATGAAACAAAGTAGG - Intronic
1108624883 13:52218111-52218133 TTTTGCTAATGGTATAAAAGTGG + Intergenic
1108681015 13:52780170-52780192 TTATGCTGAAGCAATAAAGGAGG + Intergenic
1109575262 13:64248460-64248482 TTTTGGTAATGCAGAAAAGATGG - Intergenic
1109792066 13:67262032-67262054 TTTTGGAAATGCAACGAAGTTGG + Intergenic
1109969364 13:69745542-69745564 TTTTTTTAAAGCAATAATGTTGG + Intronic
1110943461 13:81383227-81383249 TTTTGTTCATGGAATAAAGGTGG + Intergenic
1111308638 13:86450663-86450685 TTATGCTAATGAAATGAATTAGG - Intergenic
1111561997 13:89964014-89964036 GTCTGCTAATGCGATAATGTTGG + Intergenic
1111965967 13:94862182-94862204 TTTTGCTAATGTGAAAATGTCGG - Intergenic
1112615876 13:101004911-101004933 TATTCCTAATGCAACAATGTTGG + Intergenic
1113514415 13:110881748-110881770 TTTTACTAAGAGAATAAAGTAGG + Intronic
1115091120 14:29577029-29577051 TTTTGTTAATACAACACAGTTGG + Exonic
1115175255 14:30554733-30554755 TTTTGCTAATCCAATAAACTTGG + Intergenic
1115298742 14:31859996-31860018 TTTTGTTAATTAAAAAAAGTCGG + Exonic
1115987575 14:39117845-39117867 TTTTGCAGATGTAAAAAAGTAGG - Intronic
1116212057 14:41960784-41960806 TTTTGCTAGTGGGATAAAGTGGG + Intergenic
1116569259 14:46494741-46494763 TTATGTAAATGCAATAAATTCGG + Intergenic
1119755596 14:77116475-77116497 TTTTTCCAATGGAATAAATTTGG - Exonic
1120635461 14:86944983-86945005 TTTTTCTAAGGCAATTCAGTTGG - Intergenic
1120944772 14:89983665-89983687 TTCTTCAAATGCAAAAAAGTGGG - Intronic
1121589462 14:95091499-95091521 TTTTACTATTACAATATAGTAGG - Intronic
1123974293 15:25538125-25538147 ATTTTTTAATGCAAAAAAGTGGG + Intergenic
1124135882 15:27035999-27036021 ATTTGCTAATCCAATAAATATGG + Intronic
1124386365 15:29211170-29211192 TTTTGCTACTGCTATAAATGAGG + Intronic
1124992610 15:34691020-34691042 TTTTGCTGATGCCATGATGTGGG + Intergenic
1126011732 15:44309516-44309538 TTTAGCTAAAACAATAAATTGGG - Intronic
1127241084 15:57114928-57114950 TTTTGGTAATGCAACAAGGAAGG + Intronic
1130679137 15:85981141-85981163 TTTTCCTCCTGCAATAACGTGGG - Intergenic
1134333534 16:13272225-13272247 TTTTATAAAAGCAATAAAGTAGG + Intergenic
1139114969 16:63939282-63939304 TATTGCTTTTGCAATCAAGTGGG + Intergenic
1140603072 16:76501368-76501390 TTTGGCTAATGAAATAAGGAAGG - Intronic
1141073760 16:80983120-80983142 TTGTATTCATGCAATAAAGTAGG - Intronic
1142005722 16:87688807-87688829 TTCTCCTAATGGAATAAAGTCGG + Intronic
1145233172 17:21189800-21189822 TTTTGTTAATGCAGAAAAGTAGG - Intronic
1145843374 17:28015577-28015599 TTTTGCTTATGGTATGAAGTAGG + Intergenic
1148232598 17:45945853-45945875 TATTGTTAAGGGAATAAAGTAGG + Intronic
1148406768 17:47423097-47423119 TTTTGTGAATGCTATAAAGAAGG - Intronic
1148407376 17:47428704-47428726 TTTTGTGAATGCTATAAAGAAGG - Intronic
1149364254 17:55925314-55925336 TTTTGCTAATACAATCATATGGG + Intergenic
1149733186 17:58966710-58966732 TTATGTTAATGCAAACAAGTAGG + Intronic
1152971177 18:162752-162774 ATTTGCTAATGTCATAAAATTGG - Intronic
1153904229 18:9646819-9646841 TTGTGCAAATGCAAAGAAGTAGG + Intergenic
1154943847 18:21141217-21141239 TTTTGTTCATGAAACAAAGTTGG - Intergenic
1155868323 18:30994193-30994215 TTCTGCTAATGTAATAAATTTGG + Exonic
1156917409 18:42478037-42478059 TTTTGCAAATGAAAAAAACTAGG - Intergenic
1157381297 18:47220678-47220700 TTTCCCTAATGCAATAAATATGG - Intronic
1158231055 18:55255879-55255901 TTTTTCTCATGCAATAGAGCTGG - Intronic
1158815840 18:61095795-61095817 TGTTGCTAATCAACTAAAGTAGG + Intergenic
1159120727 18:64166400-64166422 TTTTGATAATTAAATAAATTTGG + Intergenic
1159164070 18:64681037-64681059 TTTTGATAATGTCATAGAGTTGG + Intergenic
1162607273 19:11719310-11719332 TTTTGATAATAAAATAAAGTGGG + Intergenic
1163403346 19:17107819-17107841 CTTTGCAAATGCAATTAGGTAGG - Intronic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1166582994 19:43919268-43919290 TTTTTTTAATGAAATAAAATGGG - Intronic
929271952 2:39982335-39982357 TTCTCCTAATGAAATAAAATAGG + Intergenic
929662612 2:43803593-43803615 TTGTGCTAGTGGAATTAAGTTGG + Intronic
930485155 2:52002181-52002203 TTTTGTAAATGCAATAAATAAGG - Intergenic
930549634 2:52815930-52815952 TTATGTTATTGCAATTAAGTTGG - Intergenic
931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG + Intronic
931593129 2:63908640-63908662 TTTGGCTAATGCATCAGAGTGGG - Intronic
931888060 2:66639829-66639851 ATTTGCAAATGCAAAAAAGATGG - Intergenic
933015822 2:77125755-77125777 TTTTTCAAATTCAATAAATTAGG - Intronic
933581590 2:84132802-84132824 TTTTTCTCCTGCAATAAACTAGG + Intergenic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934604766 2:95686294-95686316 TTTTACTAATAAAATAAGGTGGG - Intergenic
934742469 2:96734961-96734983 TTTTTCTACTGTAATAAATTAGG - Intronic
935346669 2:102114595-102114617 TTTTGCTATTGTGATAATGTGGG + Intronic
936001823 2:108839867-108839889 TCTAGCTAATGCAATAAGGTAGG - Intronic
936013171 2:108938670-108938692 TTTTGATAAGGCAAAAAAGTAGG - Intronic
936538215 2:113328822-113328844 TTTTACTAATAAAATAAGGTTGG - Intergenic
936748915 2:115616563-115616585 TTTTGCTAATGTTACAAACTGGG - Intronic
936796385 2:116209795-116209817 ATTTAGTTATGCAATAAAGTAGG - Intergenic
937172886 2:119894850-119894872 TTTTGCTAATCTGATAAAATTGG - Intronic
939554059 2:143652904-143652926 TTTAGCCAATGCAATAAGGCAGG - Intronic
939560528 2:143726313-143726335 TTTGGCAAATGCCTTAAAGTAGG - Intronic
939647524 2:144719136-144719158 ATTTGCTAATACAAAAAAGCAGG + Intergenic
941406203 2:165091923-165091945 TCATTGTAATGCAATAAAGTTGG - Intronic
941433852 2:165443852-165443874 TTTTGCTAATGGAAGAGAATCGG + Intergenic
941589831 2:167406131-167406153 TTTTGCATATGGTATAAAGTAGG - Intergenic
942437819 2:176000301-176000323 TTTTGCAAATGCAATAACTGAGG - Intronic
942808882 2:179972571-179972593 TTTTTATAAAACAATAAAGTTGG - Intronic
942997758 2:182285297-182285319 TTTTGTTCAAGCAATAAAGTTGG + Intronic
943190190 2:184666435-184666457 TTTAGCTAATCAAATACAGTAGG + Intronic
944075532 2:195726180-195726202 TCTTGCTATGGCAACAAAGTTGG + Intronic
945275063 2:207979979-207980001 TTCTGATAATGCAATAAGGGAGG + Intronic
946105058 2:217361869-217361891 TTTTGTTAAGGTAATAAGGTGGG - Intronic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
947401819 2:229738646-229738668 ATGTGCTATTGCAATTAAGTTGG + Intergenic
947954279 2:234174354-234174376 TTTTGGTAATTTAATAATGTTGG - Intergenic
949078483 2:242076908-242076930 TTTTGCTGAAACAATATAGTAGG - Intergenic
1169176551 20:3520803-3520825 TTTTACTAGTGTGATAAAGTTGG - Intronic
1170207800 20:13818141-13818163 TGTTGCTAATACAGTAAAGGAGG - Exonic
1173721875 20:45266077-45266099 TTAGGCCAATGCAATAAAATTGG - Intergenic
1174482205 20:50839153-50839175 TTTTACTAATGGAACAAAGCAGG + Intronic
1179204100 21:39257263-39257285 TATTGTTAAGGCAATACAGTAGG + Intronic
949212010 3:1514368-1514390 TTTTTCCAAAGCAAGAAAGTCGG + Intergenic
950087899 3:10273583-10273605 TTTTTTTAATGTAATAAAGATGG - Intronic
951397630 3:22189140-22189162 TTTTGCTCATATACTAAAGTTGG + Intronic
951869643 3:27346987-27347009 TTCTGATAACACAATAAAGTTGG + Intronic
953588475 3:44228110-44228132 TTCTGGTAATGCCATGAAGTGGG - Intergenic
953767722 3:45756755-45756777 TTTTTTAACTGCAATAAAGTAGG - Exonic
954043227 3:47906343-47906365 TATTTCTAATGAAAAAAAGTTGG + Intronic
955653320 3:61217826-61217848 TTATTATAATGCATTAAAGTTGG + Intronic
956383913 3:68696475-68696497 TTTTGGTATTGCTATAAATTTGG - Intergenic
956965650 3:74456347-74456369 TCATGCTACTGCAATAAATTTGG - Intronic
957953138 3:87150065-87150087 TTTTACTAGGGCAATAAAGAGGG - Intergenic
958045861 3:88282774-88282796 TTTTGCTCATAACATAAAGTGGG - Intergenic
958760694 3:98304406-98304428 TTTTGCTTATTTAATAAAATTGG - Intergenic
958992065 3:100858051-100858073 TTCTGATGATGCAATAAAATTGG - Intronic
959820657 3:110731108-110731130 TTGTGGTAATGCAAGAAAATTGG + Intergenic
959906782 3:111719072-111719094 TTTTGTTTATGGTATAAAGTAGG - Intronic
959980068 3:112506285-112506307 TTTTGCTAATGCAACTCTGTTGG - Intergenic
960214978 3:115022544-115022566 TTTTGCTATGGCAATAAACTTGG - Intronic
962670040 3:137695554-137695576 TTTTGCTAATGGAGTTAAGGGGG - Intergenic
963131694 3:141864307-141864329 TTTTGGTAATCCATTAAAGAAGG - Intergenic
964345641 3:155751888-155751910 TTTTGCCAAGGCAGTAAAGTGGG - Intergenic
964452810 3:156827745-156827767 TTATGCTAAGGCCATAAAGTTGG + Intronic
966452779 3:180080687-180080709 TTTAGCTAATGCAATAAGACAGG + Intergenic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
971983147 4:33781267-33781289 TTCTGTTAAGGAAATAAAGTAGG + Intergenic
972135033 4:35882004-35882026 TTCTACTGATTCAATAAAGTTGG - Intergenic
973741456 4:53923313-53923335 TTTTGCTAAAACACTAAAATAGG + Intronic
974066137 4:57079302-57079324 TTTTACTAATGAAGTACAGTGGG - Intronic
975868845 4:78755750-78755772 ATTTTTTAATGTAATAAAGTAGG - Intergenic
976219481 4:82744405-82744427 AGTTACTAATGCATTAAAGTTGG + Intronic
976307584 4:83576258-83576280 TTTTGCTAATGCAAACAATGTGG + Intronic
976633821 4:87267177-87267199 TTTTTCTAGTGTAACAAAGTGGG - Intergenic
978432510 4:108647770-108647792 TCTTTCTAATGCAATATTGTGGG - Intergenic
979817718 4:125130545-125130567 TGTTGATAATGCCATAAAGTAGG - Intergenic
980620906 4:135302391-135302413 TTTTGCTATAGCAATATAATTGG + Intergenic
981015471 4:139969388-139969410 TTTTTCTGATGCAAAAATGTGGG - Intronic
982172676 4:152677039-152677061 TTCTGCTCATGGAGTAAAGTGGG - Intronic
982590766 4:157306837-157306859 TTTTGCTTATGCTTCAAAGTAGG + Intronic
983295138 4:165857403-165857425 TTTTCCTAATTTAATAAACTGGG - Intergenic
984202130 4:176737097-176737119 ATTAGTTAATACAATAAAGTGGG - Intronic
984704402 4:182837169-182837191 ATTTCCTAATGCAGGAAAGTGGG - Intergenic
986083041 5:4413950-4413972 TTTTGCAAATTCAATTAAATTGG + Intergenic
988303198 5:29461057-29461079 TTTCAGTAATGCCATAAAGTGGG - Intergenic
988439027 5:31210888-31210910 CTTTGCTTATACAATACAGTTGG - Intronic
988926120 5:35992475-35992497 TTTTGCTAATGCATTATAAAAGG - Intergenic
990351097 5:54917514-54917536 TTTTGCTGATTCCATAAATTTGG + Intergenic
990506298 5:56448815-56448837 TTTTGCTTATGTGATAAAGAGGG - Intergenic
991376537 5:65973926-65973948 TTGTGCTAATACATAAAAGTGGG + Intronic
992638581 5:78748978-78749000 TTTTGTAAATGCAGTAAAATGGG - Intronic
992751732 5:79868690-79868712 TGTTGAGAATGGAATAAAGTTGG + Intergenic
994258342 5:97627487-97627509 TCTTGTTAATGCAAGAAAGATGG + Intergenic
994796494 5:104307249-104307271 TTTTTTTAATAAAATAAAGTTGG + Intergenic
995372585 5:111435751-111435773 TTTGGCTAATGAAATAAAGGTGG - Intronic
996436359 5:123437011-123437033 TTTTGCTGACACAAGAAAGTAGG - Intergenic
996458754 5:123716618-123716640 TTTTCTTAATGCAACAAAATGGG + Intergenic
998758250 5:145404236-145404258 TTTAGCTTATGCAAGAAAGATGG + Intergenic
1001848318 5:174940926-174940948 ATTGGCAAATGCAATAAAGCAGG - Intergenic
1003337032 6:5183508-5183530 TTGCACCAATGCAATAAAGTTGG + Intronic
1003821563 6:9903900-9903922 ATGTGCTATTGCAATATAGTAGG + Intronic
1003993461 6:11512672-11512694 TTCTGCTTATGTAATATAGTTGG + Intergenic
1005030686 6:21506045-21506067 TTTTGATAATGGGAAAAAGTTGG + Intergenic
1006209360 6:32382214-32382236 TTTTGCTAATTCAAAAGATTAGG - Intergenic
1006649156 6:35536730-35536752 TATTTCTAATGCTATAAGGTTGG - Intergenic
1007220216 6:40272984-40273006 ATTTGCTAAAGCAATTAAGATGG - Intergenic
1008706007 6:54159863-54159885 TTTTGCTTATGCAGTCAATTTGG - Intronic
1008842678 6:55922619-55922641 TTTTGCCATTCAAATAAAGTTGG + Intergenic
1009889734 6:69666212-69666234 TTTTGATAATGCAACAGAGTAGG + Intergenic
1010398780 6:75424684-75424706 TCTGGAAAATGCAATAAAGTTGG - Intronic
1010520811 6:76834060-76834082 TTTTCCTAATTTAGTAAAGTTGG + Intergenic
1011802718 6:91036008-91036030 ACTTGCTAATGCAATAAAAGGGG + Intergenic
1013474854 6:110497751-110497773 TTGTGATAAGTCAATAAAGTTGG + Intergenic
1015577369 6:134686511-134686533 TATTGCTATTGCAGTAAAATTGG - Intergenic
1020539705 7:9444962-9444984 TTTTTCTAATGAAATAAATAAGG + Intergenic
1020900559 7:13997860-13997882 TCTTGCTAAGGCAATGAAGAAGG - Intergenic
1020944421 7:14583865-14583887 TTTTTTTATTGCAATAAAATAGG - Intronic
1021915254 7:25425454-25425476 TTTAGCTAATGCCATTAATTTGG - Intergenic
1021980523 7:26050158-26050180 TTTTCCTGATGCCATACAGTTGG + Intergenic
1022570934 7:31453704-31453726 TATTGCTAAGGAAAAAAAGTGGG + Intergenic
1023095107 7:36652369-36652391 ATTGGCTAATTCAATAAATTAGG + Intronic
1023293840 7:38694206-38694228 TAATTCTAATGCAATAAAGATGG - Intergenic
1023653795 7:42399191-42399213 TTTTGCTTATGGAATGAAGAAGG - Intergenic
1024479726 7:49851288-49851310 TTTTGCAAATGTAATTAAGAAGG - Intronic
1024668544 7:51569070-51569092 TTATTCTAATGCAATAAAAATGG + Intergenic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1026193701 7:68153097-68153119 TTTTCCTATTACAATAAAGCAGG - Intergenic
1030642041 7:112017313-112017335 TTTTGGAAATGTTATAAAGTTGG + Intronic
1030986136 7:116244488-116244510 GTGTGCTAATGCAAAAAAGGTGG + Intronic
1032832287 7:135640403-135640425 TTTTGGTAATTATATAAAGTTGG + Intronic
1033520579 7:142156421-142156443 TTCTACCAAAGCAATAAAGTTGG + Intronic
1033536358 7:142315504-142315526 TTTATCTACTGCAATCAAGTAGG - Intergenic
1036211139 8:6842142-6842164 TTTAGCTAAAGCCATAAAGCTGG + Intergenic
1036957905 8:13210648-13210670 TTTTGCTATTGTAACACAGTTGG + Intronic
1038549129 8:28450289-28450311 TTTTGCATATGGTATAAAGTTGG - Intronic
1038692824 8:29778741-29778763 TTTTGTTAATACACTACAGTTGG + Intergenic
1038936921 8:32262349-32262371 TTCTGCAAATGCAAATAAGTTGG - Intronic
1039262868 8:35791319-35791341 TTTTTCTAACACAACAAAGTGGG + Intronic
1040645925 8:49396611-49396633 TTTTGTTCATGTAATAAATTTGG - Intergenic
1041627082 8:60042482-60042504 TTGTGCTATTGCAGAAAAGTTGG - Intergenic
1042150212 8:65773995-65774017 TTTTGGTATTGCAATAAATAAGG - Intronic
1043914869 8:85910757-85910779 TTCTGCTAATCCAATGAGGTAGG + Intergenic
1044168634 8:89021242-89021264 CTTTGCTTGTGCAATAAAATAGG - Intergenic
1044534937 8:93347628-93347650 TTTTAATTTTGCAATAAAGTTGG - Intergenic
1044631967 8:94288917-94288939 TATTTCTAATGCTATAAAATTGG + Intergenic
1044890249 8:96827412-96827434 TTTTACTAAAGCAATAATTTAGG - Intronic
1045167050 8:99618423-99618445 TTTTGAGAATGCAATTAACTAGG - Intronic
1047898508 8:129393898-129393920 TTTTACCAATCCAATAAAGCAGG - Intergenic
1052561751 9:30092068-30092090 TTTTCCTGATGGACTAAAGTTGG - Intergenic
1055014887 9:71605776-71605798 TTTTTGTAATGTAATAAAATAGG + Intergenic
1055945048 9:81686389-81686411 AGTAGCTACTGCAATAAAGTGGG + Intronic
1056373641 9:85985114-85985136 TTTTATTAAAGCAATCAAGTGGG - Intronic
1057563100 9:96144307-96144329 TTTTGGAAAAGAAATAAAGTAGG + Intergenic
1058783029 9:108358106-108358128 CTTTGCTAATTCACTCAAGTTGG - Intergenic
1058812707 9:108656743-108656765 TTTTGTTCATGCAATACGGTTGG + Intergenic
1060386331 9:123232503-123232525 TTTTGTGAATGGAATGAAGTAGG - Intronic
1060902977 9:127277574-127277596 TTTTGCTTATGAAATAAAGTAGG + Intronic
1186499556 X:10040458-10040480 TTTTACTCACGCAATAAACTGGG - Intronic
1186555782 X:10556920-10556942 TTTTGACATTGCCATAAAGTGGG - Intronic
1188604224 X:32008262-32008284 TTTTGCAAATGATATAAAGAGGG + Intronic
1188633454 X:32398492-32398514 TTTTGAAAATACAAAAAAGTGGG + Intronic
1189918126 X:45877172-45877194 TTTGTTTAATTCAATAAAGTGGG + Intergenic
1190976659 X:55410317-55410339 TTATGAGAATGCAAAAAAGTAGG - Intergenic
1191791893 X:64979854-64979876 TATTGCTAAGGCAATAAGGCAGG + Intronic
1193126351 X:77874652-77874674 GTTTACTAATGCAATAATGGTGG - Intronic
1193322206 X:80136013-80136035 TTTTGATAATATTATAAAGTAGG - Intergenic
1194361885 X:92962441-92962463 TTTTTGTAAAGCAATAATGTAGG - Intergenic
1194485993 X:94487164-94487186 TTTTGCTATAGCAAAAAAGCAGG + Intergenic
1196123772 X:112078573-112078595 TTTTGCTAAGGCAAAAACCTGGG + Intronic
1196292703 X:113961921-113961943 TATTCCTACTGCAATAAATTAGG - Intergenic
1197137523 X:123080338-123080360 GGTTGCTAAGGCAATAAAGTAGG + Intergenic
1197163970 X:123355717-123355739 TTGTGCTAATGAAACAAAATTGG - Intronic
1197387382 X:125817897-125817919 TTTTGCTAATGTGATGTAGTTGG + Intergenic
1197614533 X:128676662-128676684 TTTTACTAATGCACTGAAGGTGG - Intergenic
1197842158 X:130760349-130760371 TTTAGCCAATGAAATAAGGTGGG - Intronic
1197908795 X:131457461-131457483 TTTTGGTAATGTTATAAGGTAGG + Intergenic
1197980014 X:132207975-132207997 TTTTACTAATGCAATATTATAGG + Intronic
1198542628 X:137656251-137656273 GATTGCTAATGCAAGAAAGGTGG - Intergenic
1200670132 Y:6078657-6078679 TTTTTGTAAAGCAATAATGTAGG - Intergenic