ID: 1090456059

View in Genome Browser
Species Human (GRCh38)
Location 11:126850652-126850674
Sequence CTGGTAAAGTCTTCCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090456059_1090456065 27 Left 1090456059 11:126850652-126850674 CCAACAGAGGAAGACTTTACCAG 0: 1
1: 0
2: 1
3: 25
4: 148
Right 1090456065 11:126850702-126850724 CTGCTTATCCCCAAAATAAAAGG 0: 1
1: 0
2: 2
3: 18
4: 201
1090456059_1090456061 -10 Left 1090456059 11:126850652-126850674 CCAACAGAGGAAGACTTTACCAG 0: 1
1: 0
2: 1
3: 25
4: 148
Right 1090456061 11:126850665-126850687 ACTTTACCAGGAACTTCAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090456059 Original CRISPR CTGGTAAAGTCTTCCTCTGT TGG (reversed) Intronic
901947134 1:12713026-12713048 CTGGTAAAGTATTTCCTTGTTGG - Intergenic
904222873 1:28987618-28987640 TTGGTCAAGTCTTCATGTGTAGG - Exonic
906309487 1:44743127-44743149 CTGGTTAGGTTTTCTTCTGTAGG + Intronic
908903396 1:68981609-68981631 CTGCTGAAGTCTTCCCCTGCTGG + Intergenic
908956316 1:69633034-69633056 CTTGTTAAGTCTTTCTTTGTGGG + Intronic
909190375 1:72542303-72542325 ATGGGAATGTCTTCCTCTTTTGG + Intergenic
909915121 1:81308400-81308422 CTGTTAAGGTTTTCCTGTGTAGG - Intronic
912137462 1:106679395-106679417 CAGGTAAAGTCTTGCTCTGTTGG - Intergenic
913659719 1:120995420-120995442 CTGGAAAAATCTTCCTGTATAGG + Intergenic
914011077 1:143778544-143778566 CTGGAAAAATCTTCCTGTATAGG + Intergenic
914166757 1:145182586-145182608 CTGGAAAAATCTTCCTGTATAGG - Intergenic
914649700 1:149687199-149687221 CTGGAAAAATCTTCCTGTATAGG + Intergenic
920286812 1:204885525-204885547 CTGGTCAATTCTTTCTCTGACGG - Intronic
920541351 1:206780676-206780698 CTGGGAAAGTCTTCTTCTCTAGG - Intergenic
920649738 1:207827935-207827957 GAGGTAAAGTTTTCCTCTTTGGG - Intergenic
921420457 1:214941252-214941274 TTGGTAAAGTCTTCAGCTTTAGG + Intergenic
921615354 1:217260029-217260051 CTACTACAGTCTTCCTCTCTTGG + Intergenic
923859652 1:237880512-237880534 CTGCTAAAGCTTTCCTCTTTTGG + Intronic
1069321820 10:67181403-67181425 CTTGGAAAGACTTCCTCTCTTGG - Intronic
1070940117 10:80337180-80337202 CTGGACAAGTCTTCCTCAGGAGG - Intronic
1071831575 10:89377565-89377587 ATGGTTAGGTCTTCTTCTGTGGG - Intronic
1074625506 10:115179473-115179495 GTGGTAAAGTCTTCCTGTTGTGG + Intronic
1075557549 10:123444385-123444407 CTGGAAAAGTCTTGCTTGGTTGG + Intergenic
1077597476 11:3546445-3546467 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1079370223 11:19846222-19846244 TTTGTAAAACCTTCCTCTGTGGG - Intronic
1079733342 11:23962958-23962980 CTGATGCAGTCTTCCCCTGTAGG - Intergenic
1087689690 11:101306050-101306072 CTGGAAAAGTGTTCCTGTTTTGG - Intergenic
1088566194 11:111175484-111175506 CTGAGAAAGTCTTACTCTGTTGG - Intergenic
1089913130 11:122123969-122123991 CTTGTAAATTACTCCTCTGTAGG + Intergenic
1090456059 11:126850652-126850674 CTGGTAAAGTCTTCCTCTGTTGG - Intronic
1092423661 12:8355739-8355761 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1093298136 12:17416843-17416865 CTGGTAGTGGCTTCCACTGTGGG - Intergenic
1093666567 12:21820777-21820799 TTGGAAAAGTCTTCCTTTCTTGG + Intronic
1095133531 12:38571362-38571384 CTGGTTAAATGCTCCTCTGTGGG - Intergenic
1097849409 12:64396712-64396734 CTGGTAACGTCTCCATCTGAGGG + Intergenic
1098443243 12:70539858-70539880 CTAACAAAGTCTTCCTCTTTTGG - Intronic
1098932875 12:76440672-76440694 CAAATATAGTCTTCCTCTGTGGG + Intronic
1099890836 12:88586597-88586619 CTAGTAAAGGCTTCCTATGAGGG + Intergenic
1099895077 12:88634912-88634934 CTGGTAATGTCTTCCTGTACTGG - Intergenic
1100245833 12:92756065-92756087 GAAGTAAAGTCTTCATCTGTAGG + Intronic
1100438681 12:94595283-94595305 CTGGTATAGTGTTCATCTCTGGG - Intronic
1102533022 12:113560770-113560792 CTAGAAAAGTTTTCCCCTGTAGG + Intergenic
1102974758 12:117198584-117198606 CTGCTCAAGTGCTCCTCTGTAGG + Intergenic
1104482071 12:129116099-129116121 TGGGTAAGGTCTTCCTCTGGAGG - Intronic
1105704660 13:22961552-22961574 CTGGCAAAGCCTTCCTCCCTGGG + Intergenic
1105857616 13:24386600-24386622 CTGGCAAAGGCTTCCTCCCTGGG + Intergenic
1107063431 13:36186528-36186550 CTGGAAAAGTCTTCATTTGTGGG + Intronic
1110574936 13:77044647-77044669 GTGATAAAGTCTACCACTGTGGG - Exonic
1111843445 13:93478470-93478492 CTGGTAAATTATGCCTGTGTTGG - Intronic
1112975174 13:105308894-105308916 CTGATAAAGTCTTTTCCTGTGGG - Intergenic
1113438755 13:110312190-110312212 CTGTTAAAGTCTTCCTCCATGGG + Intronic
1116487746 14:45471330-45471352 CTTGAACAGTCTTCCTGTGTGGG - Intergenic
1116803245 14:49465313-49465335 TTGCTAAAATCTTCCTCTGCAGG + Intergenic
1119430649 14:74566363-74566385 CTGGGAACGCCTTCCTCTCTTGG - Intronic
1121879735 14:97489194-97489216 TTGGTCAAGTCTTCCTTTTTGGG + Intergenic
1124035739 15:26052345-26052367 CTTGTAAAATCTTCCTTTGCAGG + Intergenic
1124346835 15:28928654-28928676 CTGGTAAAGTCTTTCCCTGCGGG + Intronic
1125083473 15:35702628-35702650 ATGGTAAAGTGCTCATCTGTAGG + Intergenic
1125298159 15:38224765-38224787 CATGTAAAGTCTTCCTCTGGAGG - Intergenic
1126329572 15:47517621-47517643 CAGGTAAAGATTTCCTGTGTGGG - Intronic
1129505293 15:76076559-76076581 TTGGTAAACTCTTCCTGAGTGGG - Intronic
1131782335 15:95873123-95873145 TTGGGAAATTCTTCCTCTGGAGG - Intergenic
1133721451 16:8498287-8498309 ACAGTAAAGTCTGCCTCTGTGGG - Intergenic
1134086134 16:11358703-11358725 CTGGTGAAGGCTTCCTCTGGTGG + Intergenic
1134366587 16:13584739-13584761 CTGGTGGACTCTTCCTCCGTGGG + Intergenic
1135176618 16:20235496-20235518 CAGATAAAGTCTTCCTCTCTTGG + Intergenic
1136931377 16:34420839-34420861 GTGATAGAGTCTTCCTCTGTTGG - Intergenic
1136973196 16:34990980-34991002 GTGATAGAGTCTTCCTCTGTTGG + Intergenic
1138304768 16:55964602-55964624 CTGGAAAGCTCTTCCTCTGTTGG - Intergenic
1140161389 16:72498364-72498386 CTCTTAAAGCCTTCCTCTCTTGG + Intergenic
1141139694 16:81489338-81489360 CAAGTAAAGTCCCCCTCTGTGGG - Intronic
1144326882 17:14190888-14190910 AGGGTAAAGTCTGCCTCTCTAGG + Intronic
1144475764 17:15587751-15587773 AGGGTAAAGTCTGCCTCTCTAGG + Intronic
1148515244 17:48210889-48210911 CTGGTAAGGACTTCCTTTGGAGG - Intronic
1150097980 17:62395480-62395502 CTGGAAAAGTCTTGTTCTGCTGG - Intronic
1154495324 18:14953145-14953167 CTAGTAAAGTCATCTGCTGTGGG + Intergenic
1157387324 18:47268741-47268763 GTGGTAAATTATTACTCTGTGGG + Intergenic
1158860661 18:61589218-61589240 CTGGTAACTTCCTCTTCTGTTGG + Intergenic
1159585089 18:70276489-70276511 TTGGTAAAGTCTTTCTCTCATGG - Intergenic
1162322539 19:9978675-9978697 CAGGTCCTGTCTTCCTCTGTGGG + Intronic
926428715 2:12764438-12764460 TTGGTAAAGTCATCCTGTGCTGG + Intergenic
927721361 2:25384746-25384768 CTGGAAACTTCTTCCTCAGTGGG - Intronic
929278210 2:40048488-40048510 CTGGTTACCTCTTCCTCTGATGG - Intergenic
932887887 2:75563374-75563396 CTGGTAGAATCTACCTCTGTAGG - Intronic
937411734 2:121682634-121682656 CTGGTAAAGTATTCCTTTGGTGG - Intergenic
940744363 2:157550378-157550400 TTGGTTAGGTCTACCTCTGTTGG - Exonic
941261564 2:163304826-163304848 CTGGTAAAGTCAACACCTGTGGG - Intergenic
943531908 2:189093031-189093053 ATGGTCTAGTCTTCCTCTGGGGG - Intronic
946340724 2:219066167-219066189 CTGACAGAGTCTTGCTCTGTTGG - Intergenic
946487844 2:220117868-220117890 CTGGTAACACCTTCCTCTGGTGG + Intergenic
947075369 2:226338114-226338136 CTGGTAAATTCTTTTTCTCTAGG - Intergenic
1173795253 20:45855277-45855299 CCAGTAATGCCTTCCTCTGTAGG + Exonic
1176990227 21:15487110-15487132 CTGGGAAAGTCTTCCACTTGTGG - Intergenic
1178294890 21:31401453-31401475 ATGGTAAACTGTTCCTCTATTGG + Intronic
1179147363 21:38779885-38779907 CTGGGAGAATCTTCCTCTTTTGG + Intergenic
1183925006 22:41199544-41199566 CTGCTAAATTCCTCCTCAGTTGG - Intergenic
951191266 3:19774494-19774516 CTGGGAAAATCTACCTCAGTGGG - Intergenic
953838633 3:46369845-46369867 CTGGGTTAGTCTGCCTCTGTAGG + Intergenic
953915213 3:46914882-46914904 GTGATGAAGTCTTGCTCTGTCGG - Intergenic
956599793 3:71008670-71008692 CTGATAAAGCGTCCCTCTGTTGG + Intronic
957067643 3:75538817-75538839 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
959579559 3:107969626-107969648 CTGGTAAAGTCTTGGTTTCTTGG - Intergenic
960237303 3:115298555-115298577 CTTGTAAAGTCTCCCTTTGAAGG - Intergenic
961285509 3:125799159-125799181 CTGGAACTCTCTTCCTCTGTGGG - Intergenic
962414431 3:135169165-135169187 CCAGTAAAATCTTCCTCTGTTGG - Intronic
965613660 3:170570682-170570704 CTGGTAAAGTATTTCATTGTGGG + Intronic
969012219 4:4075383-4075405 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
969741865 4:9034325-9034347 CTGGAACTTTCTTCCTCTGTGGG - Intergenic
975628166 4:76370840-76370862 CTGGTAAAGCCATCCTTTGCAGG - Intronic
980439195 4:132818160-132818182 CTGGTAAAGTATTTCTTTGGTGG - Intergenic
987442717 5:17976762-17976784 CTGGTAAAAGCTTACTCTGGGGG + Intergenic
991121419 5:63019334-63019356 CTGGTCAGGACTTCCTCTGTTGG + Intergenic
992780063 5:80119643-80119665 CTGGAAAAGTCCTCCTCTCTGGG - Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
998228196 5:140342831-140342853 CTGTTAAAGTCTGACTCTTTGGG + Intronic
999231163 5:150062843-150062865 CTGGAAAATTCTTCCTCTGATGG - Intronic
999330218 5:150668708-150668730 CTGCAAAAGGCTTCCTTTGTTGG + Intronic
1001113736 5:168921401-168921423 CTGTTAAAGCATTTCTCTGTTGG + Intronic
1003311447 6:4972873-4972895 TTGAGAAAGTCTTCCTCTGTTGG - Intergenic
1003643881 6:7898739-7898761 CTGGTTAAGTGTTCCTTTGTGGG - Intronic
1006085072 6:31589593-31589615 CTGGTACAGTCCTCCTCCTTCGG - Exonic
1006236023 6:32633513-32633535 CTGGTGAAGTTTTACTCTGAAGG - Intronic
1007190452 6:40012077-40012099 TTGGTAAATGCTCCCTCTGTGGG + Intergenic
1008534720 6:52499114-52499136 TTGGTAAAGTCTTCCTCACTGGG + Exonic
1009613245 6:65973526-65973548 GTGTTAAAGTCTCCCACTGTGGG - Intergenic
1010184810 6:73131787-73131809 CAGATAAACTCTTCCACTGTTGG + Intronic
1011570062 6:88725510-88725532 GTGGTGAAGTATTCCTCAGTTGG + Intronic
1012059024 6:94453654-94453676 CAAGTAAAATCTTCCTCAGTGGG + Intergenic
1015818258 6:137232803-137232825 TTGGCCAAGTCTTCCTCAGTCGG + Intergenic
1015824696 6:137299266-137299288 CTTGTAATGTCTACCTCAGTGGG - Intergenic
1015956687 6:138606258-138606280 GTGGTAAGTTCTTTCTCTGTGGG - Intronic
1016614276 6:146028619-146028641 CTGGTAAAGTCTCCGTATGGAGG - Intronic
1018620061 6:165721601-165721623 CTGGTAAACAGTTCCTTTGTAGG + Intronic
1018958032 6:168425737-168425759 CTGGAATGTTCTTCCTCTGTTGG - Intergenic
1019289895 7:245340-245362 CTGGTAAATTCTTCCTGGATTGG + Intronic
1019794158 7:3037587-3037609 GTGATAGAGTCTTGCTCTGTTGG + Intronic
1019912679 7:4110267-4110289 CTGGCCAAGTCTTCCTCTCTAGG + Intronic
1022398955 7:30017593-30017615 GAGATAAAGTCTTCCTATGTTGG + Intronic
1023158475 7:37275149-37275171 CTGATGAACTCTTCCTCTGAGGG - Intronic
1023696562 7:42854004-42854026 CTGGTGAAGTCTTCCAGTCTTGG + Intergenic
1027180937 7:75938869-75938891 CTGGTACACGCTTCCTCTATCGG + Intronic
1028694123 7:93688780-93688802 CAGATAAATTCTGCCTCTGTAGG + Intronic
1029118110 7:98248336-98248358 CTGGCCATGTCTTCATCTGTAGG - Intronic
1030868426 7:114727722-114727744 TTTATAAAGTCTTCCTCTGATGG + Intergenic
1032414095 7:131722902-131722924 TTGGCAAAGTCTTCCTTTCTTGG + Intergenic
1036253734 8:7187474-7187496 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1036467942 8:9019489-9019511 CTGGTAAAGTCTCATTTTGTGGG + Intronic
1036887201 8:12567073-12567095 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1036894796 8:12625174-12625196 CTGGAACTTTCTTCCTCTGTGGG + Intergenic
1037277072 8:17192002-17192024 GAGGTAAGGTCTTGCTCTGTTGG + Intronic
1038119446 8:24596158-24596180 CTGGTAAGGTCTTTCTCTTTAGG - Intergenic
1038653712 8:29429334-29429356 ATGGTGAATTCCTCCTCTGTAGG - Intergenic
1038849992 8:31266347-31266369 CTAGTAAAGTCTTCCTCCTAAGG - Intergenic
1038854240 8:31313839-31313861 CTGCTACATTCTTCCACTGTTGG - Intergenic
1040339767 8:46434625-46434647 ATGGAAGAGTCTTCCTCTGAAGG + Intergenic
1041405521 8:57494887-57494909 CTTGTAAAGTCTTCACCTGTGGG - Intergenic
1042208654 8:66355091-66355113 CTGCTTAAGTAATCCTCTGTTGG - Intergenic
1042629066 8:70796302-70796324 TTGGTAATGTCTTCCTTTCTGGG + Intergenic
1043016959 8:74950976-74950998 CTGCTAAAGACTTCCTTTTTGGG + Intergenic
1047797365 8:128271684-128271706 CAGCTAACGTCATCCTCTGTGGG - Intergenic
1052775327 9:32727325-32727347 CTGGTAATGTCTCCATCTGAAGG - Intergenic
1053580142 9:39395391-39395413 TTGTTAGAGTCTTGCTCTGTCGG + Intergenic
1053752454 9:41269741-41269763 CTGCCCAAGTCTTCCTCTGCTGG + Intergenic
1054101728 9:60954198-60954220 TTGTTAGAGTCTTGCTCTGTCGG + Intergenic
1054123101 9:61229567-61229589 TTGTTAGAGTCTTGCTCTGTCGG + Intergenic
1054745342 9:68848343-68848365 CTTTTAAAGTCTTACACTGTAGG - Intronic
1056851703 9:90090290-90090312 CTTGTAACTTCTTTCTCTGTGGG + Intergenic
1058779613 9:108319640-108319662 CTGGAAAAGTCACCCTCTGTCGG - Intergenic
1058954636 9:109934285-109934307 TTGGGAAATTCTTCCTCTGATGG + Intronic
1060820166 9:126657212-126657234 CTGGTGATGTCTACCTTTGTGGG - Intronic
1185854795 X:3524083-3524105 CTGGGCACGTCTGCCTCTGTAGG + Intergenic
1192769119 X:74168637-74168659 TGGGTAAATTCTTGCTCTGTTGG + Intergenic
1194845665 X:98804941-98804963 CTGATAAACTCTTCCTCTTTTGG + Intergenic
1197270288 X:124417799-124417821 CTTGTATAGTCTTCCCCTCTTGG + Intronic
1198975467 X:142331066-142331088 CTGGAAAAGTCTTATTTTGTAGG + Intergenic