ID: 1090461962

View in Genome Browser
Species Human (GRCh38)
Location 11:126899056-126899078
Sequence AAAGGTTAACAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090461957_1090461962 -4 Left 1090461957 11:126899037-126899059 CCCTTTGACTATAGGTAATAAAG 0: 1
1: 1
2: 0
3: 28
4: 332
Right 1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 322
1090461955_1090461962 4 Left 1090461955 11:126899029-126899051 CCTGAGGTCCCTTTGACTATAGG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 322
1090461958_1090461962 -5 Left 1090461958 11:126899038-126899060 CCTTTGACTATAGGTAATAAAGG 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090461962 Original CRISPR AAAGGTTAACAGAAGGTGGA AGG Intronic
901760439 1:11467732-11467754 AAAGGTGAACAGATGCAGGAAGG + Intergenic
902604590 1:17561738-17561760 AAAGGAAAACAAAAAGTGGAAGG - Intronic
903314546 1:22491516-22491538 AAAGGTCCACAGAAGGAGGTAGG + Exonic
905199119 1:36304641-36304663 AAAGGGGAACACAAGGTGGTCGG - Exonic
905601512 1:39256191-39256213 AAAGGTTAGCAGAGATTGGAAGG + Intronic
906717996 1:47984512-47984534 CAAGGTGAACTGGAGGTGGAGGG + Intronic
907462145 1:54611499-54611521 AAGGGATATCAGAAGGGGGAAGG - Intronic
908070788 1:60457098-60457120 AAAGGTTAAGAGAAGGCCAAAGG + Intergenic
909835385 1:80248224-80248246 AAAGGAAAAGAGAAAGTGGAAGG + Intergenic
910467840 1:87519119-87519141 AAAGGTTGTCCGTAGGTGGAGGG - Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
912592883 1:110844648-110844670 AAAAGTTAACAGATGGAGAAAGG - Intergenic
912885602 1:113469791-113469813 AAATGTTAACAGAAAGCTGAAGG - Intronic
913426922 1:118742229-118742251 AAATGTTAACACAAGGAAGAAGG - Intergenic
915038218 1:152946472-152946494 AATGATTATCATAAGGTGGAGGG - Intergenic
915709380 1:157880166-157880188 AAAGGTATATAGCAGGTGGAAGG + Intronic
915779892 1:158535858-158535880 AAAGGGTCAGAGAAAGTGGAGGG + Intergenic
917392684 1:174556441-174556463 AAAGGATGACTGAAGGTGGGAGG + Intronic
917683736 1:177394806-177394828 AAAGGTTACCAGAGGGAGGTAGG + Intergenic
918537883 1:185594550-185594572 AAAGGTCACCTGAAGGTGAAGGG + Intergenic
918656804 1:187037003-187037025 AAAGGTTATGAGAAGGGGGATGG + Intergenic
918820963 1:189253724-189253746 AATAGTTAACAGAAGGAGGGGGG + Intergenic
921745501 1:218735830-218735852 AAAGGTTAATGGAAGGGGAATGG + Intergenic
922779225 1:228238117-228238139 AAAGGAGAGCAGCAGGTGGATGG - Intronic
923937868 1:238784351-238784373 AGAGGGAAACAGAAGTTGGAAGG + Intergenic
1062940169 10:1414976-1414998 ATAGGATGATAGAAGGTGGATGG + Intronic
1063078765 10:2744407-2744429 ACAGGTTAACATAAGGTTGCTGG + Intergenic
1063299021 10:4835209-4835231 AAAGGTACACAGGAGGTAGAGGG - Intronic
1064509452 10:16073967-16073989 AAAGGTTATTAGAAGGTTGAAGG + Intergenic
1064566968 10:16650239-16650261 AAAGGTTGACAGGAGGAGGCAGG + Intronic
1065404470 10:25348542-25348564 AAAAGTTAACAGGATGGGGAGGG + Intronic
1066044905 10:31586469-31586491 AAAGGCTAAATGAAGGTGGCAGG - Intergenic
1067013217 10:42733917-42733939 AATGGTTACCAGAGGCTGGAGGG + Intergenic
1067460454 10:46454428-46454450 AAAGGTTCACTTAAGGTGAAGGG + Intergenic
1067626738 10:47930175-47930197 AAAGGTTCACTTAAGGTGAAGGG - Intergenic
1068895719 10:62198201-62198223 GAAGTTTATCAGAAGGAGGAAGG + Exonic
1069172171 10:65245692-65245714 AAAGGTGAACAGAAGGCTGTTGG - Intergenic
1069266822 10:66469304-66469326 AAAGATGAACAGAAGTTGTAAGG + Intronic
1069270699 10:66523849-66523871 AAAGGTTATCAGCAAGTGGGGGG - Intronic
1070036493 10:72730259-72730281 AAAGTTTAAAAGAATGTTGAAGG - Intronic
1071161005 10:82745116-82745138 AAAAGTTCACATAAAGTGGAAGG + Intronic
1071303261 10:84273751-84273773 AAAGAGTAACAGAAGGTGACTGG + Intergenic
1071660143 10:87492661-87492683 AGAGGTTACCAGAGGCTGGAAGG - Intergenic
1072573366 10:96677633-96677655 AAATGTTTACAGAAGGTCAAAGG - Intronic
1074189305 10:111122321-111122343 AAAGGAGATCAGAAGGTGGGAGG - Intergenic
1074674665 10:115834744-115834766 GAAGATTAACACATGGTGGAAGG - Intronic
1077573248 11:3356799-3356821 AAAGGTTAAGAGAGGGAGAAGGG + Intronic
1077583040 11:3429499-3429521 AAATGTTACCAGCAGGTCGAGGG + Intergenic
1078295477 11:10064568-10064590 AAAGGTTAAAAGAAAAAGGAGGG + Intronic
1078591659 11:12646345-12646367 AGAGCCTAACAGGAGGTGGATGG + Intergenic
1079707812 11:23642573-23642595 AATGGTTACCAGAGGCTGGAAGG + Intergenic
1079980643 11:27148382-27148404 AAAAGATGACAGAATGTGGAAGG + Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1081889796 11:46531411-46531433 AAAGATTAACAGAATGAGGCTGG + Intronic
1082013708 11:47468765-47468787 AAAGGTCAACACAAGGTCAAAGG + Intronic
1082775846 11:57243910-57243932 AAAGGGTGACAGGAGGTGGGTGG - Intergenic
1083314492 11:61806037-61806059 AAAGTTTAAGATAAGGTTGAGGG + Intronic
1083508350 11:63182672-63182694 AACGTTCAACAGAAGGTGGCAGG - Intronic
1084018770 11:66404378-66404400 GAAGGCAAAGAGAAGGTGGAGGG + Intergenic
1084239951 11:67812302-67812324 AAATGTTACCAGCAGGTCGAGGG + Intergenic
1084390291 11:68871113-68871135 AAAGTTCAGGAGAAGGTGGAAGG + Intergenic
1084832487 11:71780532-71780554 AAATGTTACCAGCAGGTCGAGGG - Intergenic
1086571318 11:88287692-88287714 AATGGTTAACAGAGGCTGGAAGG - Intergenic
1087121689 11:94581628-94581650 AATGGTTTACAGAAGGAGGTGGG + Intronic
1088816596 11:113425383-113425405 AGAGGTAGACAGCAGGTGGAGGG + Intronic
1088871907 11:113897609-113897631 AGAGGAAAATAGAAGGTGGAAGG - Intergenic
1089375515 11:117991563-117991585 AGTGGTTACCAGAAGCTGGAAGG - Intronic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1090745704 11:129703241-129703263 CAAGGTTCACAGAAGGTGAGTGG - Intergenic
1092199488 12:6571367-6571389 AAAGGTTATGAGGAGGCGGAGGG - Intronic
1093787814 12:23213147-23213169 AAAGTTTAAAAAAAGGAGGAAGG - Intergenic
1095416608 12:41983876-41983898 AAAGGGTAACAGAAAGTAAAAGG + Intergenic
1098491507 12:71086452-71086474 AAAGGATAGCGGAGGGTGGAAGG - Intronic
1099264834 12:80432267-80432289 AAAGGTTAACCAAAACTGGAGGG - Intronic
1101107675 12:101455982-101456004 AAAGGACAAAAGAAGGTGGACGG + Intergenic
1102110592 12:110363034-110363056 AAACATTAACTGAAGGTGGTGGG + Intergenic
1102189504 12:110976216-110976238 AGAGGTTACCAGAAGCTGGGAGG + Intergenic
1102446281 12:113005253-113005275 GATGGTGGACAGAAGGTGGAGGG + Intronic
1102921676 12:116796234-116796256 TAAGGTTATCATAAGGTGCAAGG + Intronic
1103435870 12:120925004-120925026 GAAGGTAAAGAGATGGTGGAAGG + Intergenic
1104084229 12:125459503-125459525 GATGGTTACCAGAAGCTGGAAGG + Intronic
1104515292 12:129419484-129419506 AAACTTTAGCAGAAGGAGGATGG + Intronic
1106818847 13:33440692-33440714 GAAGGTTATCAGAATATGGATGG - Intergenic
1107607902 13:42079980-42080002 AAAAGTCAAAAGAAAGTGGAAGG - Intronic
1108692002 13:52867550-52867572 AGAGGTTTCCAGAAGGTGTAGGG + Intergenic
1109621612 13:64914967-64914989 AAATGTTCATAGAAGGTGGAGGG - Intergenic
1109750189 13:66681788-66681810 AATAGAGAACAGAAGGTGGATGG - Intronic
1111511865 13:89276934-89276956 AAAAGCTACCAGATGGTGGAAGG - Intergenic
1112684487 13:101808287-101808309 AAAGGATAACAGAAGGAATAGGG - Intronic
1112760295 13:102687876-102687898 AAAGGTTAGAGGAAGGTGGAGGG - Intronic
1113633792 13:111906172-111906194 AAAGGTTTTTAGAATGTGGACGG - Intergenic
1114330644 14:21633907-21633929 AGAGGATAACAGCAGGTTGAAGG - Exonic
1114430869 14:22659245-22659267 AAATGTTAAGAGAAGGCAGAGGG - Intergenic
1116112391 14:40603581-40603603 AAAGGTTAAAAAGAGGGGGAGGG + Intergenic
1116895463 14:50311747-50311769 AGAGTTCAACAGAAAGTGGACGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116939517 14:50776953-50776975 TATGGTTTACAGAATGTGGATGG - Exonic
1116955072 14:50914921-50914943 AAAGGTTAAATAAAGGTGGAGGG + Intronic
1117482844 14:56166276-56166298 AAAGTTAAAAAGCAGGTGGAGGG - Intronic
1117929108 14:60821127-60821149 AAAGCATAACATAATGTGGATGG - Intronic
1117965307 14:61201721-61201743 ACAGGTTAACAAAAGTTGGAAGG + Intronic
1118941191 14:70339887-70339909 TGAGGTTAAAAGAAGGAGGATGG - Intronic
1120138864 14:80904316-80904338 AATGGTTACCAGAGGGTGGCGGG + Intronic
1120389870 14:83892431-83892453 AAAGATTAACAGAGAGTAGAGGG + Intergenic
1120707869 14:87763028-87763050 AAAGGTTAGAAGAGTGTGGAGGG - Intergenic
1120819942 14:88902821-88902843 ACAGACTTACAGAAGGTGGAGGG + Intergenic
1121240996 14:92430135-92430157 AAAGTTACTCAGAAGGTGGAAGG - Intronic
1121551637 14:94807215-94807237 AAATGTTTGCAGAAGGTAGAAGG - Intergenic
1122198768 14:100109209-100109231 GAAGGACAAGAGAAGGTGGATGG - Intronic
1126075294 15:44903304-44903326 AATGGTTAACAGAAGCTTGGGGG - Intergenic
1126138417 15:45414950-45414972 AAATGTTAACAGTAGGTAGGAGG - Intronic
1126903788 15:53342781-53342803 AAAGCTTAAAAGAAGGCTGAGGG + Intergenic
1127804301 15:62504792-62504814 AAAGGGTAACAGAAAGTAGTTGG + Intronic
1128072916 15:64808359-64808381 CAAGGCTCACAGAAGGTGGGTGG - Intergenic
1129459955 15:75695572-75695594 AAAGGAGACCAGGAGGTGGAGGG - Intronic
1130062481 15:80579853-80579875 GAAGGTGAACTGAAGGTGGGAGG + Intronic
1130567347 15:85008063-85008085 AGAGGTCAAGAGAAGGTGGCAGG + Intronic
1133439102 16:5805808-5805830 ACAGGGTAGCAGAAGGTGGGAGG - Intergenic
1133921633 16:10158739-10158761 AAAGGTTTCCAGGAGCTGGAGGG + Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1137287753 16:47030510-47030532 AAAGGCCAAGAGCAGGTGGATGG + Intergenic
1139732883 16:68962384-68962406 GATGGTTAACAGAAGTGGGAAGG - Intronic
1142325257 16:89410810-89410832 GAAGCTTAACAGAAGGGGGTGGG + Intronic
1142688042 17:1589055-1589077 AACGGGTCACAGAAGGAGGAGGG + Intronic
1144580902 17:16458773-16458795 AAGGCTTAACAGAAGTTGGCAGG - Intronic
1146095794 17:29929612-29929634 AGAGGGTAAAAGAAGGGGGAGGG + Intronic
1146327138 17:31896377-31896399 AAAGATTAAAACAAGGTGTAGGG - Intronic
1146569809 17:33942493-33942515 AAAGGAGAAAAGGAGGTGGAAGG - Intronic
1147007250 17:37413449-37413471 AAAGGTTAACAAAAGGTATGTGG - Intronic
1147180334 17:38680694-38680716 AAAGGTTAAATGATGGTGGCTGG - Intergenic
1147948837 17:44095792-44095814 GAAGGGTAACAGCAGGGGGAGGG + Intronic
1148228190 17:45914044-45914066 AAAGGATAAAAAAAGGAGGAGGG + Intronic
1150007208 17:61477183-61477205 AAGGGTTAACAGAAGCCGCAGGG + Intronic
1150664057 17:67113702-67113724 ATAGGATAATAGAATGTGGAAGG + Intronic
1151136339 17:71949091-71949113 GAAGGTTAACAGCAGATGCAGGG - Intergenic
1151773889 17:76184911-76184933 AAAGGTCAACATTAGGTGGGAGG - Intronic
1153209634 18:2746766-2746788 AAAAGTTTACAAAAGATGGAAGG - Intronic
1154980353 18:21498462-21498484 AAAGGTTCACAGAAGGGGGGTGG + Intronic
1155546904 18:26924911-26924933 AATGAATAACTGAAGGTGGAAGG - Intronic
1155766523 18:29641465-29641487 AAATATTAAAAGAAGGCGGAAGG - Intergenic
1156590207 18:38479370-38479392 AAGGGTTCACATAAGCTGGAGGG - Intergenic
1158187226 18:54784443-54784465 AATGGGGAACAGAGGGTGGAGGG - Intronic
1158569505 18:58585425-58585447 CAAGCTTAACAGAAGATGGTTGG + Intronic
1160521199 18:79509202-79509224 AAAGGGGAACAGGAAGTGGACGG - Intronic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1164124025 19:22293788-22293810 AAAGGTAGACAAAAGGTGGCTGG - Intronic
1166342327 19:42146092-42146114 AAATATTAATAGTAGGTGGAGGG - Intronic
1168304469 19:55427995-55428017 AAAGGTAAAAAGGAGGTGGCAGG - Intergenic
926521437 2:13920513-13920535 GATGGTTACCAGAAGCTGGAAGG + Intergenic
927043354 2:19252388-19252410 AAGCGTTACCAGAATGTGGATGG - Intergenic
928704126 2:33929420-33929442 AAGTTTTAAAAGAAGGTGGAAGG - Intergenic
929100584 2:38308458-38308480 AAAGGTAGTCAGAGGGTGGAGGG + Intronic
929706112 2:44213889-44213911 ATAGTTTATCAGAAGGTGGGAGG + Intronic
930458545 2:51638842-51638864 AAGGCTTAAAAGAAGGTGGGGGG + Intergenic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
931331047 2:61283902-61283924 AATGGTTACCAGAGGCTGGAGGG + Intronic
932531537 2:72539196-72539218 AAAGGAAAAAAGAAGGGGGAGGG + Intronic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
934946049 2:98542814-98542836 ACAGGGTAACAGAAGGGGGAAGG - Intronic
935267300 2:101405832-101405854 AAAGGTTAAAAGAAGACGGCTGG + Intronic
935959034 2:108405707-108405729 AATGGTTTAGAGGAGGTGGAGGG + Intergenic
936056444 2:109265384-109265406 ACAGTTTATCAGATGGTGGAAGG + Intronic
936156306 2:110049614-110049636 AAAGGTTCAGAGTGGGTGGAGGG + Intergenic
936188383 2:110321828-110321850 AAAGGTTCAGAGTGGGTGGAGGG - Intergenic
936271984 2:111055898-111055920 CGAGGATAAGAGAAGGTGGAGGG - Intronic
936816888 2:116471058-116471080 AGAGGTTAAAAGAAGGATGATGG + Intergenic
937251205 2:120524923-120524945 AAAGGGAAACAGCAGGTAGAGGG - Intergenic
937407443 2:121643643-121643665 AAAGGGTAACAGTGTGTGGAAGG + Intronic
939376129 2:141370297-141370319 AAAAATTAACAGATGTTGGAAGG - Intronic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
947194648 2:227548992-227549014 AAAGGTTAACTGAGGGAGAAGGG - Intronic
1169343785 20:4814688-4814710 CAAGGTTAAAGGAGGGTGGAGGG - Intronic
1169950433 20:11037649-11037671 ATAGGTTAAGAGAAGGAGGGAGG + Intergenic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1172393255 20:34580925-34580947 AAAGGTTACTAGAAGGCAGAGGG - Intronic
1173452609 20:43178483-43178505 AAAGGTTAAGAGATGGTAAATGG + Intronic
1174741466 20:53018469-53018491 AGGGGCTAACAGAAGGGGGAGGG + Intronic
1175107225 20:56624203-56624225 AGAGGTTACCAGCAGGTGGGTGG + Intergenic
1175776576 20:61657631-61657653 AAAGATCTACAGAAGTTGGATGG + Intronic
1175956022 20:62609861-62609883 CCAGGTAAACAGAAGCTGGAAGG + Intergenic
1177068812 21:16475552-16475574 CAAGATTAGCAGAATGTGGAAGG - Intergenic
1177838850 21:26214637-26214659 AAAGGTTAACAGAAACTACAGGG + Intergenic
1178803240 21:35816654-35816676 TCAGTTAAACAGAAGGTGGAAGG + Intronic
1179427505 21:41293588-41293610 AAAAGTTCACAGAAGGAAGATGG - Intergenic
1180898546 22:19354558-19354580 AAGGGTCCAGAGAAGGTGGAAGG - Intronic
1182329665 22:29542209-29542231 AAAGGTTAAAAGAATGTGACTGG + Intronic
1184381502 22:44147592-44147614 GAAGGTAAAAAGCAGGTGGAAGG + Intronic
949685596 3:6566165-6566187 AGAGATGAACAAAAGGTGGAGGG - Intergenic
949763435 3:7498851-7498873 CAAGGACAACAGAAAGTGGAGGG - Intronic
951265527 3:20561338-20561360 AAAGATTAACAGAAGGGAAAAGG + Intergenic
951484335 3:23194789-23194811 GAAGGTTCACAGAAGGGGAAGGG + Intergenic
954326756 3:49868270-49868292 AAAGGATAGCAGATGGGGGAGGG - Intronic
954486116 3:50853192-50853214 GATGGTTACCAGAAGCTGGAAGG - Intronic
955281721 3:57600438-57600460 AAAAGGGAACAGAAGGGGGAAGG - Intergenic
955670821 3:61400669-61400691 AGAGGTTACCAGAGGCTGGAAGG - Intergenic
955970051 3:64429934-64429956 AAAAGCTAAAAGAAGATGGATGG + Intronic
958547787 3:95577355-95577377 AGTGGTTATCAGAAGCTGGAGGG + Intergenic
959477411 3:106827873-106827895 AAAGGTCAAGAGATGGGGGAAGG - Intergenic
960520197 3:118645979-118646001 AAAGCTGAAGAGGAGGTGGAAGG + Intergenic
961068112 3:123893244-123893266 AAAGGTTACCAGGTGTTGGAGGG - Intergenic
961134438 3:124496646-124496668 AGAGTTTAACAGAAGTGGGAAGG + Intronic
961298962 3:125909632-125909654 AAATGTTACCAGCAGGTCGAGGG - Intergenic
961617885 3:128198003-128198025 AAAGGTTAAGGGAAGGGGGATGG - Intronic
961703488 3:128765448-128765470 AGAGGTTAACTGAAGATGTAAGG - Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962144388 3:132824756-132824778 AAAACTGAACAGAAGGTTGAAGG - Intergenic
962228560 3:133638773-133638795 AAATGTTGAAAAAAGGTGGAAGG - Intronic
962268163 3:133958201-133958223 CAAGGCTAACAGATGTTGGAAGG + Intronic
963281348 3:143387372-143387394 AAAGGTAAGCCGAGGGTGGAGGG + Intronic
963758992 3:149266865-149266887 AAAATTTAACAGCAGCTGGAAGG - Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964308425 3:155365090-155365112 ACAGGTAATCAGAAGGTTGATGG + Intergenic
965005282 3:163014089-163014111 AAGGGTTAAGAGAAAGGGGAAGG + Intergenic
965325581 3:167299939-167299961 AAAGGTGAAAAGCAGGTGGAGGG - Intronic
965740747 3:171871825-171871847 AAAAATTAACAGAAGGTTAAAGG - Intronic
966134707 3:176684992-176685014 AAAGGTCAAAAGAAAGTGAATGG + Intergenic
966916336 3:184586190-184586212 AAAGGTTAAAAGGACCTGGAGGG - Intronic
967820806 3:193837086-193837108 AAAGGTTAAATGAGGTTGGAAGG - Intergenic
968337112 3:197923386-197923408 AAAGGTCACTAGGAGGTGGAAGG - Intronic
969089187 4:4680482-4680504 AAAGGCTATCAGAGGGCGGATGG + Intergenic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969815649 4:9685435-9685457 AAATGTTACCAGCAGGTCGAGGG - Intergenic
970128231 4:12838436-12838458 ACAGGTTCACAGATTGTGGAAGG + Intergenic
970643997 4:18098553-18098575 AGAGGTTACCAGAAGTTGGAGGG + Intergenic
970992652 4:22230547-22230569 AAAGGATAGAAGAAGGTGGGTGG + Intergenic
971580826 4:28337437-28337459 GAAGGCAAACAGAAGGTAGAAGG + Intergenic
973043875 4:45510657-45510679 AAAGGATAGCAGAAGGGTGAGGG - Intergenic
973697723 4:53507216-53507238 GAGGGGTCACAGAAGGTGGAAGG + Intronic
975167394 4:71192675-71192697 AAAACTTAACAGAAGGAAGAGGG - Intronic
975662241 4:76699363-76699385 AAAGGTAAAAAGCAGGGGGAGGG - Intronic
975810923 4:78168725-78168747 AAAAATTAAAAGATGGTGGATGG + Intronic
976059748 4:81113235-81113257 TAAGATTAACAGAAGGGGTATGG + Intronic
976874882 4:89840944-89840966 ACAGGTTTACAGAAGGTGAGAGG - Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
978468721 4:109037976-109037998 AATGGATAAAAGAAGGAGGAAGG + Intronic
979464392 4:121019755-121019777 AATGGATTACAGATGGTGGAAGG - Intergenic
980002261 4:127503701-127503723 AACAGATAAAAGAAGGTGGAAGG - Intergenic
981033320 4:140147498-140147520 AAAGGTTGGCAGCAGGTGGGGGG + Intronic
981344376 4:143658536-143658558 AAAGGTTTAGACAAGGTGGTGGG - Intronic
982598527 4:157416082-157416104 AAAGGTAAACATAAGGTGACAGG + Intergenic
982933186 4:161435405-161435427 AATGGTTAACAGAGGCTGAAAGG + Intronic
983585627 4:169351337-169351359 AAAGGCTCACAGAAGAGGGAGGG - Intergenic
983926123 4:173404352-173404374 AAATATGAACAGAAGATGGACGG - Intronic
984294134 4:177832107-177832129 ACAGGTCCACAGAAGGTGGACGG - Intronic
984565413 4:181324190-181324212 GAAGGTCAACACAAGGTGGAGGG - Intergenic
985250810 4:188022594-188022616 AAAGTTTAGCAGGAGGAGGAAGG + Intergenic
985861667 5:2476404-2476426 AAAGATTACAAGAAGGTGGAAGG + Intergenic
986026400 5:3855027-3855049 AAAGGCTAACTGGAGGTGGGAGG + Intergenic
986190483 5:5492344-5492366 AATGGTCAACAGAGTGTGGACGG + Intergenic
987057896 5:14212401-14212423 CAAGGTTCACAGAAGTTGGCTGG - Intronic
987947062 5:24623993-24624015 AAAGCATAACAGCAGGTTGAAGG + Intronic
992288575 5:75261416-75261438 AAAGGTTGACAGTTGGAGGAGGG - Intergenic
993258137 5:85619756-85619778 AAAAGCTAAGATAAGGTGGAAGG + Intergenic
993841236 5:92881693-92881715 AAATGGTAACAGATGATGGAGGG + Intergenic
994090610 5:95806628-95806650 AAAGGGTAACAGAGGATGGATGG - Intronic
994324380 5:98432404-98432426 AAAGGTCAAAAGAAGGGGAAAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994756943 5:103805459-103805481 AAAGAATAAAAGAAGGAGGAAGG - Intergenic
996012119 5:118492811-118492833 AAAGGGTAAGAGAAGGTGAAGGG + Intergenic
996828981 5:127719055-127719077 GATGGCTAACAGAAGCTGGAAGG - Intergenic
997897411 5:137732008-137732030 AATGGTTACCAGGAGCTGGAGGG - Intronic
998951301 5:147395516-147395538 AAAAGATAAGAGAAGGGGGAAGG - Intronic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1000463570 5:161549028-161549050 AAAGGTTATCAGAAGGTAAGTGG - Intronic
1004308981 6:14527073-14527095 ATAGGTTGACAGTAAGTGGATGG + Intergenic
1005717427 6:28563961-28563983 AAAGGCCAACAGATGGAGGAAGG + Intergenic
1007559022 6:42790528-42790550 AAAGGGGAAAAGAAGGTGGGGGG - Intronic
1007914303 6:45546800-45546822 AAATTATAACAGAAGATGGAGGG - Intronic
1010032501 6:71286257-71286279 AAAGGTATTCAGATGGTGGATGG + Intergenic
1010524218 6:76880568-76880590 AAAGGAGAATAGAAGGTGGAGGG + Intergenic
1011017682 6:82775728-82775750 AAAGGTCAAAAGAAGGTGATAGG + Intergenic
1011875923 6:91961494-91961516 AATGGTTAACAGTCGGTGTATGG - Intergenic
1011917089 6:92520493-92520515 ACACGTGAACTGAAGGTGGAGGG - Intergenic
1012528644 6:100207534-100207556 AAACGTTAATAGAAGGTGTGGGG + Intergenic
1013134468 6:107267448-107267470 ACATGTTAACAGAAGGTGAGTGG - Intronic
1013626176 6:111939446-111939468 AAACTTAAACATAAGGTGGATGG - Intergenic
1013949126 6:115758315-115758337 AAACTTTAACAGCGGGTGGAGGG + Intergenic
1014370222 6:120597409-120597431 AAAGGTTAAAAGAATGATGAGGG + Intergenic
1014412605 6:121145440-121145462 AATGGTTACCAGAAGCTGGAGGG + Intronic
1021781461 7:24110820-24110842 AATGGTCAACAGCAGGTGTAAGG + Intergenic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1023155669 7:37249215-37249237 AAAGGTTAATATGAGATGGAGGG + Intronic
1023255749 7:38310761-38310783 AAATGTTATCCAAAGGTGGATGG - Intergenic
1023335539 7:39165234-39165256 AAGGGTTAACAGATGAAGGAGGG - Intronic
1023659446 7:42457431-42457453 AAAGGTTAACAGAGTGTGCATGG - Intergenic
1023920517 7:44625974-44625996 AAAATTTAAAAGAAGGTGGGGGG + Intronic
1026423487 7:70265634-70265656 GCAGGTTACCAGCAGGTGGAAGG + Intronic
1028725606 7:94083988-94084010 ACAGGTTCAAAGATGGTGGAGGG + Intergenic
1029570604 7:101366101-101366123 AAAGGATACCAGAAGGTGTTGGG + Intronic
1030517105 7:110551732-110551754 AGAGGTTAGAAGAAGCTGGAAGG - Intergenic
1030840462 7:114346764-114346786 AAAGGTTATCAGAGACTGGATGG + Intronic
1031834542 7:126667604-126667626 AAAGCTGAGGAGAAGGTGGAAGG + Intronic
1031890341 7:127287006-127287028 ACAGCTTAAGAGAAGGGGGAAGG - Intergenic
1033015655 7:137668717-137668739 AAAGGTTGACAGAATGGTGAAGG + Intronic
1033485338 7:141783594-141783616 TAAGGTCAACAGCAGGAGGAGGG + Intronic
1034075706 7:148229225-148229247 AAAGTTTAACAGAAATTGGATGG + Intronic
1037607391 8:20449166-20449188 AATGGTCAACAGCAGGTGGAAGG - Intergenic
1037711747 8:21360648-21360670 AGAGGTTAAGAGAAGGTGCTGGG - Intergenic
1039677534 8:39685788-39685810 ATATGTTAGCAGATGGTGGAGGG - Intronic
1041799098 8:61779355-61779377 AAAGGTTACCAAAAGCTTGAGGG - Intergenic
1041856350 8:62460038-62460060 AATGGTTAAGAGAATGTGGTGGG + Intronic
1042355960 8:67827855-67827877 AAAGGATCACAAAGGGTGGAGGG + Intergenic
1043117763 8:76280933-76280955 AAAGGTGTAAAAAAGGTGGAAGG - Intergenic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1044467108 8:92520355-92520377 AAAGCTGAACAGAAGGCAGAAGG + Intergenic
1045286183 8:100793617-100793639 AATGGTTACCAGAGGCTGGAGGG - Intergenic
1045736588 8:105303039-105303061 AGGGCTTATCAGAAGGTGGAGGG + Intronic
1049470426 8:142772883-142772905 AAAGGTGGACAGAAGGAGGCAGG + Intronic
1050737321 9:8779041-8779063 AAAGGGAAAAAGAAGGTGGAGGG + Intronic
1050857369 9:10377042-10377064 AAAGGGTAATAGAGGGTGGGTGG - Intronic
1050961685 9:11741456-11741478 AATGTTTATCAGAAGGTAGAAGG + Intergenic
1050987188 9:12097900-12097922 AAAGGAATACAGAAAGTGGATGG - Intergenic
1053073750 9:35115958-35115980 ACAAGTCCACAGAAGGTGGAAGG - Intronic
1056148100 9:83755018-83755040 AAAGGTTTAAAGAATGTGGCAGG + Intronic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056722694 9:89085319-89085341 AAAAGTGAACAGAAGGCTGAGGG - Intronic
1057953868 9:99391719-99391741 AGAGATTAACAGGAGGTGGCAGG - Intergenic
1058071591 9:100606480-100606502 AAAGGTTAATATAACCTGGAAGG + Intergenic
1058157376 9:101530596-101530618 GATGGTGAACAGAAGGTGGCTGG + Intronic
1059339997 9:113592301-113592323 AAAGGTTAAGTGAAGATGGTTGG - Intronic
1059443482 9:114323993-114324015 AAAGCCAAACAGAAGGCGGAAGG - Intronic
1059670448 9:116485958-116485980 CAAGGTTCACAGATTGTGGAAGG + Intronic
1060517942 9:124277483-124277505 AAAGGGTAGGAGAAGGTGGTGGG - Intronic
1060708350 9:125829995-125830017 AAAGGTGAACTGAAGTTGGGAGG + Intronic
1060769483 9:126321521-126321543 ACAGGTTAACAAATAGTGGATGG + Intergenic
1062671309 9:137711568-137711590 AGTGGTTACCAGGAGGTGGAGGG + Intronic
1187406485 X:19009120-19009142 AAGGGTTAACGCAAGGTGTAAGG + Intronic
1188980819 X:36725402-36725424 GAAGCTTAGCAGAAGGTGCATGG + Intergenic
1189143001 X:38626350-38626372 AAAGATTAACAGCTGGTTGATGG - Intronic
1189290614 X:39882962-39882984 AAGGGTTAAGAGAAGTCGGAGGG + Intergenic
1189377621 X:40477959-40477981 AAAGGCTGGAAGAAGGTGGATGG - Intergenic
1190213679 X:48466812-48466834 ACAGGTCAGCAGGAGGTGGATGG + Exonic
1190507379 X:51139466-51139488 AAATGACAACAGAAGGTGTAGGG - Intergenic
1191030334 X:55962550-55962572 AGAGGATGACAGAAGGTGGATGG + Intergenic
1191712325 X:64163577-64163599 AAAGTTTAAAAGAAGGGAGAGGG - Intergenic
1191908102 X:66117146-66117168 AAAGCTTACCAAAAGGTAGAAGG - Intergenic
1191915007 X:66192044-66192066 AAACACTAACAGAAGGAGGAAGG + Intronic
1193417289 X:81240259-81240281 AAAGTTAAAAAGCAGGTGGATGG + Intronic
1194278016 X:91911626-91911648 AATGGTTACCAGAGGCTGGAAGG - Intronic
1194486061 X:94488035-94488057 AAAGGTTACAAGAAGGTTTATGG + Intergenic
1196026249 X:111044351-111044373 AAATGATGACAGAAGATGGAAGG - Intronic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1197890655 X:131267074-131267096 AATGGTTATCAGAAGCTGGGAGG + Intergenic
1198549820 X:137733543-137733565 AAAGATTACCAGAAGCTGAACGG - Intergenic
1200595353 Y:5133699-5133721 AATGGTTACCAGAGGCTGGAAGG - Intronic
1201193272 Y:11467689-11467711 AAAGGTTTGCAGAAAGTGAATGG + Intergenic
1201550574 Y:15212756-15212778 AAAAATGAACAGAAGGTGCAAGG + Intergenic
1201987033 Y:19979895-19979917 AAATGTTTACAGAAGGCTGAGGG + Intergenic