ID: 1090457190

View in Genome Browser
Species Human (GRCh38)
Location 11:126860431-126860453
Sequence AGGAATTTGCTGAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 385}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090457189_1090457190 -8 Left 1090457189 11:126860416-126860438 CCTCAGGTGTTGGGAAGGAATTT 0: 1
1: 0
2: 2
3: 19
4: 186
Right 1090457190 11:126860431-126860453 AGGAATTTGCTGAATGAAGAAGG 0: 1
1: 0
2: 2
3: 42
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090457190 Original CRISPR AGGAATTTGCTGAATGAAGA AGG Intronic
900119440 1:1042234-1042256 AGGAACATGATGGATGAAGATGG - Intronic
901584700 1:10279292-10279314 ATTAGTTTGCTAAATGAAGAAGG - Intronic
901690339 1:10969116-10969138 AGGAATTTCCAGAATGAGCAGGG + Intronic
902186980 1:14732921-14732943 AGGTATTTTCTGAATGAACAGGG + Intronic
903737092 1:25536988-25537010 AGGAACCTGCTGCATGGAGACGG + Intergenic
904367711 1:30025998-30026020 AGGAATTAGCTTAACCAAGAAGG + Intergenic
904821103 1:33245052-33245074 GGGAATTTGATGAATGAACCAGG + Intergenic
905126138 1:35717470-35717492 AGGAATTTGCTGGGTGGAGAAGG - Intronic
905905023 1:41612185-41612207 AGGATTTGGCTGAACAAAGAAGG - Intronic
906265184 1:44423592-44423614 AAATATTTGCTGAATGAAGGAGG + Intronic
907092872 1:51745142-51745164 AGGAATGAACTGAATGAAAAAGG + Intronic
908108183 1:60867676-60867698 AGGACTTTGATGAAGGAGGAGGG + Intronic
908403582 1:63792866-63792888 AGTATTTTGCTGAAAGATGAAGG + Intronic
909689127 1:78386749-78386771 AAGTATTTGCTAAATGATGAAGG - Intronic
909891245 1:81009859-81009881 AGGAATTTATAGAAGGAAGATGG + Intergenic
910657196 1:89631827-89631849 AGGATTTTGCTGAGTGAGCAGGG + Intergenic
911392348 1:97262058-97262080 AGGAATCTGGTGATTGAGGATGG - Intronic
912741872 1:112205598-112205620 AGGAAAATGCTGATTGAAAAAGG - Intergenic
913109419 1:115643797-115643819 ATAAATGTGTTGAATGAAGAAGG + Intronic
913126804 1:115798381-115798403 AGAAATTTCCTGAATGATGGGGG + Intergenic
913385068 1:118250612-118250634 AGGAATTTCCTGAGTGGAGAAGG + Intergenic
915318625 1:155043721-155043743 AGGAGGTGGATGAATGAAGACGG - Intronic
917382193 1:174424092-174424114 AGAAGTTTACTGAATGATGAAGG + Intronic
917594843 1:176518658-176518680 AGGAATATGCTAAATGCAGATGG - Intronic
917745798 1:178005730-178005752 AGAAATTAGCAGAAGGAAGAGGG - Intergenic
918161934 1:181909446-181909468 AGGAATTAGCTGGACAAAGAAGG + Intergenic
918720744 1:187849786-187849808 TGTTATTTGATGAATGAAGAGGG - Intergenic
920204331 1:204280841-204280863 AGGAATCAGGTGCATGAAGATGG - Intronic
920288135 1:204896489-204896511 AGGAATTGGTAGAAGGAAGAAGG + Intronic
921627530 1:217394193-217394215 AGACATTTGCTGCTTGAAGATGG - Intergenic
922966101 1:229692207-229692229 AGAAGTTAGCTAAATGAAGAAGG + Intergenic
922988275 1:229883658-229883680 AGCATTTTTCTGAATGAAGATGG - Intergenic
923082327 1:230670036-230670058 AGGAGTTTGCTGGACGAGGAAGG + Intronic
923414276 1:233739610-233739632 AGGAAAAGGCTGAAGGAAGATGG + Intergenic
1062983064 10:1741884-1741906 AGCAATTTCCTGAATGAACTTGG + Intergenic
1063298971 10:4834726-4834748 AGGAATCTGCTAAAGGATGAGGG - Intronic
1063824962 10:9885944-9885966 AGGAAGTTGCAGAATAAAAATGG - Intergenic
1065678697 10:28207033-28207055 AAAAATTTGTTGAATGGAGAAGG - Intronic
1065896979 10:30171696-30171718 AGCACTTGGGTGAATGAAGAGGG + Intergenic
1066249862 10:33622671-33622693 AGCACTTTTTTGAATGAAGATGG + Intergenic
1067811741 10:49433400-49433422 GAGAACTTTCTGAATGAAGAGGG + Intergenic
1068089843 10:52419920-52419942 AGGAATTTGCAAAATAAAGATGG - Intergenic
1068651836 10:59530685-59530707 AAGAATTTGCTTAATGAATCTGG - Intergenic
1069398160 10:68012345-68012367 AGGATTATGCTTAGTGAAGAAGG - Intronic
1071106591 10:82104574-82104596 AGGAATGTGCTGTGTGAAAAAGG + Intronic
1071110964 10:82155677-82155699 TGTATTTTGCTGACTGAAGAAGG + Intronic
1071411256 10:85399278-85399300 AGGAAATCACTGAATGAATAAGG + Intergenic
1072346226 10:94509492-94509514 GGGACTTTTCTGAATGCAGAAGG - Intronic
1072587908 10:96798958-96798980 AGCCATTGGCTGAATGGAGAAGG - Intergenic
1073616106 10:104997769-104997791 AAAGATTTGCTGAATGAAAAAGG - Intronic
1073739345 10:106388689-106388711 TGAAATTTGTTCAATGAAGACGG - Intergenic
1076201470 10:128562194-128562216 AAAAACTTGCAGAATGAAGAAGG - Intergenic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1078657841 11:13258989-13259011 AGGAATGTGCTAAGTGGAGAGGG + Intergenic
1078699335 11:13666301-13666323 GGGATCTTGCTGAATAAAGATGG + Intergenic
1078982936 11:16559108-16559130 ATGAACTTGCTGTATGAAGCAGG + Intronic
1079287739 11:19154250-19154272 AAGTATTTGTTGAATGAATAGGG + Intronic
1079989467 11:27231696-27231718 AGGAAATAGCTGTTTGAAGACGG - Intergenic
1080867918 11:36212080-36212102 TGGAATTTGCTGAATAAGGAAGG - Intronic
1080975253 11:37332002-37332024 AGGAATTAGCTGAAGAATGAGGG - Intergenic
1081797415 11:45830645-45830667 AGCATTATGCTGAATGAAGAAGG + Intergenic
1083160606 11:60851990-60852012 AAGCATTGGCTAAATGAAGAGGG + Exonic
1084060588 11:66670898-66670920 AGCAACTTGCTGATTGCAGAGGG - Intronic
1085165977 11:74399389-74399411 AGGAAGTTGTTGAGGGAAGATGG + Intergenic
1085997608 11:81939022-81939044 AGCAATATGCTTAATGAAGTGGG + Intergenic
1086257209 11:84891518-84891540 AGGAAATTAATGAATGAAGAGGG + Intronic
1087093209 11:94296837-94296859 AGGTATTTGTTAAATGAACAAGG - Intergenic
1087434550 11:98097509-98097531 AAGAATTTGCTTAATGAGAATGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087800405 11:102497223-102497245 AGGAACTTGGGGAATGAAGAAGG - Intronic
1088177665 11:107072451-107072473 AGCAATTAGCTGATTTAAGAAGG + Intergenic
1088183580 11:107139188-107139210 GGAAATTTGCTTAATGTAGAAGG + Intergenic
1088756698 11:112890926-112890948 AGGAATTTTCTAACTGAAGCCGG + Intergenic
1089076392 11:115742076-115742098 AGGAATGGGGAGAATGAAGAGGG + Intergenic
1089924303 11:122241448-122241470 AGAAATTAGGAGAATGAAGATGG + Intergenic
1090203364 11:124871197-124871219 AGAAGTTTGCAGAATGTAGAGGG - Intronic
1090457190 11:126860431-126860453 AGGAATTTGCTGAATGAAGAAGG + Intronic
1091673764 12:2472388-2472410 ATGAATAGGCTTAATGAAGATGG - Intronic
1091933016 12:4412404-4412426 TGGAATTTGCTTTATTAAGATGG + Intergenic
1092045441 12:5429457-5429479 GGCAAGGTGCTGAATGAAGAAGG - Intergenic
1093925565 12:24905002-24905024 AGAAATTTACTAAAGGAAGAAGG + Intronic
1093957237 12:25235068-25235090 TGGAATTGGCAGAATGAAGATGG - Intronic
1094102803 12:26781209-26781231 AGGTGTTTGCTGAAGGCAGAAGG + Intronic
1094493991 12:30978086-30978108 AGGCATTTGCTAAGTGAAGGAGG - Intronic
1094556672 12:31507113-31507135 TGGAATTTCCTGAGTGACGACGG - Intronic
1096289046 12:50325197-50325219 AGGTGTTTGCTGAAGGCAGAGGG + Intergenic
1097499932 12:60389151-60389173 AGGAAATTGCTGGGTGATGATGG + Intergenic
1097579909 12:61442557-61442579 AGAATTTTGCTGAATGAACTTGG + Intergenic
1097707155 12:62880334-62880356 AGTAATTGGCCAAATGAAGAGGG - Intronic
1097939061 12:65283920-65283942 ACTAATTTCCTGTATGAAGAGGG + Intronic
1098240746 12:68464338-68464360 TGGAATTTCCTGAGTGAGGAGGG - Intergenic
1098393953 12:69998401-69998423 AAGAATTTGCTGGGTGAGGAGGG + Intergenic
1098477953 12:70927307-70927329 AGGATTTTGCAGAATTAAGTAGG + Intergenic
1099225332 12:79962357-79962379 AGCAATTTGCTCTATGAACAAGG - Intergenic
1099593723 12:84629436-84629458 AAGAATTTGCTGATTGACCAGGG + Intergenic
1100223642 12:92534138-92534160 ACAAATTTCCTGAAAGAAGATGG - Intergenic
1100673560 12:96842543-96842565 AGAATTTAGCTGAATGAAAAAGG - Intronic
1101437773 12:104679057-104679079 AGACATTAGCTGAATGAAGGAGG + Intronic
1102397375 12:112598405-112598427 AGTAATGTGCTTAGTGAAGAAGG + Intronic
1102803772 12:115761261-115761283 AGGATTTAGCTGAAGGAAGCTGG + Intergenic
1102816934 12:115873836-115873858 TGGTGTTTGCTTAATGAAGAAGG + Intergenic
1103187641 12:118974428-118974450 AGGCATTTGCCAAGTGAAGAAGG - Intergenic
1103946054 12:124527143-124527165 AGGGATTTGCTGAATCAGGATGG - Intronic
1103946190 12:124528011-124528033 AGGGATTTGCTGAATCAGGATGG + Intronic
1106310612 13:28550694-28550716 AGGGGTTTGCTGATTGTAGAGGG + Intergenic
1106451197 13:29884156-29884178 AGGAATTTGCTGAGCGCAGAGGG + Intergenic
1106532671 13:30608614-30608636 GGGATTTGGCTGACTGAAGAGGG + Intronic
1107757972 13:43646457-43646479 AAGAATTTCATGTATGAAGATGG - Intronic
1107923007 13:45229321-45229343 AGGAATTTGCTGTACAAAGAAGG - Intronic
1108528725 13:51308711-51308733 AGGAACATTTTGAATGAAGAGGG + Intergenic
1108598460 13:51970491-51970513 AGGAATCTGCAGAAAGAAGCTGG - Exonic
1109683013 13:65777334-65777356 AGGAATGTTCTAAATGAAGTAGG + Intergenic
1110500296 13:76219555-76219577 AGTAATTTTCTGAACCAAGATGG + Intergenic
1110599364 13:77354446-77354468 ATGAATTAACTGAATGAAGCAGG + Intergenic
1111191114 13:84807876-84807898 AGGAATGTGTTGTACGAAGACGG + Intergenic
1111612852 13:90626205-90626227 AATAATTTAATGAATGAAGAAGG - Intergenic
1112171057 13:96972010-96972032 AGGAATGTGCTTCAGGAAGAAGG - Intergenic
1113788841 13:113016720-113016742 AGAAATTCGCTGCATGGAGAGGG - Intronic
1114058332 14:18995840-18995862 AGGAATATGCTCAATGAAAAAGG - Intronic
1114104214 14:19405914-19405936 AGGAATATGCTCAATGAAAAAGG + Intronic
1114440935 14:22747221-22747243 AGGGTTTTACTGAATGAAAAGGG + Intergenic
1115298823 14:31860853-31860875 AGAATTATGCTGAATGAAAAAGG + Exonic
1115840114 14:37460783-37460805 AGGAATATGCTTAACCAAGAAGG + Intronic
1116275483 14:42826825-42826847 AAGAATTTCCTGAATTATGAGGG + Intergenic
1116365422 14:44055652-44055674 TGGAAGTGGCTGAATCAAGAGGG - Intergenic
1117319379 14:54606612-54606634 AGAAAGGTGCTGAATGAACATGG - Intronic
1117571304 14:57051735-57051757 AGGAATTCCCAGAATGAAAATGG - Intergenic
1118505524 14:66406957-66406979 AGCAATTTGCAGAAAGATGAGGG - Intergenic
1119069948 14:71572440-71572462 AGGCAGTTACTAAATGAAGAAGG + Intronic
1119431314 14:74569818-74569840 AGAAATTTGCGGCATGAAGGAGG + Intronic
1122457803 14:101868142-101868164 AAGAATGTGTTGAATTAAGAGGG + Intronic
1123497127 15:20838558-20838580 AGGAATATACTTAATGAAGGAGG + Intronic
1123500049 15:20873213-20873235 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1123554361 15:21412192-21412214 AGGAATATACTTAATGAAGGAGG + Intronic
1123557297 15:21446911-21446933 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1123590606 15:21849513-21849535 AGGAATATACTTAATGAAGGAGG + Intergenic
1123593522 15:21884178-21884200 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1124096291 15:26651400-26651422 AGCAAGTAGCTGAATGCAGAAGG - Intronic
1126687358 15:51260146-51260168 AGGATTTTGCTGAAACTAGATGG + Intronic
1128599061 15:68980113-68980135 AGGAATATGGTTGATGAAGAAGG + Intronic
1129914412 15:79256218-79256240 TGGAATTTCCTGAATGATAAGGG + Intergenic
1131354406 15:91732239-91732261 AGCTCTTTGCTGAATGAGGAAGG - Intergenic
1131967038 15:97855192-97855214 AGGTATTTGCTGAAGGCAAAAGG + Intergenic
1131972557 15:97906791-97906813 AGGAATGGGCTAAGTGAAGAGGG - Intergenic
1132418109 15:101638916-101638938 AGGAGTTTGATGAATGAGTAAGG - Intronic
1202962708 15_KI270727v1_random:139390-139412 AGGAATATACTTAATGAAGGAGG + Intergenic
1133699341 16:8294642-8294664 TGATATTTTCTGAATGAAGAGGG - Intergenic
1133737357 16:8626283-8626305 AGGAGTTTGCTTAATGAAAGTGG - Intronic
1133758490 16:8780060-8780082 AGGGATTGGCTGGGTGAAGAAGG + Intronic
1138308074 16:55996775-55996797 AGGCATTTGCTGAGAGAACAGGG - Intergenic
1141499689 16:84435463-84435485 AAATATTTGCTGCATGAAGAAGG - Intronic
1143055841 17:4161181-4161203 AGTTATTTGCTGAATGACTAAGG - Intronic
1143385177 17:6525017-6525039 TGGAATCTGCTGAATAAGGAGGG - Intronic
1144037752 17:11382669-11382691 AGGAAAATGTTGGATGAAGAGGG - Intronic
1146797536 17:35793642-35793664 GGGAAACTGCAGAATGAAGAGGG - Intronic
1151615986 17:75211888-75211910 AGAAATTTGCTGAAAGAAAGAGG - Intronic
1153368760 18:4289165-4289187 AAGGACTGGCTGAATGAAGATGG + Intronic
1153573850 18:6500999-6501021 AGGAATATGCTTAACCAAGAAGG - Intergenic
1154366878 18:13718727-13718749 AGGAATTTACTTGATGAATAAGG + Intronic
1154455146 18:14514980-14515002 AGGAATATACTTAATGAAGGAGG + Intronic
1154458652 18:14556175-14556197 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1155363678 18:25029328-25029350 TGGAATTTGCTGAAAGATAATGG - Intergenic
1155524969 18:26706686-26706708 GGGACTTTGCAGAAAGAAGATGG + Intergenic
1155751410 18:29427093-29427115 AGGAATTTGTTGAATAAACTTGG - Intergenic
1156860667 18:41832640-41832662 AGGAATATGTGGAATGCAGAAGG - Intergenic
1157073301 18:44435453-44435475 AGGAATAAACTGAATCAAGAAGG - Intergenic
1157253782 18:46119743-46119765 GGAACTTTGCCGAATGAAGAAGG + Intronic
1157354263 18:46918231-46918253 AGGAAGATGCTGAGTCAAGATGG + Intronic
1157458604 18:47862513-47862535 AGGAATGTGCTATATGAAGATGG - Intronic
1157617078 18:48993307-48993329 AGGAGTTTGCTGGAGGAAGGAGG - Intergenic
1158424240 18:57324757-57324779 AGAAATTAGCTGAACGAAGGTGG - Intergenic
1159146910 18:64466648-64466670 AGGAATTTGATGAATTAAACTGG - Intergenic
1159640024 18:70852936-70852958 AAGTATTTGCTGAATGCAAAAGG - Intergenic
1159806511 18:72963890-72963912 AGAAATCTGCTTTATGAAGAAGG + Intergenic
1160441100 18:78893349-78893371 AGCAGTATGCTAAATGAAGAAGG + Intergenic
1161070036 19:2255452-2255474 ATGAATTTGCCGAGTGAGGAGGG - Intronic
1161507128 19:4650074-4650096 AAACATCTGCTGAATGAAGAGGG - Intronic
1163216447 19:15881256-15881278 AGGAATGAGCTGAATAAATAAGG + Intronic
1165080874 19:33305339-33305361 AGGAATTTGCTGGAAGGATAAGG + Intergenic
1165597032 19:37017779-37017801 AGTACTCTGCTGAATGAACATGG - Intronic
1166346899 19:42172205-42172227 AGGAATCTGGGGAATGAAGATGG - Intronic
1166372817 19:42311717-42311739 AGGGATTTGCTGAGTGAAAATGG - Intergenic
1167821950 19:51936470-51936492 TGGAATTTCCTGAATGATAAGGG + Intronic
925066766 2:933870-933892 AGGACTTTGCAGAGTGGAGAGGG + Intergenic
925195228 2:1917702-1917724 GGAAAATTGCTGAATGATGATGG - Intronic
926047098 2:9717813-9717835 AGGCCTTTGATGAATGGAGAAGG + Intergenic
926542726 2:14201461-14201483 AGGAATTTTCAGATTAAAGAAGG + Intergenic
927618744 2:24628720-24628742 AGGAATTGGATAGATGAAGAAGG + Intronic
928237095 2:29553015-29553037 AGAATTTCGCTGAATAAAGAAGG - Intronic
928613367 2:33012205-33012227 AGTATTTTGTTGAATGAATAAGG + Intronic
929169569 2:38918069-38918091 AGGAATTTGTTGAAAGGAGATGG + Intronic
930213430 2:48667975-48667997 GGGAATTTGCAGAGTCAAGAAGG - Intronic
930260754 2:49143361-49143383 AGGAATGTGCTGAATTCATATGG - Intronic
931367841 2:61634829-61634851 AGGAATTTCCTGAAAAAAGTGGG + Intergenic
931580926 2:63773306-63773328 AGCAATATGTTGAATGAAAAAGG + Intronic
931612019 2:64111185-64111207 AGGAATCTCATGAATGAAAAAGG + Intronic
932611203 2:73201777-73201799 AGGAATTTACAGTCTGAAGAAGG + Intergenic
932774624 2:74520408-74520430 AGGAATTAGCCGAGTGGAGACGG + Intronic
933554969 2:83820932-83820954 AAGAATTTGCTTTATGAATATGG + Intergenic
933984923 2:87582791-87582813 AGGAATTTTCTAGCTGAAGAAGG - Intergenic
934681953 2:96290404-96290426 AGGAAGTTGTTGATTGAGGAGGG + Exonic
934803671 2:97195351-97195373 AATTATTTTCTGAATGAAGACGG + Intronic
934804087 2:97200959-97200981 AATTATTTTCTGAATGAAGACGG + Intronic
934832960 2:97550833-97550855 AATTATTTTCTGAATGAAGACGG - Intronic
936308929 2:111368020-111368042 AGGAATTTTCTAGCTGAAGAAGG + Intergenic
937177235 2:119951769-119951791 AAGAAATTGTTGCATGAAGAAGG + Intronic
937371542 2:121301229-121301251 GGGAATTGGCTGAATGGAGAAGG + Intergenic
937433479 2:121860692-121860714 AGGAAGGTGATGAATGAGGACGG + Intergenic
937479106 2:122240874-122240896 AGGAATTTGCAGAATCATAATGG - Intergenic
939530302 2:143351477-143351499 AGCATTTTGCTTAATGAAGGTGG - Intronic
940101601 2:150046459-150046481 AGGAATTTGAGGAATGCTGACGG - Intergenic
940397137 2:153202317-153202339 GAGAGGTTGCTGAATGAAGAAGG - Intergenic
941319967 2:164041772-164041794 AGAAATTTGCAGAATTAACAAGG - Intergenic
943267610 2:185755060-185755082 AGGATTTTGATAAATGGAGACGG - Intronic
943483415 2:188450973-188450995 AGTAATTTGCTGAAAGGTGAAGG - Intronic
943711722 2:191104225-191104247 AGAAATTTGGAAAATGAAGAAGG - Intronic
943837077 2:192526962-192526984 AAGAATTTGCTTGATGAATATGG - Intergenic
945945467 2:215990881-215990903 AGGAATTTGCTTTATGAATCTGG - Intronic
946870906 2:224084158-224084180 AGGTATTTGCTAATTGGAGATGG - Intergenic
946947089 2:224832289-224832311 CAGAATTTGTTGAATGAAAAAGG - Intronic
947351163 2:229246879-229246901 AGCAATTTGCAAAATGGAGAAGG + Intronic
948498144 2:238368167-238368189 AGGACTTGGCTGAATGAATTAGG + Intronic
948728977 2:239951722-239951744 AGGAATTTTAGGAATGAACAAGG - Intronic
1169732377 20:8800266-8800288 GTGAATTTGCTGCATGAATATGG - Intronic
1170256240 20:14347347-14347369 AGGAATTTGCTGAATTATAGAGG + Intronic
1170513010 20:17098295-17098317 AGGATTTGGCTGAATTCAGATGG - Intergenic
1172328322 20:34054950-34054972 AGGAATTTTCTAAATGAAAATGG - Intronic
1172654332 20:36527823-36527845 TAGATTTTGCTGAAGGAAGAAGG - Exonic
1172930712 20:38584394-38584416 AGGAGTTTGCAGAAGGATGAAGG + Intronic
1174969962 20:55264060-55264082 GGTAATTTACTGAATGATGATGG + Intergenic
1175163949 20:57029844-57029866 AGGAAATTGCTGCATGCAGAGGG + Intergenic
1175385612 20:58593065-58593087 AGATGTTTGCTGAATGAAGGAGG + Intergenic
1176375457 21:6084974-6084996 AGGAACTTGCTGACAGCAGAAGG + Intergenic
1176815497 21:13597166-13597188 ATGAATTTGCTGAAAGGAGTTGG + Intergenic
1176819020 21:13638299-13638321 AGGAATATACTTAATGAAGGAGG - Intronic
1177449996 21:21253945-21253967 AGGAATTTTCAAAATGCAGAGGG + Intronic
1178573653 21:33764684-33764706 AGGAAATTTCAGAATTAAGAAGG + Intronic
1179022483 21:37652764-37652786 TGGAATTTTCTGCAGGAAGAGGG + Intronic
1179748017 21:43453270-43453292 AGGAACTTGCTGACAGCAGAAGG - Intergenic
1180476820 22:15718459-15718481 AGGAATATGCTCAATGAAAAAGG - Intronic
1181362719 22:22350744-22350766 AGGAAATTCTTGAAGGAAGAAGG + Intergenic
1181565574 22:23735080-23735102 GGGAATTTGCCCAAGGAAGAAGG + Intergenic
1182063980 22:27417393-27417415 AGGTATTTGCTGAAGGAAGGAGG + Intergenic
1183105011 22:35609387-35609409 AGGGATTTGCAGAGAGAAGATGG + Intronic
1183196978 22:36360299-36360321 AGCAATTTGCAGAGGGAAGAGGG + Intronic
1183957529 22:41390453-41390475 ATGACTTTGCTGGAAGAAGAGGG - Intronic
950429753 3:12944000-12944022 AGGAAGAGCCTGAATGAAGAGGG + Intronic
950586159 3:13894133-13894155 AGAAATTTGCTAAAGGGAGAAGG - Intergenic
951277550 3:20707151-20707173 AGGATTTTGCTAAATGAAAAAGG - Intergenic
951723144 3:25723417-25723439 AGGAATTTTCTGTATAAATAGGG - Intronic
951792972 3:26507034-26507056 ATGAATTTTCTTAATGAGGATGG + Intergenic
951799880 3:26584096-26584118 AGGAAATTGATGTATAAAGAAGG + Intergenic
951849626 3:27124691-27124713 AAGAATTAGCTGAAGGAAAACGG + Intronic
953527675 3:43707523-43707545 AGGCATTTGCAAAATGAAGTTGG - Intronic
954722661 3:52578805-52578827 AGGAGTTTACTGTATGAAGTAGG + Intronic
955128540 3:56139798-56139820 ACGAATTTGCTTAAAAAAGATGG + Intronic
955145410 3:56313421-56313443 AAATATTTGCTGAATGAAAATGG - Intronic
955723919 3:61912339-61912361 AGGAATTTGCATAATGAAGAGGG + Intronic
955891808 3:63658193-63658215 AGGAATTTGCTGAATGTTCCAGG - Intronic
956319264 3:67977923-67977945 AGAGATTTGCTGAATGAACCTGG - Intergenic
956360337 3:68440586-68440608 AGGCATTTGCTGAAGGCAAAGGG - Intronic
958000876 3:87747347-87747369 AGGGATTTGTTTAAAGAAGAAGG + Intergenic
958486877 3:94723812-94723834 GGGAAGTTGCTGTATCAAGAGGG + Intergenic
959373382 3:105557951-105557973 AGCAATTTCTTGATTGAAGAAGG - Intronic
960163863 3:114380061-114380083 AGATATTGGCTGAATGAAAATGG + Intronic
960505224 3:118485761-118485783 AGGACTTTCTTTAATGAAGAAGG + Intergenic
960547705 3:118935501-118935523 AAGAATTTGCACAAGGAAGATGG + Intronic
960614064 3:119580781-119580803 AGGAATTGGCTGAAAGAGGGGGG + Intronic
960647086 3:119897927-119897949 AAATATTTGCTAAATGAAGATGG + Intronic
960811706 3:121632718-121632740 AGGAGATTGAAGAATGAAGATGG - Intronic
962057015 3:131883277-131883299 AGCAATTGGGTGAATGATGATGG - Intronic
962549635 3:136476436-136476458 TGGAACTTGCTCAATGAATATGG + Intronic
963671475 3:148257504-148257526 AGGAAAGTGCAGAGTGAAGAGGG - Intergenic
963921415 3:150909515-150909537 TGGAATTTCCTGAGTGATGAAGG + Intronic
964084522 3:152799881-152799903 AGAAATTGGCTGTATGAAGGTGG + Intergenic
964956981 3:162371747-162371769 TGGTATATGCTGAATGAATATGG + Intergenic
965527964 3:169741368-169741390 AGGAATTTTTTTAATGAAAATGG + Intergenic
966278567 3:178204705-178204727 AGGAATAGGCTGGATGAAAAAGG + Intergenic
968955592 4:3717259-3717281 GGAAATTTGCTGTATGAAGCAGG + Intergenic
970580580 4:17470946-17470968 AGGAGTTAGCTGAATCAAGGTGG + Intronic
971311510 4:25529455-25529477 AGGAATTAGCCAGATGAAGAAGG + Intergenic
971461042 4:26896970-26896992 AGTATTATGCTGAATGAAAAGGG - Intronic
972458498 4:39277057-39277079 AGAAATTTGCAGAATGGACATGG - Exonic
972523743 4:39887141-39887163 AGTAATTTGTTGAATAAAGGTGG + Intronic
972982171 4:44718586-44718608 CAGAATTTGCTGAATAAAGCTGG + Intronic
973934271 4:55827301-55827323 AGAAGTTAGCAGAATGAAGATGG - Intergenic
975640672 4:76496759-76496781 AAGAATTGACTGAATGAGGAAGG - Intronic
975911037 4:79267132-79267154 ATGAATTTGCTTCAGGAAGAAGG - Intronic
976385009 4:84446935-84446957 TGAAATTTGCTGAATGAGCAAGG - Intergenic
976888552 4:90015759-90015781 AGGAATTTACCAAATGAGGAAGG - Intergenic
977530328 4:98193318-98193340 AGGAATTTGCTGATTGTGGGTGG - Intergenic
977580027 4:98714728-98714750 AGAAACCTACTGAATGAAGATGG + Intergenic
978263556 4:106793735-106793757 GGGAATTTGGAGAATGGAGATGG + Intergenic
978806693 4:112808338-112808360 AGGAAATGGCTGAATAAAGTGGG + Intergenic
979097168 4:116565164-116565186 AAGAATTTGCTTTATGAATATGG - Intergenic
979284902 4:118911800-118911822 GGGGAGTTGCTGAATGAAAATGG - Intronic
979567375 4:122169957-122169979 ATGAATTTGTTTAATGTAGATGG + Intronic
980469958 4:133238750-133238772 AGGAATGTGTGGACTGAAGAAGG - Intergenic
981028232 4:140097595-140097617 AGGAATGTACTGAAGGAAGACGG + Intronic
982659232 4:158187337-158187359 TGGAACTTGCTGAAACAAGATGG + Intergenic
982684989 4:158477445-158477467 AGGAATTTACTGACTGAGGAGGG + Intronic
984097167 4:175447830-175447852 AGGAAAGTGCTGAAAGGAGAAGG + Intergenic
984283308 4:177698562-177698584 ATGAATTTGTTGAATGAGAAAGG - Intergenic
984883197 4:184428353-184428375 AGGAATTTGGAGAAGGAAGAGGG + Intronic
986575565 5:9209045-9209067 ATGAATTTGCTGATTCAAGTAGG + Intronic
986807231 5:11319309-11319331 AAGTATTTGTTGAATAAAGAAGG + Intronic
987706765 5:21468898-21468920 AGGAATTGGCTGAAAAAACAGGG + Intergenic
988322134 5:29712542-29712564 AGGGAAATGCTGAATGAAAACGG + Intergenic
989070539 5:37506432-37506454 AGGACTTTGGTCAATTAAGAAGG + Intronic
989204017 5:38793723-38793745 AGGAATTAGCCAGATGAAGAAGG - Intergenic
989316304 5:40082822-40082844 AGGAATTCGCTGTATGAATTTGG + Intergenic
990189826 5:53247241-53247263 AGGAATTAGATCAAGGAAGAAGG - Intergenic
991347725 5:65687712-65687734 AGGAATTAACTGAATGACAATGG + Intronic
992264739 5:75007385-75007407 AGGAGTTTGCTTAATAAAAAAGG + Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
993434098 5:87870218-87870240 AAGAATTGCCTGAATGAAGGTGG + Intergenic
995174376 5:109158012-109158034 AGGATTTAGCTAGATGAAGAAGG + Intronic
995625044 5:114067092-114067114 AGAAATGTGCTAAATGAAGATGG + Intergenic
995903699 5:117098471-117098493 AACAATTTGCTGAAGGAAGAAGG - Intergenic
996460923 5:123742080-123742102 AAGAATTTTCTGAATCATGAGGG - Intergenic
997100520 5:130963600-130963622 AGGAATTTGCTGAACGATTATGG + Intergenic
997470917 5:134116191-134116213 AGAACTTTGCTGAAGGAAGGAGG + Intronic
998462757 5:142321743-142321765 TGGACTTTTCTGAATAAAGAGGG + Intronic
998687343 5:144543595-144543617 AAGAATTTGCTTCAGGAAGAGGG + Intergenic
1000028646 5:157382265-157382287 AGGAATTTGTTGAATTAGGATGG - Intronic
1000759597 5:165206030-165206052 AGGAGTTTGTTAAATGAAGGAGG + Intergenic
1000907138 5:166977239-166977261 AGGAGTTTGCTAGATGAAGAGGG + Intergenic
1001897562 5:175394476-175394498 AGGATTTTAATGAAGGAAGAAGG - Intergenic
1002430537 5:179201127-179201149 AGTCATTTGCTCAATGAAGCGGG + Intronic
1002663555 5:180806895-180806917 AGAAATTTGCTGGGTGAAGCTGG + Intronic
1002955821 6:1862640-1862662 AGGATATTGCTGAATGCAGCTGG - Intronic
1002978808 6:2113312-2113334 AGGAAGTTGCTGGATGAGGATGG - Intronic
1003700127 6:8454980-8455002 GGGAAGTTGGTGAATGAATAAGG - Intergenic
1004089904 6:12490203-12490225 GGAAATTAGCTGAATGCAGAGGG + Intergenic
1004431701 6:15550872-15550894 AGGAAGATGCTGCATGAGGAAGG + Intronic
1004593974 6:17081154-17081176 AGGAGATGGCTGGATGAAGATGG + Intergenic
1006254942 6:32823893-32823915 AGGAATTATCTAAAGGAAGAGGG - Intronic
1006795924 6:36732277-36732299 AGGGCTTTGCTGAGTGAACAAGG + Exonic
1008020285 6:46569095-46569117 AGGAATTAGCTAAACCAAGAAGG - Intronic
1008068903 6:47079500-47079522 AGTAATTCTCTGAAGGAAGAAGG + Intergenic
1008474003 6:51916802-51916824 ATGAATATGCTAAATGAAAAAGG + Intronic
1008592743 6:53010310-53010332 AGGAATTTCATGCATCAAGAGGG + Intronic
1009597013 6:65748368-65748390 AAGAATTTGCTTTATGAATATGG - Intergenic
1011204119 6:84873208-84873230 AGGCATTTGCTGAATGCACTTGG - Intergenic
1014580881 6:123136085-123136107 AGCAATTGGGTGAATGAAGTTGG + Intergenic
1014647053 6:123986909-123986931 TGTTATGTGCTGAATGAAGATGG + Intronic
1015201598 6:130587664-130587686 AGGCATTTGCCAAATGTAGAAGG + Intergenic
1016892768 6:149022791-149022813 AGGGACTTGCTGAAGGAAGGTGG + Intronic
1017152661 6:151294589-151294611 AGCAATTCACTGCATGAAGATGG - Intronic
1018662526 6:166101604-166101626 AGAAATTGGCTGAAAGAAAAGGG + Intergenic
1019196498 6:170286384-170286406 TGGGATTTGCTGACTGAAGCCGG - Intronic
1020410524 7:7887001-7887023 AGGATTTAGCTGGGTGAAGAAGG - Intronic
1020608913 7:10371187-10371209 AGGAATATACTTAATGAAGGAGG + Intergenic
1021905155 7:25326198-25326220 AGGAAATGGTTGCATGAAGAAGG + Intergenic
1022404161 7:30070998-30071020 ATGACTTTGCTGACAGAAGAAGG + Intronic
1022522002 7:31014418-31014440 AGGATGTTGCAGTATGAAGAAGG - Intergenic
1022642105 7:32196846-32196868 TGGAATTTGGTGACTGATGAGGG + Intronic
1022848217 7:34233184-34233206 AGGAATTTGCTTTATGAATCTGG + Intergenic
1022889133 7:34677772-34677794 AGAAATTTGCTCACTGGAGATGG - Intronic
1023677097 7:42642260-42642282 AGGAGTTTCCTGGTTGAAGAGGG + Intergenic
1026032878 7:66810053-66810075 AGAGATTTGCTGAATGAATGAGG - Exonic
1027512347 7:79098233-79098255 AGGACTTTGCTGAAGGTAAATGG + Intronic
1030308350 7:108042499-108042521 AGGAATAGGCTGAACTAAGAAGG - Intronic
1030779430 7:113581051-113581073 CAGAAATTGATGAATGAAGAGGG - Intergenic
1031130610 7:117829188-117829210 TGGAATTTGCTGCAGGAAGGAGG + Intronic
1031670806 7:124542431-124542453 AGGAATTTGGTTTCTGAAGATGG - Intergenic
1032233052 7:130093086-130093108 AGTCATTGGCTGAATTAAGATGG - Intronic
1033218033 7:139508301-139508323 ATGAATTTGTGGAAGGAAGAAGG + Intergenic
1036796231 8:11758480-11758502 AGGAATTTGAGGAGGGAAGAGGG - Exonic
1037321085 8:17643763-17643785 AAGAATTTGAAGAATGAAGTAGG + Intronic
1038962946 8:32541799-32541821 TGGCATTTGCTGTATGAATATGG + Intronic
1039409806 8:37343198-37343220 ATGATTCTGCTGTATGAAGAGGG - Intergenic
1039713311 8:40081502-40081524 AGGCATTTTCTGAATTAATATGG - Intergenic
1040087407 8:43359746-43359768 AGGAATATACTTAATGAAGGAGG - Intergenic
1040405090 8:47093201-47093223 AGGAATATACTTAATGAAGGAGG + Intergenic
1041450838 8:58005078-58005100 ATGATTTTGCTTAATGAGGAAGG - Intronic
1042490330 8:69390592-69390614 AAGAATTAGCTGGATGAAGAGGG - Intergenic
1042897187 8:73683884-73683906 AGGAATGTACCTAATGAAGAAGG + Intronic
1042949055 8:74182228-74182250 AAGGATTTGCTGAATCAAAAGGG - Intergenic
1042990133 8:74629989-74630011 AGGAATTCTCTGACTGAAGAAGG + Intronic
1043191972 8:77236591-77236613 AAAAATTTGCTGAATAAATAAGG - Intergenic
1043648325 8:82553086-82553108 AAAAATTTTCTGAATGAATATGG + Intergenic
1044334197 8:90958757-90958779 AGGAATTTGGTTAGTGAAGTGGG - Exonic
1044428535 8:92082299-92082321 AGGAATTTTCTACATGAACAGGG - Intronic
1044890448 8:96829456-96829478 TGGAATTCACAGAATGAAGATGG + Intronic
1046159176 8:110337403-110337425 TGGAATTTAATGACTGAAGATGG - Intergenic
1046986689 8:120396823-120396845 TGGAATTTTCTGAAGGAAGTTGG + Intronic
1047656056 8:126978649-126978671 AGTAATTTGCTGAACTAAGCAGG + Intergenic
1048229438 8:132622638-132622660 AGGACTTTGATCACTGAAGATGG - Exonic
1048683466 8:136873698-136873720 TGGAATGTGCTTCATGAAGAAGG + Intergenic
1049316199 8:141969713-141969735 AGAATTGTGCTGTATGAAGATGG - Intergenic
1049462358 8:142736014-142736036 AGGCATTTGCTGACAGAGGACGG + Exonic
1050473247 9:6015210-6015232 AGGAATTTGATAGATGAGGATGG - Exonic
1050771416 9:9206145-9206167 AGGAGTTTGCTCAAAGAACAAGG + Intronic
1050871446 9:10575861-10575883 AGGAATTAGCAGAAAGAAAATGG - Intronic
1053317731 9:37066441-37066463 AGGGAGTGGCTGTATGAAGAAGG + Intergenic
1053322108 9:37107882-37107904 AGGGAGTGGCTGTATGAAGAAGG + Intergenic
1054751512 9:68911984-68912006 AGGAATTTTCTGTAGAAAGATGG + Intronic
1054990652 9:71321764-71321786 AAGTATTTGCTGAATGAATAAGG - Intronic
1056741349 9:89258008-89258030 AGGAATTTGAGGATGGAAGAAGG + Intergenic
1057932606 9:99208637-99208659 ATGAATTTGCTGAATGTACCTGG + Intergenic
1057935999 9:99239459-99239481 AGGGATTTGCACAGTGAAGAGGG + Intergenic
1058274523 9:103023759-103023781 AGGAATTTGCACAATTAACAAGG + Intergenic
1058718233 9:107740785-107740807 AGGAATTGGCAGAGTGGAGATGG - Intergenic
1059052320 9:110939367-110939389 AGGTATTTGGTGAAGAAAGATGG - Intronic
1059397314 9:114044755-114044777 AGGAATATGCTTAATTAAGGAGG - Intronic
1059432287 9:114257463-114257485 AGGAATCTGCTGAATGAACAAGG - Intronic
1203528337 Un_GL000213v1:111201-111223 AGGAATATACTTAATGAAGGAGG + Intergenic
1203531861 Un_GL000213v1:152292-152314 ATGAATTTGCTGAAAGGAGTTGG - Intergenic
1186159738 X:6764365-6764387 GTGAATTTGCTGAGTGAAAATGG + Intergenic
1186903252 X:14081661-14081683 AAGAATTTGCACAATGAAAACGG - Intergenic
1187313788 X:18172701-18172723 AAAAATCTTCTGAATGAAGATGG + Intronic
1188491827 X:30745967-30745989 AGATATTTGCTGAATGAATACGG + Intergenic
1189112136 X:38302331-38302353 AGGGCTTAGCTGCATGAAGAAGG + Intronic
1189734498 X:44055928-44055950 AGGGCTGAGCTGAATGAAGATGG - Intergenic
1190390302 X:49924516-49924538 AGGAATTAGCTGAATTAATTTGG + Intronic
1192755579 X:74044228-74044250 AGGAATTTGCTTTATGAATCTGG + Intergenic
1193899543 X:87160948-87160970 TGCCATGTGCTGAATGAAGAGGG - Intergenic
1194269019 X:91786747-91786769 AAGAATTTCCAGAATTAAGAGGG + Intronic
1196521467 X:116678524-116678546 AGTAATTTACTGAGAGAAGAAGG - Intergenic
1197062599 X:122199298-122199320 AGGTGTTTGCTGAATGCAAAGGG - Intergenic
1197114090 X:122811470-122811492 AGGAAGTTGCAGAAAGAAGTTGG + Intergenic
1197405430 X:126042140-126042162 AGGTGTTTGCTGAATGCAAAGGG + Intergenic
1197469091 X:126845036-126845058 AGGAATGTTCTGAATACAGAGGG + Intergenic
1197516348 X:127434876-127434898 AGGAATTTGTTTTATGAATATGG + Intergenic
1198267826 X:135026507-135026529 AGGAATATACTTAATGAAGGAGG + Intergenic
1199557234 X:149122681-149122703 AGGAAATGGCAGAATGATGATGG - Intergenic
1200586234 Y:5007759-5007781 AAGAATTTCCAGAATTAAGAGGG + Intronic
1201553419 Y:15242888-15242910 ATGAATTTGCTGAGTGAAAATGG + Intergenic
1201587509 Y:15577236-15577258 AAGAATCTACTGAATGAATAGGG + Intergenic