ID: 1090452787

View in Genome Browser
Species Human (GRCh38)
Location 11:126821372-126821394
Sequence GGTAAGCCCTTTCCAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090452787_1090452796 30 Left 1090452787 11:126821372-126821394 CCTTCCTTTGGAAAGGGCTTACC 0: 1
1: 0
2: 3
3: 9
4: 230
Right 1090452796 11:126821425-126821447 CCTGGGACCTTGTAGTTTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 141
1090452787_1090452793 12 Left 1090452787 11:126821372-126821394 CCTTCCTTTGGAAAGGGCTTACC 0: 1
1: 0
2: 3
3: 9
4: 230
Right 1090452793 11:126821407-126821429 GATATTCTTGCTTTTTAACCTGG 0: 1
1: 0
2: 3
3: 16
4: 193
1090452787_1090452790 -10 Left 1090452787 11:126821372-126821394 CCTTCCTTTGGAAAGGGCTTACC 0: 1
1: 0
2: 3
3: 9
4: 230
Right 1090452790 11:126821385-126821407 AGGGCTTACCTGGCCATTTTTGG 0: 1
1: 0
2: 0
3: 18
4: 153
1090452787_1090452794 13 Left 1090452787 11:126821372-126821394 CCTTCCTTTGGAAAGGGCTTACC 0: 1
1: 0
2: 3
3: 9
4: 230
Right 1090452794 11:126821408-126821430 ATATTCTTGCTTTTTAACCTGGG 0: 1
1: 0
2: 2
3: 58
4: 679

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090452787 Original CRISPR GGTAAGCCCTTTCCAAAGGA AGG (reversed) Intronic
900317902 1:2068573-2068595 AGGAACCCTTTTCCAAAGGAGGG + Intronic
900547239 1:3235825-3235847 GGACAGCCCTTTCCAAATGAGGG - Intronic
902731682 1:18373971-18373993 GGCAAGCCCTTTAGAAAGCAGGG + Intronic
907264377 1:53247924-53247946 GGGAGGGTCTTTCCAAAGGAGGG - Intronic
911189435 1:94933084-94933106 GGTGAGCACTCTCCAAAGGGAGG - Intergenic
915014598 1:152721019-152721041 AGTGAGCCATCTCCAAAGGAAGG + Intergenic
915892700 1:159786001-159786023 GGTAAGCACTTTGTAAATGATGG - Intergenic
917134331 1:171774712-171774734 GGTAAGCAGTTTCAACAGGAAGG + Intergenic
919264041 1:195238054-195238076 GGTAACTCCTTTCCACAGGCAGG - Intergenic
919431241 1:197494861-197494883 AGTAAGCCATTTCCAAAGGATGG + Intergenic
921674652 1:217964811-217964833 GGTAACTCCTTTCCACAGGCAGG + Intergenic
921675258 1:217968950-217968972 GGTAACTCCTTTCCACAGGCAGG - Intergenic
921675279 1:217969087-217969109 GGTAGCTCCTTTCCACAGGAAGG - Intergenic
1067850837 10:49752616-49752638 GGTAAGACCCTTCCTCAGGACGG - Exonic
1068177538 10:53480950-53480972 GTTAAGTCCTTTTCACAGGAAGG - Intergenic
1071559259 10:86632503-86632525 GGTAAGCCTGTTTCTAAGGAGGG - Intergenic
1072390893 10:94985911-94985933 GGAAATCCCGTTCCAAAGAAGGG - Intronic
1073088475 10:100912173-100912195 CACAAGCCCTTTACAAAGGAGGG + Intergenic
1075062638 10:119267530-119267552 GGGCAGCCCTCTCCACAGGATGG + Intronic
1077709247 11:4519497-4519519 GGTAAGCACATTCCAGAGAAGGG - Intergenic
1081279871 11:41195910-41195932 GCTAAGCCCTTTGAGAAGGAAGG + Intronic
1082323543 11:51108056-51108078 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082326660 11:51152829-51152851 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082327430 11:51163881-51163903 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082331739 11:51226781-51226803 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082333365 11:51250240-51250262 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082342493 11:51382858-51382880 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082343070 11:51391359-51391381 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082346046 11:51434714-51434736 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082346687 11:51444065-51444087 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082348675 11:51472965-51472987 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082354208 11:51552710-51552732 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082355416 11:51570565-51570587 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082358150 11:51610511-51610533 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082361586 11:51660685-51660707 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082367724 11:51749938-51749960 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082369775 11:51779694-51779716 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082370292 11:51787344-51787366 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082370525 11:51790744-51790766 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082374344 11:51846002-51846024 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082374635 11:51850255-51850277 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082374693 11:51851105-51851127 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082375568 11:51863855-51863877 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082375690 11:51865555-51865577 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082378908 11:51912307-51912329 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082379916 11:51926758-51926780 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082384109 11:51988087-51988109 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082386040 11:52016147-52016169 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082386805 11:52027197-52027219 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082389762 11:52070550-52070572 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082390105 11:52075651-52075673 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082390977 11:52088402-52088424 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082396259 11:52165055-52165077 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082397724 11:52186306-52186328 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082397898 11:52188856-52188878 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082398600 11:52199054-52199076 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082403020 11:52262976-52262998 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082403420 11:52268925-52268947 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082404889 11:52290175-52290197 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082407180 11:52322967-52322989 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082410298 11:52368025-52368047 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082411788 11:52389476-52389498 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082412672 11:52402230-52402252 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082417037 11:52465132-52465154 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082417276 11:52468532-52468554 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082419623 11:52502535-52502557 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082420805 11:52519537-52519559 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082423496 11:52558647-52558669 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082424022 11:52566301-52566323 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082430769 11:52664031-52664053 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082441909 11:52824675-52824697 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082445330 11:52873965-52873987 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082446444 11:52890118-52890140 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082447962 11:52912222-52912244 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082448431 11:52919024-52919046 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082448669 11:52922424-52922446 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082451774 11:52967486-52967508 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082452539 11:52978535-52978557 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082454386 11:53005735-53005757 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082455909 11:53027834-53027856 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082455964 11:53028684-53028706 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082456646 11:53038887-53038909 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082457884 11:53056744-53056766 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082466390 11:53179150-53179172 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082470697 11:53241426-53241448 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082471560 11:53254177-53254199 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082474836 11:53301782-53301804 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082475368 11:53309435-53309457 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082478647 11:53357039-53357061 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082479536 11:53369793-53369815 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082481436 11:53397010-53397032 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082491054 11:53534313-53534335 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082491346 11:53538564-53538586 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082491988 11:53547914-53547936 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082493393 11:53568315-53568337 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082501119 11:53680193-53680215 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082505314 11:53741405-53741427 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082507127 11:53767758-53767780 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082509659 11:53804320-53804342 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082510071 11:53810269-53810291 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082511244 11:53827279-53827301 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082511902 11:53836634-53836656 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082517973 11:53924215-53924237 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082518030 11:53925065-53925087 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082519554 11:53947173-53947195 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082520390 11:53959087-53959109 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082520694 11:53963344-53963366 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082522449 11:53989171-53989193 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082522863 11:53995121-53995143 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082527379 11:54060406-54060428 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082532739 11:54137787-54137809 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082533260 11:54145441-54145463 GATATACCCTTTTCAAAGGAAGG - Intergenic
1082539139 11:54230463-54230485 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082540319 11:54247632-54247654 GATACACCCTTTTCAAAGGAAGG - Intergenic
1082546771 11:54341165-54341187 GATATACCCTTTTCAAAGGAAGG - Intergenic
1083594912 11:63914593-63914615 GGTAAGCTCTTCAGAAAGGAGGG + Intronic
1084714355 11:70864167-70864189 GGTTTTCCCTTTCCAAATGATGG - Intronic
1086143755 11:83527688-83527710 TGTAAACCCTTTCTAAAGTAAGG - Intronic
1090452787 11:126821372-126821394 GGTAAGCCCTTTCCAAAGGAAGG - Intronic
1093908851 12:24723261-24723283 AGTCAGCCCTTTCCTTAGGATGG - Intergenic
1094040000 12:26112678-26112700 GGGAAGGCCTTTCTAAAGAACGG + Intergenic
1094905717 12:35192775-35192797 GGAAATCCCTTTTCCAAGGAAGG - Intergenic
1094925335 12:35510374-35510396 GGAAATCCCTTTTCCAAGGAAGG - Intergenic
1094945925 12:35844063-35844085 GGAAATCCCTTTTCCAAGGAAGG - Intergenic
1100831919 12:98524249-98524271 GGTAAGACCTTTCCAAATAGAGG + Intronic
1101076458 12:101134422-101134444 TGTAAGCTCTATCCAAAAGATGG + Intergenic
1101197091 12:102394735-102394757 TATAAGTTCTTTCCAAAGGAGGG + Intergenic
1104297120 12:127526495-127526517 GGTAAACTGCTTCCAAAGGAAGG - Intergenic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1107205477 13:37780626-37780648 GGTAATTCATTTCCTAAGGAAGG - Intronic
1108451942 13:50575882-50575904 GAAAAGCCCTTTCCAAAGGAGGG - Intronic
1112578390 13:100657669-100657691 GTTAATCCCTTCCCAAAGGATGG + Intronic
1116132155 14:40868372-40868394 AGTAAACCCTTTGCAAATGATGG - Intergenic
1118061247 14:62139924-62139946 GGAAAGCTCTTTCGAAAAGATGG + Intergenic
1118516429 14:66533407-66533429 CGTGGTCCCTTTCCAAAGGAAGG - Intronic
1119519535 14:75276002-75276024 GGTTTGTCCTTTCCAGAGGATGG + Intergenic
1119577157 14:75735289-75735311 GGTAAGCCAATTCCACAGCAGGG + Exonic
1121221317 14:92287871-92287893 GCAAAGCCCTCTCCAAAGGAAGG + Intergenic
1126361869 15:47854850-47854872 TGTAAGTCCTTTCCATTGGATGG + Intergenic
1127112221 15:55686895-55686917 GGAAACCACTTCCCAAAGGATGG - Intronic
1127297848 15:57625582-57625604 AGTAAACACTATCCAAAGGAAGG + Intronic
1127299892 15:57642892-57642914 GGTGAGCCCTTTTGAAATGAAGG + Intronic
1131678980 15:94701932-94701954 AGTATGCTCTTTCCAAAGTATGG + Intergenic
1133013661 16:2929045-2929067 GCAGAGCCCTTTCCAGAGGACGG - Intronic
1133805951 16:9126097-9126119 GGGATGGCCTTTCCAAAGAATGG - Intergenic
1138191309 16:55016373-55016395 GGGAAGCCCTTTCTAAAGAGAGG - Intergenic
1139042301 16:63012583-63012605 AGTATGCCCCTTTCAAAGGATGG + Intergenic
1140081651 16:71753866-71753888 GGTATGCACCTTCCAAACGATGG - Exonic
1142229779 16:88894848-88894870 GGAAAACCCTTTCTACAGGATGG + Intronic
1142422133 16:89978039-89978061 GAAAAGCTCTTTCCAAAGGAAGG + Intergenic
1146352663 17:32108705-32108727 GGTGAGCACTTTGCAAAGGCAGG - Intergenic
1146575095 17:33984150-33984172 AGTCAGCCCTCTCCAATGGAGGG + Intronic
1148730844 17:49835478-49835500 GGTAAGCCCTGTCTAAAAAAGGG + Intergenic
1149630624 17:58119091-58119113 GGAAAGGCCTTTCTGAAGGATGG - Intergenic
1151121189 17:71795321-71795343 GGTACTCCTTTTCCAAAGAAAGG + Intergenic
1153697628 18:7660461-7660483 GGGAACCCCTTCCCAAAGTAGGG + Intronic
1157562628 18:48659543-48659565 GGTGAGCCCTTTACAAACCAAGG - Intronic
1160984956 19:1834203-1834225 CGCGAGCCCTTCCCAAAGGAAGG + Intronic
1161085162 19:2331855-2331877 GCCAAGCCCATTCCTAAGGAAGG - Intronic
1161578618 19:5068348-5068370 GAAAAGCCCAGTCCAAAGGACGG - Intronic
1163648135 19:18501879-18501901 GGACAGCCCTTTCCAAAAGAAGG + Intronic
1164203503 19:23038905-23038927 AGTGTGCCCTTTCCTAAGGATGG - Intergenic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
938204022 2:129401852-129401874 TGTAAGCACTTACCAAAGGGTGG + Intergenic
940210171 2:151248876-151248898 GATAAGCCTTCTCCAAAGAAAGG + Exonic
940650256 2:156435225-156435247 GGAAATGCCTTTCCAAAAGAAGG - Intergenic
940928109 2:159391097-159391119 TCTAAGAACTTTCCAAAGGAGGG + Intronic
943784901 2:191866702-191866724 GGAAATCTCTTTCCAAAAGATGG - Intergenic
945824814 2:214708689-214708711 GCTAGGCCCTTTCAAAAGAATGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947612307 2:231531647-231531669 GGTTAGCCCATTCTACAGGAAGG - Intergenic
948557184 2:238821340-238821362 GAGAAGCCCCTTCCAAAGAAAGG + Intergenic
1169622267 20:7520641-7520663 GGTAAGCCCTGTGGAAAGGAAGG + Intergenic
1172790496 20:37502038-37502060 GGCAGGCCCTTTCCAAAGGTGGG - Intronic
1172877951 20:38177468-38177490 AGTAAGCCCTTGGCAAATGATGG - Intergenic
1173005460 20:39136734-39136756 TGGAAGCTCTTCCCAAAGGAGGG + Intergenic
1173233062 20:41217521-41217543 GGTCAGCATTTTCCAAAGGAAGG - Intronic
1174976115 20:55337231-55337253 GGTAAGGCCTACCCGAAGGAAGG + Intergenic
1178191183 21:30282790-30282812 GGTAAGCAGTGTCCAAAGGTAGG + Exonic
1182528782 22:30939384-30939406 GGTAAGACAGTGCCAAAGGATGG + Intronic
1183979650 22:41532035-41532057 GCTCAGGCCTCTCCAAAGGAAGG - Intronic
1184846976 22:47094192-47094214 GGCAAGTCCTTTCCTGAGGAAGG + Intronic
1185272357 22:49935264-49935286 GGTCCGCCCTTTGCAGAGGAAGG + Intergenic
952920053 3:38277845-38277867 GGTAAGCCCTTTCCAATTTGTGG + Exonic
957031061 3:75242077-75242099 GGTAAGCCAGTTCCTAAAGAAGG - Intergenic
957417923 3:79929777-79929799 GGTAGCTCCTTTCCAAAGGCAGG - Intergenic
957500263 3:81047305-81047327 GGCAAGCACTTTCCCAAAGAAGG + Intergenic
957665285 3:83218306-83218328 GGTAGCCCCTTTCCATAGGCAGG + Intergenic
958222615 3:90712939-90712961 AGAAATCCCTTTTCAAAGGAAGG + Intergenic
963686573 3:148442509-148442531 TGTAAGCCTTTTCCAAAATAAGG - Intergenic
964435297 3:156644895-156644917 GGTCAGCCTTTTTCATAGGATGG - Intergenic
967129878 3:186460525-186460547 GGGAAGCCCTTTCCAAAGGGTGG + Intergenic
969484330 4:7463549-7463571 GATAAGGCCTTTTCCAAGGATGG - Intronic
972422198 4:38898730-38898752 GGAAAGACTATTCCAAAGGAAGG + Intronic
977244955 4:94620133-94620155 GGTAAGAACTTTCAAAAGCATGG - Intronic
977647409 4:99429106-99429128 GTTAAGCTCTGTCCAAAGAAAGG + Intronic
977741056 4:100483085-100483107 TGTCAGCCCTTGCCAAAAGAGGG - Intronic
980291688 4:130853148-130853170 GGAAAACTCTTGCCAAAGGAAGG + Intergenic
982181503 4:152752069-152752091 GGTAGCTCCTTTCCACAGGAAGG - Intronic
983380082 4:166981164-166981186 GGTAGCTCCTTTCCACAGGAAGG + Intronic
984789824 4:183605278-183605300 TGTATGCCCTTTGCAAATGAAGG - Intergenic
985288864 4:188365825-188365847 GGACAGCCTTTGCCAAAGGAAGG - Intergenic
989730435 5:44641672-44641694 GGTAACTCCTTTCCACAGGCAGG + Intergenic
990364658 5:55058048-55058070 GGTAAGACCTATCTAAAGAAGGG + Intergenic
990620615 5:57555078-57555100 GGTAAACCCTTCCCTTAGGATGG + Intergenic
991179421 5:63732500-63732522 GGAATGCCTTTTTCAAAGGAAGG + Intergenic
992155504 5:73951620-73951642 GGTGATCGATTTCCAAAGGAGGG - Intergenic
994631666 5:102295584-102295606 GGTATACCTTTCCCAAAGGAAGG + Intronic
997280721 5:132643061-132643083 GGTCAGAGCTTTCCAAAGGTGGG - Exonic
999145530 5:149390692-149390714 GGTAAGTGATTTCCAAAGTAGGG + Intronic
1002135023 5:177102131-177102153 GGGAAGCCCTAGCCAAGGGATGG + Intergenic
1002657536 5:180762571-180762593 GGAATTCCCTTTCCAAAGAAAGG - Intergenic
1004075876 6:12343912-12343934 GGAAAGACCTTTGCAATGGAGGG + Intergenic
1009843372 6:69105508-69105530 GGCAAGACTTTTCAAAAGGAAGG - Intronic
1011809906 6:91119347-91119369 TGTATCCCCTTTCCAAAAGATGG + Intergenic
1012622611 6:101364804-101364826 GGTAAGCCCTGTCCAATGTGTGG - Intergenic
1013621169 6:111890915-111890937 GCTAAGTCCCTTCAAAAGGATGG + Intergenic
1019618937 7:1980152-1980174 GGTGTGCCCTTTCCAGAGGAGGG - Intronic
1020188360 7:5975494-5975516 GGTAAGAACTTTCCAAGCGAAGG - Intronic
1020294555 7:6749274-6749296 GGTAAGAACTTTCCAAGCGAAGG + Intergenic
1021132475 7:16927913-16927935 GGGAAGCCCTCCCTAAAGGAAGG - Intergenic
1023511813 7:40961254-40961276 TGTAGGCCCTTTCTAAGGGAAGG + Intergenic
1024250969 7:47505434-47505456 GGGAAGCCCTCTCCAGAGCAGGG + Intronic
1024730481 7:52248358-52248380 GCAAAGGCCTTTCAAAAGGATGG + Intergenic
1026391994 7:69911604-69911626 GGTAACTCCTTTCCACAGGCAGG + Intronic
1026782602 7:73279664-73279686 CTTTAGTCCTTTCCAAAGGAAGG - Intergenic
1027023365 7:74832489-74832511 CTTTAGTCCTTTCCAAAGGAAGG - Intronic
1027064567 7:75112829-75112851 CTTTAGTCCTTTCCAAAGGAAGG + Intronic
1037636403 8:20704364-20704386 GGTCAACCATTTCCAAAGGGTGG - Intergenic
1044065463 8:87693501-87693523 TGTAAGCCCTTTCTTAAGGCTGG - Intergenic
1044769443 8:95615031-95615053 AGGAAGCCCTTTCCAGATGAAGG + Intergenic
1052394792 9:27925996-27926018 GCTAAGCCCTTTCATAAGCAAGG - Intergenic
1056735703 9:89207881-89207903 GATAAGCCCATTCCAGAGCAGGG - Intergenic
1056905330 9:90642653-90642675 GGTAATCCCTTTCCAGGGGCTGG + Intronic
1061787099 9:133036050-133036072 GGGAAGCCCTTGCAGAAGGAGGG - Intronic
1189205020 X:39230388-39230410 GGTGAGCCCTAACCAAAGTAGGG + Intergenic
1191892266 X:65956393-65956415 GGTACCCCCTTTCCATAGAAGGG + Intergenic
1194983265 X:100461998-100462020 GGAAAGCCGTTTCCAAAGCTAGG - Intergenic
1195981762 X:110586127-110586149 GGAAAGCCATTTCCAATGGCTGG + Intergenic
1198462169 X:136874246-136874268 GGTACCCCCTTTCCATAGAAGGG + Exonic
1199532587 X:148867242-148867264 GGAAACCCCTATCCAAATGACGG - Intronic
1200749126 Y:6928953-6928975 GGTAACTCCTTTCCACAGGCAGG + Intronic