ID: 1090458467

View in Genome Browser
Species Human (GRCh38)
Location 11:126869393-126869415
Sequence CTGGAGACACTGCAGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 1, 2: 2, 3: 55, 4: 467}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090458467_1090458476 19 Left 1090458467 11:126869393-126869415 CCACTCTCCTGCAGTGTCTCCAG 0: 1
1: 1
2: 2
3: 55
4: 467
Right 1090458476 11:126869435-126869457 TTACTGGCACTGGAATTGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 220
1090458467_1090458475 18 Left 1090458467 11:126869393-126869415 CCACTCTCCTGCAGTGTCTCCAG 0: 1
1: 1
2: 2
3: 55
4: 467
Right 1090458475 11:126869434-126869456 GTTACTGGCACTGGAATTGCAGG 0: 1
1: 0
2: 1
3: 26
4: 275
1090458467_1090458477 30 Left 1090458467 11:126869393-126869415 CCACTCTCCTGCAGTGTCTCCAG 0: 1
1: 1
2: 2
3: 55
4: 467
Right 1090458477 11:126869446-126869468 GGAATTGCAGGGTCTATTTCTGG 0: 1
1: 1
2: 1
3: 11
4: 155
1090458467_1090458472 3 Left 1090458467 11:126869393-126869415 CCACTCTCCTGCAGTGTCTCCAG 0: 1
1: 1
2: 2
3: 55
4: 467
Right 1090458472 11:126869419-126869441 TCACCTCTGACATGAGTTACTGG 0: 1
1: 0
2: 0
3: 8
4: 97
1090458467_1090458474 9 Left 1090458467 11:126869393-126869415 CCACTCTCCTGCAGTGTCTCCAG 0: 1
1: 1
2: 2
3: 55
4: 467
Right 1090458474 11:126869425-126869447 CTGACATGAGTTACTGGCACTGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090458467 Original CRISPR CTGGAGACACTGCAGGAGAG TGG (reversed) Intronic
900829257 1:4952866-4952888 CTGGAGTCACCTCAGGAGTGTGG + Intergenic
900849483 1:5130934-5130956 TTGGAGAGAGGGCAGGAGAGGGG - Intergenic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
902038619 1:13475900-13475922 CTGGAGGCACTGCACCACAGTGG + Exonic
902263831 1:15247281-15247303 CTGGAGACTCCGCGGGAGCGCGG + Exonic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902395376 1:16129596-16129618 CAGGAAGCACTGCAGGTGAGGGG + Intronic
902837937 1:19058675-19058697 ACGGAGCCAATGCAGGAGAGAGG - Intergenic
903649043 1:24911961-24911983 CTGGAGCCACTGCCAGGGAGGGG + Intronic
903779790 1:25813979-25814001 CTGGAGGAACTGCAGGTGAGCGG + Exonic
904297146 1:29527294-29527316 CTGGTGACCCTGGAGGAGAAGGG + Intergenic
904340235 1:29829566-29829588 CTGGTGTCCCTGCTGGAGAGAGG - Intergenic
904432030 1:30470453-30470475 CAGAAGACACATCAGGAGAGGGG - Intergenic
904445490 1:30570342-30570364 CAGAAGCCACTGCAGGAGGGTGG + Intergenic
904591812 1:31619165-31619187 CAGGAGCCGCTGCAGCAGAGGGG - Exonic
905028849 1:34868350-34868372 CTGCAGACACTGCAGGCCAAAGG - Intronic
905266984 1:36761104-36761126 CTGGAGATGCTTCAGCAGAGAGG + Intergenic
906402008 1:45511406-45511428 CTGGGCACACTGCAAGAGAAAGG + Exonic
906716990 1:47977733-47977755 CAGGAGACATTGGAGGAGAGAGG + Intronic
906778294 1:48549528-48549550 AGGGAGAGACAGCAGGAGAGAGG + Intronic
906921089 1:50065042-50065064 CTGGAGACCATTCAGAAGAGTGG + Intronic
910162371 1:84287626-84287648 CTGAGGGCACTGCAGGAGACCGG - Intergenic
910195233 1:84633381-84633403 CTGGAGAGAGTGCAGCAGAGGGG - Intronic
910833530 1:91484254-91484276 CTGGGAGCACTGCAGGAGACTGG + Intergenic
912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG + Intergenic
912527864 1:110298060-110298082 CTGGAGGCACTGGAGTAGAGTGG + Intergenic
913078633 1:115361290-115361312 CTGGAGCCACTGCTGCAGAAGGG + Intergenic
913447075 1:118961035-118961057 CTATAGGAACTGCAGGAGAGTGG + Intronic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
914846483 1:151286587-151286609 CTGGAGGCTCAGCAGGAGACGGG + Exonic
915719469 1:157973725-157973747 AAGGAGACATTGAAGGAGAGTGG - Intergenic
916135205 1:161646655-161646677 CTGTGGACATAGCAGGAGAGTGG + Intronic
916428078 1:164700656-164700678 GTGGAGACCCTGCAGCAGATAGG + Intronic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917468653 1:175307283-175307305 ATGGAGAAACTGCAGCAGAGAGG + Intergenic
917742432 1:177973966-177973988 GTGGAGAGACTGGAGGAGAAGGG + Intronic
919472306 1:197994868-197994890 CTGAGGACATTTCAGGAGAGTGG + Intergenic
919895295 1:202005952-202005974 CTGCAGGCACTGCAGGGCAGCGG + Exonic
920125340 1:203689850-203689872 CTGAAGGCATTGCAGGGGAGGGG + Intronic
920299796 1:204981754-204981776 CTGGAGAGGCTGCCAGAGAGGGG - Intronic
920659954 1:207907278-207907300 CTGGAGTCATAGCAGGACAGTGG - Intronic
920950973 1:210571386-210571408 CAGGAGAAACTGCAGGCAAGGGG - Intronic
920965260 1:210696019-210696041 CCAGAGAAACTGCTGGAGAGTGG - Intronic
920988337 1:210911872-210911894 GTGGAGAGATTGCAGGAGAGGGG - Intronic
921872153 1:220152655-220152677 CAGGAGCCACTACAGTAGAGTGG - Intronic
922383789 1:225060807-225060829 CAGCAGACACTGCAGAACAGCGG + Intronic
923015109 1:230120540-230120562 CAGGCGACACTGGAGGGGAGAGG - Intronic
924068862 1:240254921-240254943 CTTGTGACACAGCAGGTGAGTGG + Intronic
924383502 1:243483511-243483533 GAGGAGGCACTGGAGGAGAGAGG - Intronic
924728234 1:246689759-246689781 CTGCAGTCACTGTAGGAGCGGGG - Intergenic
1063800112 10:9566795-9566817 CTGGCGAGACTGCAGGAAAAAGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065814419 10:29471193-29471215 CTGGAAACACTGCAGGAAACAGG + Exonic
1067753213 10:48985418-48985440 CTGGGGAGACTGCAGGAGACAGG + Intergenic
1068146019 10:53071624-53071646 GGAGAGACACTGCAGGAGAAAGG - Intergenic
1068748346 10:60561756-60561778 GAGAAGACACTGCAGGAGAAAGG - Intronic
1069103084 10:64348029-64348051 CTGGAGCCACTGCAGGAAGATGG - Intergenic
1069348873 10:67502224-67502246 CCAGAAGCACTGCAGGAGAGGGG - Intronic
1070287320 10:75093343-75093365 GCAGAAACACTGCAGGAGAGAGG + Intergenic
1070877234 10:79825955-79825977 CGGGAGGCACTGCCGGGGAGGGG - Intergenic
1071264753 10:83954974-83954996 TTGAAGTTACTGCAGGAGAGAGG + Intergenic
1071643731 10:87341999-87342021 CGGGAGGCACTGCCGGGGAGGGG - Intergenic
1072617128 10:97057282-97057304 CTGGAGAAAAGGCAGCAGAGAGG + Intronic
1073060942 10:100733269-100733291 CAAGAGACAGTGCAGGACAGGGG + Intergenic
1073249127 10:102111145-102111167 CTGGAGGAAGTGAAGGAGAGAGG + Intronic
1073292116 10:102418575-102418597 CTGGTGGCAATGCAGGGGAGGGG + Intronic
1073606572 10:104901593-104901615 CTGGAGAGACTGTAGGTGAGGGG - Intronic
1074449544 10:113548003-113548025 CTGGAGTCCATGCAGTAGAGTGG + Intergenic
1074935247 10:118172138-118172160 CTGGAAAAACTGCAGAAGACTGG + Intergenic
1075274607 10:121081859-121081881 CTGGGGACACTGGAGGAGAGAGG + Intergenic
1076027059 10:127124064-127124086 CTGGAGACAGGGGAGTAGAGGGG + Intronic
1076062453 10:127424032-127424054 CTGGAGACCCTGTAGTTGAGTGG - Intronic
1078446313 11:11407660-11407682 CAGGAGGCACTGCAGGACAAGGG + Intronic
1079144740 11:17840634-17840656 CTAGGGAGACTGCAGAAGAGAGG + Intronic
1079343083 11:19629126-19629148 ATGGAGACACTGAGGCAGAGCGG - Intronic
1079427270 11:20355712-20355734 ATGTAGCCACTGCAGGAAAGAGG - Intergenic
1080070776 11:28083910-28083932 CTTCAGACACTTAAGGAGAGTGG + Intronic
1081574323 11:44309824-44309846 CTGGCGACACCCCTGGAGAGTGG - Exonic
1082115954 11:48328330-48328352 CTGAGGGCACTGCAGGAGACCGG + Intronic
1083429846 11:62608591-62608613 CTGTTGAAACTGCAGGAGATTGG - Exonic
1084173911 11:67413564-67413586 TGGGACACACTCCAGGAGAGGGG + Intronic
1084719611 11:70895926-70895948 CTGGGGAGACTGCACGTGAGGGG - Intronic
1085768230 11:79302751-79302773 CTGGAGACCCTATAGGAAAGTGG - Intronic
1086351408 11:85945608-85945630 CTGCTGACTCTGTAGGAGAGGGG + Intergenic
1087292742 11:96338324-96338346 CTGCAGACTCTGCAGCAGCGGGG + Intronic
1088923141 11:114276267-114276289 CAGGAGCCCCTGCAGGAGACAGG + Intronic
1089082504 11:115788547-115788569 TTGGCCACACTCCAGGAGAGGGG - Intergenic
1089809550 11:121120589-121120611 ATGGAGACAGTGCTGGAGAAGGG - Intronic
1090066666 11:123509777-123509799 CTGTAGTCACTGCAAGCGAGCGG + Intergenic
1090094446 11:123729614-123729636 CTCCAGACCCTGCAGGAGAGCGG - Exonic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1090586811 11:128222010-128222032 AAGGAGACAATACAGGAGAGAGG - Intergenic
1090632036 11:128657809-128657831 CTGGAGAGACTGTAGCAGTGGGG - Intergenic
1091326332 11:134691372-134691394 GGGGAGACACGGGAGGAGAGGGG - Intergenic
1091688459 12:2580013-2580035 CTGGAGCCCCTGCAGGCTAGAGG - Intronic
1091817191 12:3447482-3447504 CGAGAGGCACTGCGGGAGAGGGG - Intronic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092953238 12:13526867-13526889 CTGTAGAAAATGCAGCAGAGGGG + Intergenic
1093091763 12:14929312-14929334 CTGGAGAGACTGCAGGAGAGTGG - Intronic
1093484769 12:19640957-19640979 ATGGAGACGATCCAGGAGAGAGG - Intronic
1094503364 12:31039465-31039487 CTGGCAATACTGCAGAAGAGTGG - Intergenic
1095166079 12:38973644-38973666 CTGGAGGAATTGCTGGAGAGAGG - Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1096469196 12:51865582-51865604 CCGCAGACGCTGCAGGGGAGGGG + Intergenic
1096496325 12:52041411-52041433 CTGGAGCCCCTTAAGGAGAGTGG + Intronic
1096849891 12:54428734-54428756 CTGGGGAGACTGCTGGTGAGGGG - Intergenic
1098971712 12:76863973-76863995 CTGGAGAAGCTGCTGGGGAGAGG - Intronic
1099281044 12:80646585-80646607 CAGGAGACACTCGAGGAGAGTGG + Intronic
1100618535 12:96250051-96250073 CTGGACCCAGGGCAGGAGAGTGG + Intronic
1100620959 12:96272480-96272502 CTGGAGAAACGGCTGGAGAGTGG + Intergenic
1103316047 12:120056782-120056804 GTGGAGACCTGGCAGGAGAGTGG + Intronic
1103791748 12:123477017-123477039 CAGGAGAGACTGAAGCAGAGGGG + Intronic
1104283324 12:127398483-127398505 CTGCCCACACTGGAGGAGAGAGG + Intergenic
1104474882 12:129063174-129063196 CTGAAGACACTGCAGGTGCCAGG + Intergenic
1104964892 12:132504488-132504510 CTGGCGCCACTGCAGGGCAGTGG + Intronic
1105612288 13:21978872-21978894 CTGGAGAAAGTGCAGGTGAGTGG - Intergenic
1106763711 13:32893080-32893102 CTGGAGACACTGGAGGCAGGGGG - Intergenic
1106793024 13:33175509-33175531 CTGGAGAAACTGAATTAGAGAGG - Intronic
1111976117 13:94968379-94968401 CTGGAGACCCGGGAGGAGCGAGG + Intergenic
1112140687 13:96638408-96638430 ATGAAGAAACTGCAGTAGAGAGG - Intronic
1112213395 13:97404053-97404075 CAGGAGCCACTGCAGGAGACAGG + Intergenic
1112487175 13:99830469-99830491 TTGGAGACACTGGAGCAGTGTGG + Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113693072 13:112325722-112325744 GGGGAGCCACGGCAGGAGAGAGG - Intergenic
1114157293 14:20118959-20118981 CTGGGGACACTACAGGAGACTGG + Intergenic
1114266779 14:21076941-21076963 CTGAAGACATTCTAGGAGAGAGG + Intronic
1114307588 14:21437647-21437669 GTGTAGTCACTACAGGAGAGGGG - Intronic
1114438237 14:22726065-22726087 CTGGAGACACCGTGGGGGAGTGG - Intergenic
1115160032 14:30383606-30383628 ATGGAGACCATGCAGGAGTGAGG + Intergenic
1115197338 14:30815876-30815898 CTGGAGAGACTAAAAGAGAGTGG - Intergenic
1115431950 14:33329485-33329507 CTGGAGACAAAGCAGCCGAGGGG + Intronic
1115934050 14:38531525-38531547 ATGGAGGCAGAGCAGGAGAGGGG - Intergenic
1115972520 14:38961877-38961899 CTGGAGACAAGGCACGTGAGGGG - Intergenic
1118065381 14:62185076-62185098 CTGGAGATAGTCAAGGAGAGTGG + Intergenic
1118189521 14:63567868-63567890 CTTGAAACACTGGAGGAGAATGG - Intergenic
1118200277 14:63664706-63664728 CTGGAGTTAGTGCAGGAGGGTGG - Intergenic
1118471166 14:66076688-66076710 CTGGAGAAATGTCAGGAGAGAGG - Intergenic
1118808256 14:69256213-69256235 CTGGAGGCAAGGCAGGGGAGAGG - Intergenic
1118839649 14:69500919-69500941 CTGGAGATGCTGCAGGAGTCTGG + Exonic
1118842595 14:69524308-69524330 CAGCAGACACTGGAGGTGAGGGG + Exonic
1119483699 14:74975110-74975132 CAGGAGACACTGCCGGGAAGAGG - Intergenic
1119620747 14:76130279-76130301 CTTGAGAAACTGCTGGAGGGAGG - Intergenic
1120723680 14:87915198-87915220 CTGGAGTCACTGAAAGAGATGGG - Intronic
1121064296 14:90946924-90946946 CTGGGGACAATGGAGGAGAGAGG + Intronic
1121325637 14:93018134-93018156 CTGGAGGCACAGCAGAAGATGGG + Intronic
1121442032 14:93955544-93955566 TTGGAGACACTCCAGGAAAAGGG - Intronic
1121936867 14:98027935-98027957 CTGGTGATGCTGCAGGGGAGGGG - Intergenic
1122318540 14:100839742-100839764 CTGCAGACACTGCAGCAGGAGGG + Intergenic
1122651323 14:103228708-103228730 CAGGAGCCACTGCAGGAGTCAGG + Intergenic
1122872470 14:104646262-104646284 CTGGAGGCCCTGCATGTGAGTGG - Intergenic
1123506301 15:20943029-20943051 CTCCAGAGACTGCAGGAGAAGGG - Intergenic
1123563527 15:21516733-21516755 CTCCAGAGACTGCAGGAGAAGGG - Intergenic
1123599779 15:21954020-21954042 CTCCAGAGACTGCAGGAGAAGGG - Intergenic
1124004630 15:25785946-25785968 CTGGAGACACCTCCGGAGACCGG - Intronic
1125502501 15:40248330-40248352 CTGGACAGCCTGGAGGAGAGGGG + Intronic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1125953948 15:43776683-43776705 CTGGAGAAGGTGCAGGGGAGAGG - Intronic
1126176991 15:45745044-45745066 CAGGAGAGACAGCAAGAGAGGGG - Intergenic
1127385375 15:58462584-58462606 GTGGAAACAGAGCAGGAGAGGGG - Intronic
1128780920 15:70358155-70358177 CAGGAGACACTGAAGGAGACTGG + Intergenic
1129192254 15:73944362-73944384 CAGGAGACCCTCCAGGACAGAGG - Intronic
1130239716 15:82176075-82176097 ATGGTGACACTGCAGTACAGTGG + Intronic
1130595333 15:85245134-85245156 CAGGAGAGGCTGCTGGAGAGGGG + Intergenic
1131902875 15:97107927-97107949 CTGGAGTCCCTGAAGGAGATGGG + Intergenic
1132230481 15:100180105-100180127 GGGGAGACACTCCAGGACAGTGG - Intronic
1132307987 15:100831492-100831514 CTGTACACAGTGCAGGAGAGGGG - Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132413083 15:101600216-101600238 CTGCTGACACTGCAGGTGGGAGG + Intergenic
1202971885 15_KI270727v1_random:243870-243892 CTCCAGAGACTGCAGGAGAAGGG - Intergenic
1132496631 16:266467-266489 CTGGTGACCCTGCAGGCAAGAGG + Intronic
1133111478 16:3550489-3550511 CTGGAGAACCTGCAAGAGAAGGG + Exonic
1133953463 16:10418845-10418867 CTGGAAACACGGCAGTATAGTGG - Intronic
1134261805 16:12656929-12656951 TTGTAGGCACTGAAGGAGAGCGG - Intergenic
1134422568 16:14108014-14108036 CTGGACCCACTGCAGAAAAGGGG - Intronic
1136301161 16:29335238-29335260 TGGGAGACACTGTAGGAGGGTGG + Intergenic
1137370831 16:47904304-47904326 CTGGACACACTGAAGCAGAAAGG - Intergenic
1137840608 16:51637300-51637322 CTGGAGAAACTGCAGAGTAGGGG + Intergenic
1138446931 16:57070440-57070462 CAGGGGACAGAGCAGGAGAGGGG + Intronic
1139320312 16:66109218-66109240 CTGGGGACCCTGGAGAAGAGAGG - Intergenic
1140263587 16:73401292-73401314 CTGGAGACAGTGCGGGAAAAAGG - Intergenic
1140427651 16:74874409-74874431 CTGCAGCCACTGCCGGAGTGAGG - Exonic
1141064121 16:80900324-80900346 CTGGACCCACTGCAGGCGGGCGG + Intergenic
1141497332 16:84419251-84419273 CTGGAGCCTCTGCAGGAGCATGG - Intronic
1141698615 16:85632362-85632384 CTGGGGGCACTGCCTGAGAGAGG - Intronic
1143033953 17:3983822-3983844 CTGAAGTCACTGCAGGAGGTCGG + Intergenic
1143568543 17:7740078-7740100 CAGGAGAGAGTGCAGGGGAGGGG + Intronic
1144643096 17:16950164-16950186 TTGGAGACAGTGCAGGATAGTGG + Intronic
1145403626 17:22568315-22568337 CTCCAGAGACTGCAGGAGAAGGG + Intergenic
1145811237 17:27765534-27765556 CTGGAGGCCCTGGATGAGAGTGG - Exonic
1145882669 17:28363873-28363895 CTGGAGAGACCTCAGGAGACAGG + Intergenic
1145977471 17:28992719-28992741 GAGGGGACACTGGAGGAGAGAGG - Intronic
1146058257 17:29591777-29591799 CTGCAGCCAGTGCAGGGGAGGGG - Intronic
1146381836 17:32336100-32336122 TAGAAGATACTGCAGGAGAGAGG - Intronic
1146500782 17:33362664-33362686 GTGGAGACAATGCAGGAGTAAGG - Intronic
1147586051 17:41654558-41654580 CTCCAGACAGTGCAGGAGAAGGG - Intergenic
1149394601 17:56226729-56226751 TTGGAGAGAGTGCTGGAGAGAGG + Intronic
1149680777 17:58505584-58505606 CTGTAGACATGACAGGAGAGTGG + Intronic
1151663389 17:75531639-75531661 CTGGGGACAGGGCAGGAGACGGG + Intronic
1151887793 17:76933344-76933366 CTGGAGTGGCTGCTGGAGAGGGG - Intronic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152390877 17:80003011-80003033 CTGGGGATTCAGCAGGAGAGAGG + Intronic
1152589413 17:81204042-81204064 ATGGGGAGACTGCAGGAAAGGGG + Intronic
1152890654 17:82879941-82879963 CTGGAGACACCCAAGGAGACAGG - Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1154170203 18:12046071-12046093 CTCCAGAGACTGCAGGAGAACGG + Intergenic
1154172619 18:12062168-12062190 CTCCAGAGACTGCAGGAGAAGGG - Intergenic
1154485452 18:14868316-14868338 CTCCAGAGACTGCAGGAGAAGGG - Intergenic
1155801947 18:30116600-30116622 CTGGAGAGACTGAAGGACATTGG + Intergenic
1156848800 18:41701469-41701491 ATGGAGATAGAGCAGGAGAGAGG - Intergenic
1157327553 18:46679986-46680008 CAGGAGGGACAGCAGGAGAGGGG + Exonic
1157418803 18:47527591-47527613 CTGGAGACACTTTTGCAGAGAGG + Intergenic
1157475793 18:48022643-48022665 CAGGAGACACTGGTGGAGAGGGG + Intergenic
1158572940 18:58612113-58612135 CTGCAGACACTGCAGGGGAATGG + Intronic
1158958076 18:62561369-62561391 CAGGAGAAACTGGAGGTGAGTGG - Intronic
1159490595 18:69129143-69129165 CCGGAGAGACTGGAGGGGAGAGG - Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1159681149 18:71354207-71354229 CTGGAGGCTCAGCAGGAGAGTGG - Intergenic
1160246304 18:77162861-77162883 CTGGAGACACTGTGGGTGAAAGG + Intergenic
1161197752 19:2996473-2996495 CTGGAGACACCGCAGGAAAGGGG - Intergenic
1161206262 19:3042550-3042572 CTGGAGACTTTGAAGGACAGAGG + Intronic
1162116137 19:8430644-8430666 CTTCAGCCACTGCAGGGGAGAGG - Exonic
1162464660 19:10832542-10832564 GTGGGGCCCCTGCAGGAGAGGGG + Exonic
1164810920 19:31155129-31155151 ATGGAGACAGTGCAGGTGATTGG - Intergenic
1165100071 19:33434049-33434071 CTGGTGACAGAGGAGGAGAGGGG - Intronic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1165342556 19:35223432-35223454 CTGTCCACACTGGAGGAGAGGGG + Intergenic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1166300835 19:41911374-41911396 CTGGCAGCAGTGCAGGAGAGAGG + Intronic
1166342080 19:42144251-42144273 CTGGAGACACAGCAGTGAAGAGG - Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1167276551 19:48543562-48543584 CTGAAGCCACTGCAGGGAAGGGG + Intergenic
1168299087 19:55393147-55393169 CTGGAGGGACAGCAGGGGAGCGG - Intronic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
1168563721 19:57405070-57405092 TGGGAGAGACTGCAGTAGAGTGG + Intronic
925098263 2:1224544-1224566 CTTGGGACACTCCAGGTGAGGGG - Intronic
925276314 2:2650753-2650775 CTGGAGACCCTAGCGGAGAGGGG + Intergenic
925797906 2:7566760-7566782 GTGGAGACTCTGCAGCTGAGAGG - Intergenic
925993510 2:9272637-9272659 ATGGAGAAACTGCAGGACACTGG - Intronic
926976417 2:18520890-18520912 CTGAAGACACTGGAGGAGAAAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927363832 2:22270519-22270541 CATTAGACACAGCAGGAGAGAGG + Intergenic
928666903 2:33558696-33558718 CTGGAGTCACTGCTGGACACAGG + Exonic
929403312 2:41611168-41611190 CTAAAAACACTGCAGGAAAGGGG + Intergenic
929451690 2:42042354-42042376 CTGGAGACTCTACAGGGGAGTGG - Intergenic
929601600 2:43208007-43208029 GTGGAGAAACAGCAGAAGAGGGG + Intergenic
929693179 2:44091490-44091512 CTGGAGACTCTGCAGGACACGGG - Intergenic
929703361 2:44184586-44184608 GTGGAGATACTGCAGGAAGGTGG - Intronic
930058163 2:47267801-47267823 CTGGAAACAATGCAGGAAAGGGG + Intergenic
930641036 2:53854655-53854677 CTGAAGACCCTCCTGGAGAGAGG + Exonic
930854431 2:55997490-55997512 CTGTGGAAACTGCAAGAGAGAGG - Intergenic
932375633 2:71233233-71233255 CTGAAGGCACTGCAGTAGACCGG + Intergenic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
932722528 2:74148128-74148150 CTGGGGAGACTGAAGGAGAGCGG - Intergenic
932740297 2:74285894-74285916 CTGGGGACCCTGCAAAAGAGGGG + Exonic
934687695 2:96333794-96333816 CTGGAGAGGCTGCAGGGGTGGGG + Intergenic
935426653 2:102926005-102926027 CTGAAGACTCTACTGGAGAGGGG + Intergenic
936445119 2:112588938-112588960 CTGGCCACTCTGCAGGGGAGGGG - Exonic
936901228 2:117484336-117484358 CTCCAGAGAGTGCAGGAGAGAGG - Intergenic
937107426 2:119330663-119330685 TTGGAGATAGTGAAGGAGAGAGG - Intronic
937198063 2:120177658-120177680 CAGGAGACACTGCTGAACAGAGG + Exonic
937275931 2:120684118-120684140 CTGCCCACACTGCAGGGGAGGGG + Intergenic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
937595502 2:123666967-123666989 TTGAAGACAGTGAAGGAGAGAGG + Intergenic
937743775 2:125386854-125386876 CGGGAGACGGGGCAGGAGAGGGG - Intergenic
938018240 2:127885567-127885589 CGGGAGGCACTGCCGGGGAGGGG - Intronic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
938293005 2:130160239-130160261 CAGGAGCCACTGCAGAGGAGAGG - Intronic
938463552 2:131512726-131512748 CAGGAGCCACTGCAGAGGAGAGG + Intergenic
938524817 2:132119393-132119415 CTGGGAACACTACAGGAGACTGG - Intergenic
938630759 2:133164725-133164747 CCCGAGACACTGAAGGATAGGGG - Intronic
939596380 2:144128667-144128689 CTGGGGAAACTACAGTAGAGAGG - Intronic
939900868 2:147847719-147847741 CTGAAGGCACTCCAGGATAGGGG - Intronic
941547323 2:166868252-166868274 CTGGCCACACAGCAGGAGAGCGG + Intergenic
942444725 2:176070495-176070517 CTGGAGACCCTGCAGGGCACAGG + Intergenic
946203926 2:218089773-218089795 CAGGACACCCTTCAGGAGAGGGG + Exonic
946339317 2:219057981-219058003 CTGAAGACAGCACAGGAGAGAGG - Intronic
946419754 2:219558102-219558124 CTGGAGGCTCTGGAGAAGAGAGG + Exonic
946952524 2:224892690-224892712 CTGGAAACAGTGCAGGAGGGAGG + Intronic
947436849 2:230080306-230080328 CTGGAGAAACTGAACCAGAGAGG + Intergenic
947746915 2:232512599-232512621 CTGGAAACACTGCAGGGCTGGGG - Intergenic
948608354 2:239151006-239151028 TTGCAGAAACTGCTGGAGAGGGG - Intronic
948669693 2:239559873-239559895 CTGGGGTCACAGCAGGACAGTGG + Intergenic
948906643 2:240982830-240982852 CTGGAGACACTGGGGGTGGGAGG - Intronic
948920875 2:241065325-241065347 ATGGAGAGAGTGGAGGAGAGTGG + Exonic
1169194403 20:3675442-3675464 CAGGAGACACTGCCGAAGAATGG + Intronic
1169198344 20:3695097-3695119 ATGGAGCCTGTGCAGGAGAGTGG - Intronic
1169491140 20:6072266-6072288 CTGAAGACACTGCAGCACATGGG + Intergenic
1169938770 20:10914398-10914420 GTGAAGACACAGCAAGAGAGTGG + Intergenic
1170044933 20:12075017-12075039 TTTGAAACACAGCAGGAGAGAGG - Intergenic
1170046965 20:12095806-12095828 CTGGAGACACAGCAGTGAAGAGG - Intergenic
1170552331 20:17488730-17488752 CTGGGGACCCTTCAAGAGAGCGG - Intergenic
1170793904 20:19530174-19530196 ATGGAGACACAGCATGAAAGGGG + Intronic
1170805298 20:19624616-19624638 CTTTGGACACTGAAGGAGAGTGG - Intronic
1171902131 20:30867990-30868012 ATGGAGAGACTGCAGGGGACAGG + Intergenic
1173147107 20:40534465-40534487 CTGGTGACACAACATGAGAGGGG + Intergenic
1173781083 20:45758176-45758198 CAGGAGGCACTGCAGGACACAGG + Intronic
1173833775 20:46111589-46111611 CTGGAGACAGTGCAGGGGGTGGG + Intergenic
1173836234 20:46128088-46128110 AGGGAGAAACTGCAGGTGAGGGG + Intronic
1173872362 20:46350140-46350162 CTGGAATCGCAGCAGGAGAGGGG - Exonic
1173949695 20:46980370-46980392 GAGGAGACAATGGAGGAGAGAGG - Intronic
1174482775 20:50842887-50842909 GTGGAGACAGGGCAGTAGAGGGG - Intronic
1175401964 20:58706156-58706178 GTGTGGACACTGCAGGAGAAGGG + Intronic
1175750820 20:61495943-61495965 AGGGACACACAGCAGGAGAGAGG + Intronic
1175877602 20:62237897-62237919 CTGGAGCCACTGTAGGTCAGTGG + Intronic
1176076754 20:63252109-63252131 ATGGAGACCCTGCAGCACAGAGG + Intronic
1176795884 21:13371161-13371183 CTCCAGAGACTGCAGGAGAAGGG + Intergenic
1177540604 21:22488957-22488979 CTGCAAACACTACTGGAGAGGGG + Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179141812 21:38732498-38732520 CAGGAGAGAGTGCAGGTGAGGGG - Intergenic
1179516089 21:41907965-41907987 GTGGAAACGCTGCAGGACAGAGG + Intronic
1180079542 21:45480506-45480528 CTGGAGGCCCTGCGGGTGAGTGG + Exonic
1180335507 22:11573925-11573947 ATGGAGAGACTGCAGGGGACAGG + Intergenic
1180840782 22:18957920-18957942 CTGAAGACAGTGCAGGAGACCGG - Intergenic
1180847331 22:18991071-18991093 CCAGGGACACTGCAGGACAGTGG - Intergenic
1181060704 22:20280854-20280876 CTGAAGACAGCGCAGGAGACCGG + Intronic
1181140004 22:20797403-20797425 CTGGGGACACTCCTGGAGAAAGG + Intronic
1181276104 22:21688373-21688395 TTGGAGAGGCTGCAGGAGGGAGG - Intronic
1182085896 22:27561019-27561041 CTGGTGTCACTGCAAGGGAGTGG + Intergenic
1182360246 22:29742287-29742309 CTGGAGCCACTGCTGCAAAGTGG + Intronic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1183041046 22:35178270-35178292 CTGGGGACACGGCAGTAGAGGGG - Intergenic
1183328865 22:37208766-37208788 CTGGAGACTCCACAGGGGAGGGG - Intronic
1183499180 22:38168226-38168248 CTGGAGACACTGGAGGTGCTTGG + Intronic
1183538175 22:38415200-38415222 CTGGGGGCACTGCAGGTGCGAGG + Intergenic
1184131667 22:42520110-42520132 ATGGGAAGACTGCAGGAGAGGGG + Intergenic
1184141884 22:42582325-42582347 ATGGGTAGACTGCAGGAGAGGGG + Intergenic
1184437831 22:44490334-44490356 CTGGAGCAGGTGCAGGAGAGAGG + Intergenic
1185226736 22:49657737-49657759 CTGGAGCTCCTGCAGGAGACTGG - Intergenic
950427365 3:12931725-12931747 CTGGAGCTACTGCAGAAGGGAGG - Intronic
950546570 3:13641524-13641546 CTGGGGCCACTGCAGCAGATAGG + Intergenic
950552687 3:13676240-13676262 CTCGGGACACTCCAGGGGAGGGG - Intergenic
951740502 3:25917058-25917080 CTGGTGACACTGAAGGGGAAGGG - Intergenic
951810143 3:26689609-26689631 ATGGAGAAAGAGCAGGAGAGAGG - Intronic
952929739 3:38349806-38349828 GTGAAGACACAGCAAGAGAGTGG - Intronic
953024897 3:39139154-39139176 CTGGAGACCAGACAGGAGAGGGG - Intergenic
953473134 3:43183607-43183629 CTGGAAACACTTTAGGATAGAGG - Intergenic
953509233 3:43518719-43518741 CTGGGGGCACTACAGGAGACCGG - Intronic
953532277 3:43749389-43749411 TCGGAGACACTGCGAGAGAGAGG - Intergenic
954082812 3:48222357-48222379 CAGGAGGGACAGCAGGAGAGTGG + Intergenic
954146731 3:48638128-48638150 CAGGAGAGACTCCAGGAGTGGGG - Exonic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
956517359 3:70063709-70063731 CAGGAGACAGTACAGGAGAGTGG + Intergenic
956636120 3:71367233-71367255 AAGGAGCCTCTGCAGGAGAGAGG - Intronic
956781746 3:72608737-72608759 CTGAAGAGACTGATGGAGAGGGG + Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
960150008 3:114239724-114239746 CTGGAGAGAGTTCAGGAAAGAGG + Intergenic
960944525 3:122957031-122957053 CTGGAGAAGCTGGTGGAGAGAGG + Intronic
961047371 3:123718860-123718882 CTGGGGAAACTGCAGTAGACAGG - Intronic
961330477 3:126135307-126135329 CAGGAGACATTTCAGCAGAGTGG - Intronic
961373355 3:126446190-126446212 CTGGAGAATCTGCAGGAGTGGGG + Intronic
961490558 3:127254210-127254232 CTGGAGACACTGCTGAAAAGGGG + Intergenic
961742371 3:129040774-129040796 CTGGGGAAACTGCAGGAGTCAGG + Intergenic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
963043195 3:141083914-141083936 CTGGAGGCCCTGCAGGGTAGAGG + Intronic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
963110380 3:141683330-141683352 CTGGTAACACTGCAGGATACTGG + Intergenic
963534646 3:146512721-146512743 CTAGAGACAGTAAAGGAGAGAGG + Intergenic
964117782 3:153154831-153154853 CTGGAGCCACTGCTGCAGAAGGG + Intergenic
966948569 3:184795658-184795680 CTGGAGACAGTGAGGGGGAGGGG - Intergenic
967805195 3:193709588-193709610 GAGTAGACAGTGCAGGAGAGGGG - Intergenic
968502137 4:955732-955754 CTGGGGACACGCCAGGAGGGTGG - Intronic
968704285 4:2070831-2070853 CTGGTGCCACTGCAGGAGGCCGG - Intergenic
968860010 4:3160366-3160388 CTGGCCACACTGCAGGACATTGG + Exonic
970478828 4:16452303-16452325 ATGAAGACACAGCAGGAAAGGGG - Intergenic
971415798 4:26427695-26427717 TTGGAGAGATTGCAGGAGATTGG + Intronic
972444992 4:39135472-39135494 CTGGAGACATTGCAGAAGGAAGG - Intergenic
972766217 4:42153731-42153753 CTGAGGAAGCTGCAGGAGAGAGG - Intergenic
973550623 4:52032079-52032101 CTGGACACACTGGACCAGAGAGG - Intronic
974402751 4:61426456-61426478 CTGCTGACTCTGTAGGAGAGGGG - Intronic
974517648 4:62937758-62937780 CTGGAGACATTGCAGGCAATTGG - Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976358835 4:84153669-84153691 CTGGAGGGACTGAAGTAGAGAGG - Intergenic
976563833 4:86531493-86531515 CTCGACCCACTGCAGGAAAGAGG + Intronic
977446973 4:97143084-97143106 CTGGTGCCACTTCAGGAGAACGG - Intergenic
977586867 4:98783808-98783830 CAGGACACACAGCAGCAGAGAGG + Intergenic
977691655 4:99918625-99918647 CTGAAGACACTCAAGGGGAGGGG + Intronic
979004019 4:115265763-115265785 CTGGTGACATTTCAGGAGAGCGG + Intergenic
979972173 4:127149002-127149024 CTAGAGACACTGCAGCATGGTGG - Intergenic
980845330 4:138317353-138317375 CTTGAGACAGTGCAGGATGGGGG - Intergenic
980892875 4:138833512-138833534 GTGGAGAGAGAGCAGGAGAGAGG - Intergenic
981951488 4:150414260-150414282 CTGGAAACAATGCAGGGGAGTGG - Intronic
985016722 4:185643647-185643669 CTGAGTCCACTGCAGGAGAGGGG + Intronic
985310115 4:188588621-188588643 CAGGAGGCTCTTCAGGAGAGAGG + Intergenic
985615275 5:916383-916405 CTGGGGACAGTGCAGGGGAGGGG - Intronic
985743472 5:1633675-1633697 CTGGGGACACGGCAGGTGACGGG + Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986029964 5:3884433-3884455 CGGGAGACACTGAAGAACAGAGG - Intergenic
986355030 5:6915595-6915617 CAGGAGCCACAGCAAGAGAGAGG + Intergenic
988065763 5:26227909-26227931 CTGGAGACCCTGGAGGAGCTGGG - Intergenic
989439456 5:41453429-41453451 GTGGAGAAACTTCAGGTGAGTGG - Intronic
989719569 5:44508563-44508585 GAGGAAACCCTGCAGGAGAGTGG - Intergenic
990510215 5:56482557-56482579 CTGGAAACACTGTAGCAAAGAGG - Intergenic
990591616 5:57271176-57271198 CTGGTGACACAGCAGGAGCCAGG + Intergenic
993616934 5:90124507-90124529 CTGGGGACAGGGCAGTAGAGTGG + Intergenic
994510391 5:100696066-100696088 ATGGAGTGACAGCAGGAGAGTGG - Intergenic
995063543 5:107837000-107837022 ATGGAGACAGAGTAGGAGAGAGG - Intergenic
995729573 5:115223549-115223571 CTGGAGACACTGTTGGCGAAAGG + Intronic
996086203 5:119308222-119308244 CTGGAAAACCTGCAGGAAAGAGG - Intronic
997360397 5:133291146-133291168 CAGGAGACACAGGAGGGGAGGGG + Intronic
997675980 5:135713827-135713849 CTGCAGCCAGTGCAGGAGGGAGG - Intergenic
999144607 5:149383900-149383922 CTGGATGCTCTGCAGAAGAGAGG - Intronic
999170085 5:149586589-149586611 CTGGATACACAGCATCAGAGTGG - Intronic
1000863527 5:166485273-166485295 GTGGAGACAGTAAAGGAGAGTGG + Intergenic
1001955912 5:175848085-175848107 AAAGAGACACTGCAGGAGATGGG + Intronic
1002593639 5:180307641-180307663 CTTGAGACACAGCAGGAAAGAGG - Intronic
1002639053 5:180621999-180622021 CTGGGGCCCCTCCAGGAGAGAGG - Intronic
1004167847 6:13272590-13272612 CTGGGGCCACTGGAGGAGATGGG + Intronic
1004258840 6:14089892-14089914 CTGGAGGCCAGGCAGGAGAGAGG - Intergenic
1006144475 6:31950263-31950285 CTGGGGACACAACAGTAGAGAGG - Intronic
1006190043 6:32202037-32202059 CTGGAGCCAGGGAAGGAGAGGGG - Intronic
1006520517 6:34568572-34568594 CTTGAGTCACTTCAGGGGAGTGG - Intergenic
1007072873 6:39049331-39049353 GGGGAGGCACTGCGGGAGAGGGG - Intronic
1007630580 6:43270951-43270973 GTGAAGACACAGCAGAAGAGAGG + Intronic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1010492976 6:76496063-76496085 CTGGGGGCACTACAGGAGACTGG + Intergenic
1011441436 6:87391349-87391371 ATGGAGCCACTGCAGGAAGGAGG + Intronic
1011557960 6:88588769-88588791 TGGGAGACATTGCAGGAGATGGG + Intergenic
1011628644 6:89303252-89303274 GTGTAAACACTGCAGGAGGGTGG - Intronic
1012512860 6:100024735-100024757 CTGGAAACTCTCCTGGAGAGGGG - Intergenic
1012590899 6:100979316-100979338 CTAGAGTGACTGCAGGAGAAAGG - Intergenic
1013592303 6:111629431-111629453 GGGGAGACACTGCAGGAGGAAGG - Intergenic
1015673140 6:135713670-135713692 CTGGAGACTCGGAGGGAGAGTGG - Intergenic
1015988894 6:138914714-138914736 TTGGAGGCACTGCAGGAGGATGG + Exonic
1016597407 6:145816862-145816884 TAGGAGATACTGCAGGAGAAAGG - Intergenic
1017184792 6:151589850-151589872 CAGGAGAAATTGCAGGGGAGAGG - Intronic
1018066957 6:160131230-160131252 CAGGCGCCACTGCAGGAGACAGG + Intronic
1018090834 6:160346460-160346482 TTGGAGACAAAGCAGGAAAGGGG + Intergenic
1018246950 6:161832813-161832835 CTGGAGACCCTGCAGGGCACAGG - Intronic
1018632097 6:165830253-165830275 CTGGAGACAGTGCGGGACAGAGG - Intronic
1018888504 6:167962743-167962765 CTGGAGACAGTCCAGAAGAGAGG - Exonic
1019439982 7:1041122-1041144 ATGGAGAGACTGCAGGAGGGAGG + Intronic
1019450855 7:1097033-1097055 CGGGAGACAGGGCAGGCGAGGGG + Intronic
1019737439 7:2657688-2657710 CTTGAGCCACTGCACGTGAGGGG + Intronic
1021139279 7:17003827-17003849 CTGGGAACACTACAGGAGACCGG + Intergenic
1022325481 7:29327139-29327161 GTGGAGATAATGCTGGAGAGAGG + Intronic
1024192087 7:47022686-47022708 CTGAGAACATTGCAGGAGAGAGG - Intergenic
1024832499 7:53477949-53477971 CTGGAGTAACTGCAGCAGAGGGG - Intergenic
1024920916 7:54553853-54553875 TTGGAGACACTGGATGAGACAGG - Intronic
1026461404 7:70618377-70618399 AGGGAGAGACTGCTGGAGAGGGG - Intronic
1028910659 7:96203943-96203965 CTGGAGAAAGTGCAACAGAGTGG + Intronic
1029108183 7:98195262-98195284 CTGGAGACAGCTCAGGAGAGGGG + Intronic
1029351515 7:100016003-100016025 ATGACGACACTGCGGGAGAGGGG - Intronic
1029544948 7:101205785-101205807 CTGGAGACAGTGTGTGAGAGGGG - Intergenic
1029585654 7:101469128-101469150 CTGGGGACACTGTAGGGCAGAGG + Intronic
1029805036 7:102987139-102987161 CTGGAGACTCTGAAAGGGAGAGG + Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1031061984 7:117062077-117062099 GTGAAGACACTGCAAGAAAGTGG - Intronic
1031482904 7:122300161-122300183 CAGGGGACACTGCAGGGGCGCGG - Intergenic
1032360398 7:131249819-131249841 CAGGAGATGCTGCTGGAGAGGGG + Intronic
1032594099 7:133222276-133222298 CTGGAGAAACTGAACCAGAGAGG - Intergenic
1032710074 7:134453408-134453430 CTGGAGCTGCTGCAGGAAAGTGG + Intronic
1032838153 7:135692625-135692647 CTGGAGAAACTTCAGTAGAAAGG + Intronic
1033060022 7:138097198-138097220 CTGGGGCAACTGCAGTAGAGAGG - Intronic
1033130784 7:138743917-138743939 CAGGGGACTCTGGAGGAGAGGGG - Intronic
1033879569 7:145863747-145863769 CTGGAGTAACTGAAGGAGACAGG + Intergenic
1035998222 8:4573423-4573445 CTGGTGACACCCCAGGAAAGAGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036743142 8:11383962-11383984 ACGGTGACACTGCAGCAGAGTGG - Intergenic
1037099458 8:15025571-15025593 CTGGTGACACTTCAGGAGAATGG - Intronic
1037386467 8:18347818-18347840 CTCCAGAAAGTGCAGGAGAGAGG + Intergenic
1037528491 8:19750707-19750729 GTGAAGACAGTGCAGGAGAGAGG - Intronic
1038537665 8:28365390-28365412 GTGGAGATTCTGGAGGAGAGAGG - Intronic
1040510272 8:48087217-48087239 CTGGAGCTGCTGCAGGAGAGGGG + Intergenic
1041251422 8:55938487-55938509 CATGAGTCACAGCAGGAGAGAGG - Intronic
1041462735 8:58129733-58129755 CTGGAGACCCTGCATGGGTGTGG - Intronic
1042701319 8:71618165-71618187 CTGCAGACCCTGCAGGACGGAGG - Intergenic
1043191517 8:77228356-77228378 TTGGAGACTCTGCAGCAGTGAGG + Intergenic
1043392450 8:79804762-79804784 ATGGAGCCACTGCATGAGTGGGG + Intergenic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044291837 8:90481074-90481096 CTGGAAACACTTCAGGACATTGG + Intergenic
1044593590 8:93937722-93937744 CAGGAGACAGTGTAGGAGAGTGG + Intergenic
1047019563 8:120760525-120760547 CTGGAGACCCAGCCTGAGAGAGG + Intronic
1047024882 8:120813520-120813542 GCGGAGTCACTGCAGGTGAGAGG + Intergenic
1047897854 8:129386405-129386427 CTGGAGCCAAGGCAGGAGAAAGG - Intergenic
1048878718 8:138856674-138856696 CAGGAGAGACAGCAAGAGAGAGG + Intronic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049483898 8:142841451-142841473 CTGGAGACGCTGCAGATGTGTGG - Intronic
1049661403 8:143821186-143821208 CTGGACTCACTGCAGGGGTGAGG + Intronic
1049999552 9:1062378-1062400 GTCCACACACTGCAGGAGAGGGG - Intergenic
1052213788 9:25939732-25939754 TTAAAGCCACTGCAGGAGAGGGG + Intergenic
1052438990 9:28468442-28468464 ATGCAAAAACTGCAGGAGAGAGG + Intronic
1052988875 9:34506922-34506944 CTGGAGCCACTGGAGGAGGGAGG + Intronic
1053287522 9:36859500-36859522 GTGCAGACGCTGAAGGAGAGGGG - Intronic
1053506290 9:38646206-38646228 GTGTGGACACTGCAGGGGAGAGG + Intergenic
1055708094 9:79030537-79030559 CTGTAGGAACTGTAGGAGAGAGG + Intergenic
1055893276 9:81145877-81145899 TTGGAGCCACTGCACGAGAGAGG + Intergenic
1056654142 9:88495487-88495509 CTGTGGACACTGCAGGGGACAGG + Intergenic
1056743393 9:89279692-89279714 CAGGAGACACGGCAGGAGCTAGG - Intergenic
1057795824 9:98157407-98157429 CTGGAGGCAGGGCAGGACAGAGG - Intronic
1057952885 9:99384161-99384183 CAGGAGACAATGCTGGAAAGGGG + Intergenic
1058318947 9:103606005-103606027 CTGGAGAAACTGAAGGAATGGGG - Intergenic
1058482531 9:105411391-105411413 ATGGAGACAGAGCAAGAGAGAGG - Intronic
1059414978 9:114156701-114156723 CGGGAGACAGGGCCGGAGAGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060672374 9:125481111-125481133 CAGGTGACACTGCAGGTAAGTGG + Intronic
1061135552 9:128731395-128731417 CTGGAGACAATGGGGGAGACAGG + Intronic
1061524187 9:131144578-131144600 CAGGAGACGCTGCAGGGGTGGGG - Exonic
1061736402 9:132663144-132663166 CTGGAGACCGCACAGGAGAGAGG + Intronic
1062161119 9:135080460-135080482 CTGGACACACGGAGGGAGAGGGG + Intronic
1062277282 9:135736932-135736954 CTGGAGACACGGCAGGAAGCAGG - Intronic
1185575697 X:1170467-1170489 CTGGGCACACAGCAGGGGAGAGG - Intergenic
1186403210 X:9278545-9278567 ATGGAGACATGGCAGGAGGGAGG - Intergenic
1186869759 X:13759441-13759463 GGGGAGGCATTGCAGGAGAGAGG + Intronic
1188114539 X:26226832-26226854 CTGGAGAAATTCCAGGAGAAAGG - Intergenic
1189300444 X:39948582-39948604 ATAGAGGGACTGCAGGAGAGGGG - Intergenic
1191912805 X:66169134-66169156 ATGGAGAAACTTCAGAAGAGAGG - Intronic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1194378857 X:93168880-93168902 CTGGGGGCACTACAGGAGACAGG - Intergenic
1197489373 X:127098988-127099010 CTGTAGTCAATGCATGAGAGAGG + Intergenic
1197967951 X:132085070-132085092 ATGAGGAGACTGCAGGAGAGAGG - Intronic
1199373529 X:147080587-147080609 GTAGAGAAACTGCAGGAGATAGG - Intergenic
1200151967 X:153955601-153955623 GTGGTGACAGTGCAGGACAGTGG - Intronic
1200234965 X:154463781-154463803 CTGGAGAAAGTGGAGGAGGGCGG - Intronic
1200292324 X:154885717-154885739 CGGGTGACAGTGCAGGGGAGTGG + Intronic
1200339162 X:155381454-155381476 CGGGTGACAGTGCAGGGGAGTGG + Intergenic
1200347307 X:155459238-155459260 CGGGTGACAGTGCAGGGGAGTGG - Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1201070779 Y:10145909-10145931 ATGGAGAGACTCCAGGAGACAGG + Intergenic
1201106531 Y:10767551-10767573 CAGGAGTGAATGCAGGAGAGTGG - Intergenic
1201328833 Y:12796777-12796799 CTGGTGAGACTGCAGCAGTGAGG + Intronic
1202269704 Y:23060095-23060117 CTGAGGTCCCTGCAGGAGAGAGG - Intergenic
1202422698 Y:24693841-24693863 CTGAGGTCCCTGCAGGAGAGAGG - Intergenic
1202448091 Y:24976245-24976267 CTGAGGTCCCTGCAGGAGAGAGG + Intergenic