ID: 1090450317

View in Genome Browser
Species Human (GRCh38)
Location 11:126800424-126800446
Sequence CTACAGAAACGGTCTCATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090450311_1090450317 7 Left 1090450311 11:126800394-126800416 CCCGGGTCAGAGGAGCTTGAAGA 0: 1
1: 0
2: 1
3: 18
4: 227
Right 1090450317 11:126800424-126800446 CTACAGAAACGGTCTCATTAGGG 0: 1
1: 0
2: 1
3: 6
4: 75
1090450312_1090450317 6 Left 1090450312 11:126800395-126800417 CCGGGTCAGAGGAGCTTGAAGAC 0: 1
1: 0
2: 1
3: 11
4: 132
Right 1090450317 11:126800424-126800446 CTACAGAAACGGTCTCATTAGGG 0: 1
1: 0
2: 1
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090450317 Original CRISPR CTACAGAAACGGTCTCATTA GGG Intronic
901827995 1:11875007-11875029 CAACAGAAATGGTCTCCTTACGG - Intergenic
916690624 1:167186705-167186727 CTCCAGAAACCATCACATTATGG + Intergenic
917152819 1:171963067-171963089 CTACAGAAACTGGCACATAAAGG + Intronic
918603598 1:186394058-186394080 AAACAGAAACAGTTTCATTATGG - Intronic
918710868 1:187728440-187728462 CTCCAGATACGGTCACATTGGGG - Intergenic
919196789 1:194296678-194296700 CCACAGCAAAGGTTTCATTAAGG - Intergenic
920508100 1:206531312-206531334 CTGCAGAAAGGGTCGCATTCAGG + Intronic
921171284 1:212552262-212552284 CCACAGAAAAAGTTTCATTAGGG - Intergenic
1070221351 10:74448987-74449009 CCACAGAAACAGACCCATTAGGG + Intronic
1072925708 10:99614758-99614780 CTTCAGAAAAGGTCTAATTTAGG - Intronic
1075450152 10:122545556-122545578 CTAGAGGCAGGGTCTCATTATGG + Intergenic
1082170195 11:48994939-48994961 CTAGAGAAACTGTCTCCTTGTGG + Intergenic
1082173013 11:49028489-49028511 CTAGAGAAAGGGTCTCCTTCTGG - Intronic
1082186406 11:49187124-49187146 AGAGAGAAAAGGTCTCATTAAGG - Intronic
1082607682 11:55261829-55261851 CTAGAGAAACTGTCTCCTTGTGG - Intergenic
1082862481 11:57869185-57869207 CTAGAGACAGGGTCTCACTAGGG + Intergenic
1086679930 11:89658251-89658273 AGAGAGAAAAGGTCTCATTAAGG + Intergenic
1086692758 11:89807563-89807585 CTAGAGAAAGGGTCTCCTTCTGG + Intronic
1086695622 11:89841698-89841720 CTAGAGAAACTGTCTCCTTGTGG - Intergenic
1086710532 11:90002785-90002807 CTAGAGAAACTGTCTCCTTGTGG + Intergenic
1086713044 11:90032096-90032118 CTAGAGAAAGGGTCTCCTTCTGG - Intronic
1090450317 11:126800424-126800446 CTACAGAAACGGTCTCATTAGGG + Intronic
1099425373 12:82517485-82517507 CTACAAATACTGTCTCATTAGGG - Intergenic
1100598936 12:96095966-96095988 GTACATAAAAGGCCTCATTAAGG - Intergenic
1116975779 14:51114238-51114260 CTACAGAATGGGTAACATTATGG + Intergenic
1120219922 14:81720289-81720311 CAAAAGAAAGGGTCTCTTTAAGG + Intergenic
1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG + Intronic
1126824699 15:52537525-52537547 TTACAGCAACGGTCTGATCATGG - Intergenic
1127777435 15:62276904-62276926 CTAAAGAAACTGTCTCCTAATGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1144049817 17:11488964-11488986 CTTCAGAAACAGACTCATCAGGG - Intronic
1147482778 17:40782695-40782717 CTACAGAAATGGACACAGTATGG - Intergenic
1148184991 17:45636345-45636367 CTACAGAAACTGGCACATTCAGG + Intergenic
1148606020 17:48929385-48929407 CTAAAGGAAGGGTCTCAGTATGG + Exonic
1149716557 17:58796225-58796247 GTAGAGACAGGGTCTCATTATGG + Intronic
1150873333 17:68940381-68940403 CTACAGCAACGATTTCATTTTGG + Intronic
1154065882 18:11106595-11106617 GTAAAGAAGAGGTCTCATTATGG + Intronic
1156761231 18:40593678-40593700 CTACAAAAATGTTCTAATTAGGG + Intergenic
1156942984 18:42793498-42793520 TTAAGGAAAAGGTCTCATTAAGG + Intronic
1163014607 19:14446625-14446647 CCCCAGAAAGGGACTCATTATGG - Intronic
925604771 2:5647962-5647984 CTTCAGAAACAGTCACATGAGGG - Intergenic
926091729 2:10055528-10055550 CCACACAAAAGGTCTGATTACGG + Intergenic
927740062 2:25560734-25560756 CTAGAGAAACAGACTCAATAGGG - Intronic
928836288 2:35550477-35550499 CTATAGAAACTGTGTCATTATGG + Intergenic
935014779 2:99171548-99171570 CTTCTGTAACTGTCTCATTAAGG + Exonic
941677434 2:168358696-168358718 CTACAAATACAGTCTCCTTAGGG - Intergenic
1172007807 20:31829522-31829544 CTTCAGAAAGCGTCTCCTTAGGG + Intronic
956261540 3:67348813-67348835 CTGGAGAAATGATCTCATTATGG + Intergenic
956413180 3:68999871-68999893 CTACAGATCAGGACTCATTAGGG - Intronic
956803312 3:72783495-72783517 GTTGAGACACGGTCTCATTATGG + Intronic
963905321 3:150769041-150769063 CTACAGAAATGGAATCATTTTGG - Intergenic
964157464 3:153603210-153603232 TGACAGAAATGGTCTGATTAGGG + Intergenic
965080734 3:164028057-164028079 CTACTGAATCTGTTTCATTATGG + Intergenic
965157772 3:165086953-165086975 CCACTGAAACTGTCTCATAAGGG - Intergenic
966042124 3:175504419-175504441 CTCCAGAAAGAGTCACATTAGGG - Intronic
968433666 4:574685-574707 ATACAGAAATGGTCACATCAGGG + Intergenic
969041742 4:4303070-4303092 CTTCACAAACGGTCTCATACAGG + Exonic
969966013 4:10996224-10996246 CTAGAAAGATGGTCTCATTATGG - Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
978049432 4:104178786-104178808 CTACACCAACTTTCTCATTAAGG + Intergenic
985634720 5:1030349-1030371 CGACAGAAATGGTGTCATAAGGG - Intronic
988048690 5:25994758-25994780 CTACAGAAACCCTCTCTTAATGG + Intergenic
988790032 5:34599278-34599300 GTACAGAATTGGTCTCAGTATGG + Intergenic
999641569 5:153678337-153678359 CTACAGAAAGGCACTCATCAGGG - Intronic
1002458264 5:179358451-179358473 CTCCAGATACAGTCCCATTAGGG - Intergenic
1004867305 6:19866835-19866857 CTATAGAAACAGTTTCATCAGGG - Intergenic
1008713446 6:54257990-54258012 GTAAAGAAATGTTCTCATTATGG + Intronic
1010870719 6:81034842-81034864 CTCCAAATACGGTCACATTAAGG - Intergenic
1011617491 6:89210521-89210543 CTACAAAAGTGGTCTGATTAAGG + Intronic
1011773415 6:90701004-90701026 CTGCACAAACTGTCTCATTATGG + Intergenic
1014069023 6:117159956-117159978 ATAGAGACAAGGTCTCATTATGG - Intergenic
1020518559 7:9156801-9156823 CCCCAGAAACTGTCTCAGTAAGG + Intergenic
1021974165 7:25995554-25995576 ATACAGAAACAGTCTCACCATGG + Intergenic
1029847867 7:103431507-103431529 ATAGAGAAAGGGTCTCATTATGG + Intronic
1046029589 8:108767479-108767501 CTACAGAAATGTTCTCAAAATGG - Intronic
1046151767 8:110236239-110236261 CTACAGATACGGTCTCCTTCTGG + Intergenic
1050611559 9:7359250-7359272 CTTCAGAATCAGTCTCATTTGGG + Intergenic
1055216423 9:73868889-73868911 CCACAGAAACGATCTCATTATGG - Intergenic
1055553710 9:77454632-77454654 CTAAAGAAACAGTCTCAGAATGG - Intronic
1192632030 X:72784625-72784647 CTCCAGATACAGTCCCATTAGGG - Intronic
1192649679 X:72936176-72936198 CTCCAGATACAGTCCCATTAGGG + Intronic
1198621419 X:138515480-138515502 CTACAAAAACTGTCTCAAAAAGG + Intergenic
1201281134 Y:12343245-12343267 CTACAGAAACGGAAGCATAAAGG - Intergenic