ID: 1090455247

View in Genome Browser
Species Human (GRCh38)
Location 11:126843463-126843485
Sequence GGCAGATCACAATTGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090455247 Original CRISPR GGCAGATCACAATTGAAAGC AGG (reversed) Intronic
900236112 1:1591763-1591785 GGCACAGCACCATTGACAGCAGG - Intergenic
900613834 1:3555510-3555532 GGCGGCTCAGAAATGAAAGCAGG + Intronic
902301449 1:15505490-15505512 GACAGATCACAGTTATAAGCTGG - Intronic
903738819 1:25546275-25546297 AGCAGGTCACAACTGAGAGCAGG - Intronic
911966815 1:104381592-104381614 TGCAGAACAAAATTGTAAGCCGG - Intergenic
915690817 1:157688637-157688659 GGCAGAACAAAATTGATACCAGG + Intronic
919420690 1:197366643-197366665 GGAAGATGACAAATGAAAACAGG + Intronic
919421428 1:197374450-197374472 GGCAGAGCACAATGGCATGCAGG - Intronic
919450526 1:197767520-197767542 GGCAGATCAAAGTAGAAAGCTGG + Intronic
1065876495 10:30001700-30001722 GGCTGAGCTCATTTGAAAGCAGG + Intergenic
1070501561 10:77077696-77077718 TTCAGATCACAAATGAAAGAAGG + Intronic
1071781110 10:88845860-88845882 TGCAAAACACAATGGAAAGCGGG - Intronic
1077869070 11:6246341-6246363 GGCAGAGCAAAATGGATAGCTGG - Intergenic
1081099723 11:38986710-38986732 GCCAGCTCACAATTAAAATCAGG + Intergenic
1090455247 11:126843463-126843485 GGCAGATCACAATTGAAAGCAGG - Intronic
1091691256 12:2598973-2598995 AGCAGCTCACCATGGAAAGCAGG - Intronic
1098297220 12:69016182-69016204 AGCAGACCTCAATTGAAAACGGG + Intergenic
1103039670 12:117684810-117684832 TGCAGATCACAATTCAACACAGG + Intronic
1103974375 12:124692701-124692723 GGCAAACAACAATTTAAAGCAGG + Intergenic
1104566329 12:129887925-129887947 GGCAGAACTCATTTGTAAGCTGG + Intronic
1104891454 12:132142166-132142188 GGCAGACCACTCTCGAAAGCAGG + Exonic
1105949950 13:25220987-25221009 GGCATTTCACATTTGAAAACTGG - Intergenic
1109529084 13:63616908-63616930 GGTAGTTGACAAATGAAAGCCGG + Intergenic
1111335867 13:86821840-86821862 ATCACATCACAAATGAAAGCAGG + Intergenic
1114034003 14:18604083-18604105 GGGAAATGACAATTGAAAGTCGG + Intergenic
1114078798 14:19183256-19183278 GGGAAATGACAATTGAAAGTCGG + Intergenic
1114124642 14:19710928-19710950 GGGAAATGACAATTGAAAGTCGG - Intergenic
1119486147 14:74988276-74988298 GGCAGTTCCCAACGGAAAGCGGG + Intergenic
1120861629 14:89260242-89260264 TGTTGATCACATTTGAAAGCAGG - Intronic
1122583371 14:102786116-102786138 GACAGACCAGAATTCAAAGCAGG - Intronic
1123510871 15:20998464-20998486 GGGAAATGACAATTGAAAGTCGG - Intergenic
1123568091 15:21572221-21572243 GGGAAATGACAATTGAAAGTCGG - Intergenic
1123604200 15:22007545-22007567 GGGAAATGACAATTGAAAGTCGG - Intergenic
1125521591 15:40350884-40350906 GGCAAAGGACAGTTGAAAGCAGG - Intergenic
1125530791 15:40412227-40412249 GGCAGAACACAATGGTGAGCTGG + Intronic
1129419760 15:75415310-75415332 GGCGGATCACTTTTGAATGCTGG - Intronic
1131022676 15:89112531-89112553 GACAGATAATAATTGGAAGCTGG + Intronic
1202976450 15_KI270727v1_random:299311-299333 GGGAAATGACAATTGAAAGTCGG - Intergenic
1132585353 16:703796-703818 GGCAGCTCAGCCTTGAAAGCTGG + Intronic
1133682924 16:8137474-8137496 GTCAGATTACATTTGAGAGCTGG + Intergenic
1135280310 16:21148637-21148659 TGCAGAACACAATGGAAAGAGGG + Intronic
1138195151 16:55046460-55046482 GGCTGGACACAATTGAAAGCTGG - Intergenic
1139293079 16:65875375-65875397 GGCAGGTCAAAATGGAAAGGAGG + Intergenic
1139775337 16:69313208-69313230 GGCAGATCACACTTGAAGTCAGG - Intronic
1140774137 16:78234502-78234524 GGCATATCAGAATAGAAATCTGG - Intronic
1140801093 16:78489110-78489132 AGCAGATCAATAGTGAAAGCAGG + Intronic
1141548979 16:84791898-84791920 GGGAGATCAAAAATGAAAGGAGG + Intergenic
1144034827 17:11355684-11355706 GGGAGAACTCAATTGAAAACTGG + Intronic
1146559340 17:33854779-33854801 GGCAGATGACAAATGGGAGCTGG - Intronic
1146914170 17:36667499-36667521 GGCACGTCACATGTGAAAGCAGG - Intergenic
1158309033 18:56139208-56139230 GGCAGATCTCAACTGAAGGGAGG + Intergenic
1164777895 19:30868458-30868480 GTCAGATCACACCAGAAAGCAGG - Intergenic
1167891382 19:52542517-52542539 GGGAGATCACAAAGGAAACCCGG - Intronic
1167912747 19:52717309-52717331 GGGAGATCACAAAGGAAACCCGG + Intronic
1167920620 19:52780301-52780323 GGGAGATCACAAAGGAAACCCGG + Intronic
936766155 2:115851034-115851056 GAGAGATGGCAATTGAAAGCTGG - Intergenic
937005054 2:118503883-118503905 GGCAGAGCAGAATTCAAACCTGG + Intergenic
937694409 2:124791806-124791828 TGCAGATCATAATTAAAAGTGGG - Intronic
939091360 2:137783330-137783352 GGCACATCACATGTGAAAGCAGG + Intergenic
939473638 2:142657585-142657607 TGCAGCTCACAATTGATGGCAGG - Intergenic
941683678 2:168426301-168426323 GGCAGATCACAGGGGAGAGCAGG - Intergenic
944833316 2:203554696-203554718 GGCAGAGCACAATTGGCAGAAGG + Intergenic
945157985 2:206859427-206859449 AGCAGATGACAATGAAAAGCAGG - Intergenic
948661513 2:239509448-239509470 GGCGGAAGGCAATTGAAAGCAGG + Intergenic
948941064 2:241196729-241196751 GGCAGCTCACATGTGAATGCCGG + Intronic
1169783307 20:9332178-9332200 GGGAGATCATAAAAGAAAGCTGG - Intronic
1169805565 20:9555963-9555985 GGCTGATCACAACTGCAAGAGGG + Intronic
1176430794 21:6574246-6574268 GCCTGATCACAATTTAGAGCAGG - Intergenic
1178209759 21:30516275-30516297 AGCAGATCAGAAAAGAAAGCTGG + Intergenic
1179706188 21:43181708-43181730 GCCTGATCACAATTTAGAGCAGG - Intergenic
1180458122 22:15531125-15531147 GGGAAATGACAATTGAAAGTCGG + Intergenic
951809253 3:26681483-26681505 GGCAGATCTGGATTGAAATCAGG + Intronic
952827228 3:37533982-37534004 GGCAGCTCAGAATTGAAAAGAGG + Intronic
952868176 3:37872372-37872394 AGCAAATTACAATTGAAACCTGG + Intronic
954174740 3:48835272-48835294 GGCAGATAACTTTTGAAACCAGG + Intronic
957788994 3:84916540-84916562 CTCAGATCACAGTTGAAAGATGG - Intergenic
959400577 3:105896721-105896743 GGCAAATGCCAATTGAAAGATGG - Intergenic
959822164 3:110749100-110749122 GCCAGAAAACAATTTAAAGCAGG + Intergenic
961145672 3:124591115-124591137 AGCAGACCACATTTGAAAGCAGG - Intronic
961250110 3:125495165-125495187 ATCTGATCACAGTTGAAAGCTGG - Intronic
964336494 3:155660180-155660202 GGCTGAACACAATTGAAAGTCGG + Intronic
967636033 3:191804384-191804406 GGCAGATCACAGTAAAAACCAGG + Intergenic
970562561 4:17297028-17297050 GGCACATCACATTTGTCAGCTGG + Intergenic
971859449 4:32085989-32086011 GGCAGGTCCCCATTGAAACCTGG - Intergenic
978613937 4:110574685-110574707 ATCAGATCTCAATTGAAACCCGG - Intergenic
983539396 4:168892422-168892444 AACAGACCACACTTGAAAGCTGG + Intronic
984385723 4:179054888-179054910 TGGAGATCACAACTGATAGCTGG + Intergenic
985290058 4:188377766-188377788 GGAAAATCACAATGGAAAGTTGG + Intergenic
986502518 5:8415493-8415515 TGCAGAACAAAATTGTAAGCCGG - Intergenic
986861807 5:11935523-11935545 GGCATATCACATAAGAAAGCAGG + Intergenic
987569354 5:19635471-19635493 GGCAGATCAGAAGTGAGAGATGG + Intronic
987998197 5:25313161-25313183 GGCAGTTCACAAATGACAGTTGG - Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
1003335968 6:5172488-5172510 GGCATCTCACATTTCAAAGCAGG - Intronic
1004240499 6:13916929-13916951 GGCAGGAAACAAATGAAAGCTGG + Intergenic
1004922191 6:20386068-20386090 GGGAGATGACATCTGAAAGCAGG - Intergenic
1006255934 6:32832359-32832381 GGTAGATCATAAAGGAAAGCAGG + Exonic
1008093748 6:47317543-47317565 TGCATAGCACAATTGGAAGCTGG - Intergenic
1009379078 6:63007051-63007073 GGCAGAACAAAACTGTAAGCTGG - Intergenic
1010526948 6:76912565-76912587 GGCAGATCACACTTGAGCTCAGG - Intergenic
1010622006 6:78088396-78088418 TGCAGATCACAATTGCTATCAGG + Intergenic
1012305655 6:97653913-97653935 GGCAGATCTAATTTGAAACCTGG + Intergenic
1012516001 6:100060298-100060320 CGCAAATAACAATTGAAAGCAGG - Intergenic
1015233269 6:130940692-130940714 GGCAGATCACACTTGAGGTCAGG - Intronic
1016289234 6:142509912-142509934 GGCAGATCAGAATAAAACGCGGG - Intergenic
1016554422 6:145319599-145319621 GGCAGATCCTAAGCGAAAGCTGG + Intergenic
1017398332 6:154029171-154029193 GGCAGATCAGAGTTTAAAGGCGG - Intronic
1019701085 7:2475364-2475386 GGCACATCACCGTTAAAAGCGGG - Intronic
1020549859 7:9589824-9589846 AGCAGAAAACAATGGAAAGCAGG + Intergenic
1021148961 7:17125637-17125659 GGTATATCAGAATTGGAAGCAGG - Intergenic
1021721825 7:23512094-23512116 GGCATATCCTAATTGAAATCTGG - Intronic
1022863642 7:34394488-34394510 GAAAGATCTCAATTGAAAGAGGG - Intergenic
1026063822 7:67051094-67051116 GGCAGATCACACTTGAGGCCAGG - Intronic
1027146531 7:75699473-75699495 GGCAGATCAGGATAGAAAACGGG + Intronic
1027433559 7:78140029-78140051 GCCACATCACTACTGAAAGCAGG + Intronic
1031638251 7:124128636-124128658 GACAGAACAAAATTGAAAGTAGG - Intergenic
1035962579 8:4153934-4153956 TGCAGAAAACACTTGAAAGCAGG - Intronic
1036478866 8:9120158-9120180 TGCTGATCAGAATTGTAAGCTGG - Intergenic
1039941152 8:42092336-42092358 GGCAGATCACACCTGAAGTCAGG + Intergenic
1041653815 8:60328589-60328611 TCCAGATCACAAGTGAAGGCAGG - Intergenic
1046954483 8:120048648-120048670 GGCAAAACAAAATGGAAAGCGGG - Intronic
1049864045 8:144922156-144922178 GGCAAGTCACATTTGAAATCTGG + Intergenic
1049905446 9:212555-212577 AGCAGATCAAACTTGAAAACAGG + Intergenic
1057066476 9:92056859-92056881 GTCAACTCACAACTGAAAGCTGG + Intronic
1060702574 9:125770688-125770710 GGCAAATCAGACTTGGAAGCTGG + Intronic
1061455549 9:130694936-130694958 GGCAGATCACACTTGAGGTCAGG - Intronic
1186664092 X:11700805-11700827 GGCAGATCATACTTGATTGCTGG - Intergenic
1187189940 X:17024726-17024748 GAGAGATCACAATTGGGAGCGGG + Intronic
1189615520 X:42779134-42779156 GGAAGATCAGAATAGAAAGCTGG - Intergenic
1192656426 X:72999642-72999664 GGCAGGGCACAAAGGAAAGCAGG - Intergenic
1192665694 X:73083359-73083381 GGCAGGGCACAAAGGAAAGCAGG + Intergenic
1192760521 X:74091148-74091170 GGCACATCACATGTGAAAGCAGG + Intergenic
1195449368 X:104992977-104992999 GCCAGACCACAATTCAAAACAGG - Intronic
1198601408 X:138287942-138287964 GGGAGTTCACAAAAGAAAGCAGG - Intergenic
1198880852 X:141279535-141279557 GGAACAACACAATTGTAAGCAGG + Intergenic
1199414943 X:147571035-147571057 GACAGATAAAAATTCAAAGCAGG + Intergenic
1202149999 Y:21835922-21835944 GGCAGAGCTGATTTGAAAGCCGG - Intergenic