ID: 1090457770

View in Genome Browser
Species Human (GRCh38)
Location 11:126864780-126864802
Sequence CCTCTAAAGCTGATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 3, 3: 12, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090457767_1090457770 -10 Left 1090457767 11:126864767-126864789 CCTTGAGTGCATGCCTCTAAAGC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1090457770 11:126864780-126864802 CCTCTAAAGCTGATGGAGCTAGG 0: 1
1: 1
2: 3
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090457770 Original CRISPR CCTCTAAAGCTGATGGAGCT AGG Intronic
904280559 1:29415452-29415474 GCTGCATAGCTGATGGAGCTGGG - Intergenic
912436566 1:109666347-109666369 CCTCTAGAGCTGCTGGGGCAAGG - Intronic
912554788 1:110508198-110508220 CCTCAGCAGCTGGTGGAGCTGGG + Intergenic
913318719 1:117574247-117574269 CCCCGAAGGCTGATGGAGCTGGG - Intergenic
913419548 1:118649871-118649893 CCTATGCAGCTGGTGGAGCTGGG + Intergenic
918093375 1:181316055-181316077 CCTCAGAATCTGCTGGAGCTCGG - Intergenic
920186039 1:204160059-204160081 CCCCTAACTCTGATGGAGCAGGG + Intronic
921281419 1:213571673-213571695 ACTCCAAAGCTGATGCATCTGGG + Intergenic
921584516 1:216931518-216931540 CCTCTAAGGCTGAGGCAGCAGGG - Intronic
923246203 1:232135168-232135190 GCTCTAAAGCTCAGGTAGCTGGG + Intergenic
923252050 1:232186455-232186477 CCTTTAAATCTGTTGGAACTAGG - Intergenic
1062809734 10:453841-453863 CCTACAAAGCTGTCGGAGCTGGG + Intronic
1064243390 10:13650520-13650542 CTGCTAAAGGTGATGGAGATAGG - Intronic
1067354061 10:45507709-45507731 CCTTTACAGCTGATGTAGTTTGG - Intronic
1067582908 10:47456786-47456808 CCTCTGAATCTCATGGAGCCAGG - Intergenic
1069859641 10:71462359-71462381 CCTCTAAAGCAGATGGCGGTGGG - Intronic
1071366181 10:84902731-84902753 ACTCTGTAGCTGAAGGAGCTGGG - Intergenic
1074966571 10:118496005-118496027 CCTCCACCGCAGATGGAGCTTGG - Intergenic
1077167163 11:1148894-1148916 CCTTTGAGGGTGATGGAGCTTGG + Intergenic
1079661922 11:23049011-23049033 CCTCTAAAACTGGTGGAACAAGG - Intergenic
1080095820 11:28405087-28405109 CAACAAAAGCTTATGGAGCTTGG + Intergenic
1080611039 11:33904109-33904131 CCTATAAGGCTGCTGGAGCTTGG + Intergenic
1081625045 11:44649768-44649790 CCTGTAAAGCTGTCTGAGCTTGG - Intergenic
1082773806 11:57230525-57230547 CATCTAAAGCTTATTGCGCTGGG + Intergenic
1084167692 11:67383669-67383691 CCTCCCAAGCTGCTGGAGCCTGG - Intronic
1086183071 11:83979201-83979223 TCTCTAAAGCTGAGGGAAGTAGG + Intronic
1088395108 11:109359192-109359214 CCTTTAAAATTGATGGTGCTGGG - Intergenic
1089679027 11:120109234-120109256 CCTCACAGGCTGTTGGAGCTGGG + Intergenic
1090457770 11:126864780-126864802 CCTCTAAAGCTGATGGAGCTAGG + Intronic
1091142198 11:133244800-133244822 CCTGTACAGCTGTTGAAGCTGGG + Intronic
1096541657 12:52311215-52311237 CTCCAAAAGCTGAAGGAGCTTGG - Intergenic
1100944599 12:99766829-99766851 TCTCTAAATCTGATGGAAATTGG + Intronic
1100961956 12:99972540-99972562 CATCAAGAGCTGATGGAGCTGGG + Intronic
1102962345 12:117100742-117100764 CCTGTGAAACTGATGGAGGTAGG - Intergenic
1103773830 12:123350428-123350450 CCTTTAAAGATGGTGGAGCCAGG - Exonic
1105943092 13:25169039-25169061 CCTCCAAAGCTGAAAGAGCCAGG - Intronic
1110263102 13:73508281-73508303 GCTCAAAGGCTGAAGGAGCTGGG - Intergenic
1115470511 14:33764051-33764073 CCTCTAAAGCTGAGGAAGACAGG + Intronic
1119607514 14:76033422-76033444 CCTCCAAAACAGACGGAGCTTGG + Intronic
1121718196 14:96091141-96091163 CCTCTAGAGCTGACAGAACTGGG - Exonic
1121864322 14:97348243-97348265 CCACTTAAGATCATGGAGCTGGG + Intergenic
1122296107 14:100706538-100706560 CCTGTGAAGGTGATGGGGCTTGG + Intergenic
1122616327 14:103020428-103020450 CCTCCACAGCTGCTGGAGCGCGG + Intronic
1123114640 14:105889184-105889206 CCTCTAAAGATGAGGGATCCAGG - Intergenic
1124377675 15:29139004-29139026 CCTGTAAGGGTGTTGGAGCTGGG + Intronic
1124392063 15:29268787-29268809 CCTTTCAAGAGGATGGAGCTGGG + Exonic
1124498661 15:30206951-30206973 CCTACAAAGCTGGGGGAGCTGGG + Intergenic
1124744920 15:32331725-32331747 CCTACAAAGCTGGGGGAGCTGGG - Intergenic
1125770067 15:42159329-42159351 CCACTAAAACTGTTGGTGCTGGG + Exonic
1126634712 15:50769076-50769098 CCTTAAAAGCGGATGGATCTGGG + Intergenic
1127142858 15:55994322-55994344 CCTCTAAACCTGCTTTAGCTGGG + Intergenic
1133283325 16:4679316-4679338 CCTCTTATGCTGAGTGAGCTGGG + Intronic
1133518164 16:6530212-6530234 CCTCTAGATCTGATGGAGTTTGG + Intronic
1134221818 16:12360958-12360980 TCTCTAGAGCTGGTGTAGCTTGG - Intronic
1135849919 16:25953861-25953883 CCTTGAAAGGTGAGGGAGCTGGG + Intronic
1139681818 16:68570938-68570960 CCTCAGATGCTGAAGGAGCTGGG + Intronic
1139789864 16:69424880-69424902 CCTCTGAAGCTGCTGGGGCGAGG + Intronic
1141560303 16:84863437-84863459 CCTCTAACGGAGATGGAGCAGGG + Intronic
1143089113 17:4438273-4438295 CGTCTGAAGCTGGGGGAGCTGGG - Intronic
1146329406 17:31915494-31915516 CCTAAAAAGTTGATGGAACTAGG - Intergenic
1146568265 17:33931790-33931812 GCTCTGAAACTGATGGAGCCTGG - Intronic
1148085558 17:44991814-44991836 CTTCTGAAGCAGGTGGAGCTGGG - Intergenic
1150932901 17:69604308-69604330 CCTCTAAAGGTGCTGGAGGAAGG + Intergenic
1153483827 18:5575235-5575257 CCTCAATAGCTGATATAGCTTGG + Intronic
1160591511 18:79947491-79947513 CCTCCAAAGCTGTTGGGGCATGG - Intronic
1160907625 19:1459074-1459096 TCTGTGAATCTGATGGAGCTAGG + Intronic
1161041946 19:2115018-2115040 CCTCTGAAGCTGCTGGCCCTGGG + Intronic
1161043945 19:2124449-2124471 CTTTTAAAGCTGTTAGAGCTGGG - Intronic
1163258172 19:16170358-16170380 CTTCTAAAGCAGATGGAGTTGGG + Intronic
1163800015 19:19358979-19359001 CCTCATATGCTGATGGAGCATGG - Intergenic
925027858 2:623748-623770 CCTCTAAAGCAAATGGAGGATGG + Intergenic
926376687 2:12236183-12236205 CATCTAAAGTTGATAGAGCCTGG - Intergenic
927132337 2:20071373-20071395 CATCTCTAGCCGATGGAGCTGGG - Intergenic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
931374875 2:61697877-61697899 CCTCCCAAGGTGATGGAACTAGG - Intergenic
931470769 2:62536016-62536038 ACCCAAAGGCTGATGGAGCTGGG + Intergenic
932315458 2:70778945-70778967 ACTCTAAAGCTGAGTGAGCAAGG - Intronic
936656189 2:114490349-114490371 CTTCTATAGCTGATGGAAGTAGG - Intronic
936989444 2:118346903-118346925 CCTGCAGAGCTGCTGGAGCTAGG - Intergenic
937368068 2:121279437-121279459 GCTCTAAAGCTGAGGGAGCTCGG + Intronic
938731259 2:134149810-134149832 CCTCTAAGGCTGAGGGGCCTGGG + Intronic
942143225 2:172998963-172998985 CCTCTAAAAGAGATGGAGATTGG + Intronic
943949138 2:194107008-194107030 CCTTTAAAGCTGAAAGACCTGGG + Intergenic
944031586 2:195240832-195240854 CATGTAAAGCTGATGGAGCCTGG + Intergenic
944279271 2:197876190-197876212 CCTCTGCAGGAGATGGAGCTAGG + Intronic
946232714 2:218302508-218302530 CCCCTGAAGCTGAAAGAGCTTGG + Intronic
946641855 2:221792441-221792463 CCTTTTAAGCTTATGGAACTGGG + Intergenic
947312206 2:228817375-228817397 CCCCTAAAGCAGATACAGCTTGG - Intergenic
1169770127 20:9190843-9190865 ACCCTGAAGCTCATGGAGCTTGG + Intronic
1171196262 20:23201858-23201880 CCTCTAAAGCAGATGAGGCGGGG + Intergenic
1171201597 20:23246443-23246465 CATGCAAAGCTGATGGAGCTGGG - Intergenic
1172973660 20:38891016-38891038 CCTCTAGGGTTCATGGAGCTGGG - Intronic
1174614780 20:51827461-51827483 CCTCTAGAACTGCAGGAGCTGGG + Intergenic
1178736970 21:35161264-35161286 CTTCTACAGAAGATGGAGCTTGG - Intronic
1179173119 21:38988464-38988486 CCTCTAGGGCAGATGGAGCCAGG - Intergenic
1182146286 22:27998788-27998810 CCTGTGAAGCTGGTGGTGCTTGG - Exonic
1183354450 22:37350841-37350863 CCTCCGAGGCTGATGGAGGTGGG - Intergenic
950665872 3:14494679-14494701 CCTCTGAGGCTGAGGGTGCTGGG + Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952872092 3:37909990-37910012 TCGCTAAAAATGATGGAGCTGGG - Intronic
954496766 3:50971938-50971960 CCTGTATAGGTCATGGAGCTGGG - Intronic
961230141 3:125299182-125299204 TCTCTGAAACTGATGTAGCTAGG + Intronic
962968466 3:140376284-140376306 CATCTATAGCTGATGGAGGTGGG - Intronic
964988166 3:162771135-162771157 CCACTTGAGCTGATGTAGCTTGG - Intergenic
967203846 3:187101473-187101495 GCTCTTTGGCTGATGGAGCTGGG + Intergenic
967771236 3:193335598-193335620 CCTCATAAGCTCATGGAGCAAGG + Intronic
968701987 4:2061674-2061696 CTTCTATAGCTGGAGGAGCTGGG + Intronic
969841993 4:9889475-9889497 ACTGTAAAGATGCTGGAGCTTGG + Intronic
973182677 4:47288825-47288847 CGTCAACAGCTGATGGAGCCTGG + Intronic
973862610 4:55080014-55080036 CTTTTAAAGCTGATAGAGATTGG - Exonic
974893121 4:67906519-67906541 CCCTTAAAGCAGATAGAGCTTGG - Intergenic
978563987 4:110062600-110062622 CCTCTCAAGCTAATGTAACTTGG - Intronic
979934628 4:126675785-126675807 ACTCAAGAGCTAATGGAGCTAGG - Intergenic
980441639 4:132855128-132855150 CCTCTCAAGCAGATGGAGTTGGG + Intergenic
981532049 4:145762588-145762610 CCTGACAAGGTGATGGAGCTGGG - Intronic
984134613 4:175920052-175920074 CCTCTAAAGGTGATGGAGCTTGG + Intronic
988833609 5:35010351-35010373 CCTCTGAAGGTGAGGGAGTTGGG - Intronic
991197825 5:63956974-63956996 ACTCTGAAGCTCATGAAGCTTGG - Intergenic
991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG + Intronic
991966362 5:72095551-72095573 CCTCTAAATCAGTAGGAGCTGGG - Intergenic
995192381 5:109331344-109331366 CCTTTAAAGCGGATGAAGATAGG - Intergenic
995658722 5:114456588-114456610 AGGCTATAGCTGATGGAGCTAGG + Intronic
998016063 5:138733343-138733365 CCTCCAAAGCTCAGGGAGCAAGG + Intronic
1003058032 6:2840894-2840916 CCACTAAAGCTGGGGTAGCTGGG - Intronic
1010369663 6:75092781-75092803 CCTCTAAATCTGATGGGAATGGG - Intronic
1011667146 6:89645278-89645300 CCTCTAAAGCTGATGAATTCTGG + Intronic
1012849385 6:104428713-104428735 CCTCTGCAGCTGATGGTTCTAGG - Intergenic
1017220379 6:151959548-151959570 CCTCAAAAGCTGGTGGAGGTAGG - Intronic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1023725127 7:43135414-43135436 ACACTAAATTTGATGGAGCTAGG + Intronic
1026622207 7:71959701-71959723 CCTCTTGTGCTGATGGAGTTGGG - Intronic
1028493631 7:91441061-91441083 CAGCTAAAGCTGAAGTAGCTGGG - Intergenic
1037982025 8:23261259-23261281 CCTCTTCATCTGATGGAGCCAGG + Exonic
1040055168 8:43051516-43051538 CCTCCAAATCTTATGGAGGTGGG + Intronic
1044235689 8:89827313-89827335 ACTCAAAAACTAATGGAGCTGGG - Intergenic
1047603466 8:126450660-126450682 CCTGTAAAGATGAGAGAGCTTGG - Intergenic
1047734832 8:127756004-127756026 GCTCTAGAACTGATGGAGATAGG - Intergenic
1048422870 8:134294538-134294560 GCTTTAAAGGTGATGGAGATAGG - Intergenic
1053173248 9:35905591-35905613 CTTCTCAAGCTCATTGAGCTCGG + Intergenic
1057635364 9:96759966-96759988 CCTCTAAAGATGATGAATTTAGG - Exonic
1061357039 9:130113787-130113809 CTTCTAAAGATGAGGGAGGTGGG - Intronic
1062336389 9:136071862-136071884 CCTTTGAAGCCAATGGAGCTGGG + Intronic
1190311648 X:49121129-49121151 TCTTTAAAGATGAAGGAGCTGGG + Intronic
1190775675 X:53550594-53550616 CCTATAAAACTAAGGGAGCTGGG + Intronic
1192001900 X:67159899-67159921 CCCCTAAAGCAGATACAGCTTGG + Intergenic
1192312126 X:70025800-70025822 CCTCTAAAGCTCATGCCTCTAGG + Intronic
1193999938 X:88415683-88415705 CCTATAAAGCTGTGGGACCTTGG - Intergenic
1194352351 X:92835692-92835714 CCTCTAAAGCTGATAAAGCTTGG + Intergenic
1196959953 X:120990587-120990609 CCTTTAAAGGAGATGGGGCTGGG + Intergenic
1198708820 X:139478988-139479010 TCTGTAAAGCTGATGGTTCTAGG + Intergenic
1199188080 X:144939792-144939814 CCTCTAAGCCTGAAGGAGCAAGG + Intergenic
1199849785 X:151717265-151717287 TCTCTAGAAATGATGGAGCTTGG + Exonic
1200660659 Y:5952430-5952452 CCTCTAAAGCTGATAAAGCTTGG + Intergenic