ID: 1090462291

View in Genome Browser
Species Human (GRCh38)
Location 11:126902226-126902248
Sequence GGCAAGGAAATACCCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090462284_1090462291 17 Left 1090462284 11:126902186-126902208 CCTGATAGCTCGTCCACCAAAAG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1090462291 11:126902226-126902248 GGCAAGGAAATACCCACTGTGGG 0: 1
1: 0
2: 0
3: 28
4: 274
1090462286_1090462291 4 Left 1090462286 11:126902199-126902221 CCACCAAAAGGTGCTGTCATTGA 0: 1
1: 0
2: 4
3: 14
4: 109
Right 1090462291 11:126902226-126902248 GGCAAGGAAATACCCACTGTGGG 0: 1
1: 0
2: 0
3: 28
4: 274
1090462287_1090462291 1 Left 1090462287 11:126902202-126902224 CCAAAAGGTGCTGTCATTGATGC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1090462291 11:126902226-126902248 GGCAAGGAAATACCCACTGTGGG 0: 1
1: 0
2: 0
3: 28
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090462291 Original CRISPR GGCAAGGAAATACCCACTGT GGG Intronic