ID: 1090465960

View in Genome Browser
Species Human (GRCh38)
Location 11:126933387-126933409
Sequence CGTGATGACTTGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090465960_1090465965 -7 Left 1090465960 11:126933387-126933409 CCTTCCTCCTTCAAGTCATCACG 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1090465965 11:126933403-126933425 CATCACGTTATCTGCCTTAGGGG 0: 1
1: 0
2: 1
3: 4
4: 49
1090465960_1090465963 -9 Left 1090465960 11:126933387-126933409 CCTTCCTCCTTCAAGTCATCACG 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1090465963 11:126933401-126933423 GTCATCACGTTATCTGCCTTAGG 0: 1
1: 0
2: 0
3: 3
4: 76
1090465960_1090465964 -8 Left 1090465960 11:126933387-126933409 CCTTCCTCCTTCAAGTCATCACG 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1090465964 11:126933402-126933424 TCATCACGTTATCTGCCTTAGGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090465960 Original CRISPR CGTGATGACTTGAAGGAGGA AGG (reversed) Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
908107688 1:60862069-60862091 CATGATGACCTGAATGAGGCTGG + Intergenic
913329319 1:117654131-117654153 CTTGTTGAATTGAAGGGGGAGGG + Intergenic
916951234 1:169782336-169782358 CGGGATAACTTGAAGGAGTGGGG - Intronic
920608627 1:207415059-207415081 AGTGATCAATTGAATGAGGAAGG + Intergenic
921707642 1:218342782-218342804 CTTGATTACTTCAAGGAGGCAGG - Intergenic
922559442 1:226558497-226558519 CGTGCTGGCTTGAAGGGGAAGGG + Intronic
923256270 1:232224082-232224104 AGTGAGGACCTGAAGGAGGGAGG - Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063980654 10:11449145-11449167 GGAAATGACTTGAAGGTGGAGGG - Intergenic
1064934131 10:20661128-20661150 CATGATGACTTCTAAGAGGAAGG + Intergenic
1069918007 10:71798992-71799014 TGTGGTCACTTGAAGGAGGGTGG - Intronic
1073417964 10:103400314-103400336 AGTGATGACCTGAAATAGGAGGG + Intronic
1073784584 10:106874772-106874794 GGTGATGACTAGAAAGAGGCAGG + Intronic
1076570890 10:131432228-131432250 CGTGCTGGCTTGAAGCATGAAGG + Intergenic
1077306127 11:1869425-1869447 GGGGCTGCCTTGAAGGAGGAGGG + Intronic
1077609594 11:3636153-3636175 CTTGATGACGTGAAGGCGGTAGG - Intergenic
1079981612 11:27157236-27157258 TTTGATGAGTTGAAAGAGGAAGG - Intergenic
1080062190 11:27968900-27968922 AGTGATGAGTTGAAGGGCGAGGG + Intergenic
1083213837 11:61206309-61206331 AGGGAAGACTTCAAGGAGGAAGG + Intronic
1083216721 11:61225138-61225160 AGGGAAGACTTCAAGGAGGAAGG + Intronic
1083219603 11:61243964-61243986 AGGGAAGACTTCAAGGAGGAAGG + Intronic
1083720199 11:64600118-64600140 AGTGATGGATTGCAGGAGGAGGG + Intronic
1085748557 11:79137227-79137249 CCTGTTGACTTAAAGGTGGAAGG - Intronic
1086569492 11:88265756-88265778 GGTGATGAGGTGAAGGAAGATGG + Intergenic
1090061723 11:123469431-123469453 AGTGATGAATGGAAGGCGGATGG + Intergenic
1090465960 11:126933387-126933409 CGTGATGACTTGAAGGAGGAAGG - Intronic
1090532007 11:127600667-127600689 GGTGAAGAGTTGAAGCAGGATGG + Intergenic
1091309913 11:134565278-134565300 CTTGAAGACTTGAAGTAGGGAGG + Intergenic
1091643086 12:2252451-2252473 CGTGCTGAGTGGAAGGTGGAAGG + Intronic
1092113660 12:5982826-5982848 CTTGATGACATACAGGAGGATGG + Intronic
1097356462 12:58607730-58607752 AGTAATGACTTGAAGGAAGAAGG - Intronic
1099617951 12:84962855-84962877 CTTGATGTTTTGAAGGAGAAAGG + Intergenic
1100026555 12:90135733-90135755 AGTGTTTACTTGTAGGAGGAAGG - Intergenic
1100550298 12:95640768-95640790 CTTGATAACTGGAAGGATGATGG - Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1111452917 13:88442398-88442420 CCTGATGACTTGAAGTAGAAAGG + Intergenic
1112332535 13:98487512-98487534 CGTGATGACTTGCTGGGGCAGGG - Intronic
1112488747 13:99843105-99843127 AGTGAGGACTTGAAGCAGGATGG + Intronic
1119956899 14:78808553-78808575 GGTGAGGACTGGAAGGAGGGAGG - Intronic
1124967850 15:34450635-34450657 CTTTATGATTTTAAGGAGGATGG + Intergenic
1125238971 15:37550738-37550760 CCTGTGGTCTTGAAGGAGGATGG - Intergenic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1126222631 15:46232064-46232086 CTTGAAGACTTAAAGGAGGTAGG - Intergenic
1126321699 15:47430858-47430880 GGTGATGAATTGCAGGAGCAAGG + Intronic
1126613153 15:50550009-50550031 TGTGATAACTTGAATGAGGTAGG + Intergenic
1129144877 15:73637777-73637799 CGTGATTCCTTGAAGGTGAATGG + Intergenic
1131280961 15:91020948-91020970 TGTGAGGACTGGAAGGAAGATGG - Intronic
1136280292 16:29204638-29204660 TGTGATGACGTGGAGGAGGCTGG - Intergenic
1136518190 16:30780431-30780453 CCTGATGACTTGGAGAAGGCTGG + Exonic
1137798960 16:51245124-51245146 CGTGATGAATAGAAGGAGAGTGG - Intergenic
1138588575 16:57986926-57986948 GGGGAAGACTTCAAGGAGGATGG - Intronic
1139329534 16:66176642-66176664 CATGATGAAGTGATGGAGGAAGG + Intergenic
1141935518 16:87235714-87235736 CCTGAGGCCTGGAAGGAGGAAGG + Intronic
1142084652 16:88170580-88170602 TGTGATGACGTGGAGGAGGCTGG - Intergenic
1142157093 16:88537582-88537604 GGTGATGGCTTGAGGGAGTAGGG - Intergenic
1142996450 17:3763438-3763460 TGTGATGACTTGCATCAGGAAGG + Intronic
1148205149 17:45775320-45775342 CGTGAGGACAGGAGGGAGGATGG - Intergenic
1148540502 17:48476738-48476760 AGTGCTGCCTTGAAGGACGAGGG + Intergenic
1150708080 17:67506084-67506106 CATGATGATTTGAGGGAGGAGGG - Intronic
1152525676 17:80887098-80887120 GGTGATGTCTGGAGGGAGGAAGG + Intronic
1153725202 18:7947166-7947188 AGTGATGAATTCAAGGAGAAAGG - Intronic
1153892675 18:9532803-9532825 CCTGAGGACTTTAAAGAGGACGG + Intronic
1154354356 18:13613741-13613763 CGTGATGACTGGACGGACTAGGG - Intronic
1156023203 18:32622713-32622735 CGTGATCAATTGAAAGAGAAAGG - Intergenic
1157056792 18:44238944-44238966 GGAAATGGCTTGAAGGAGGATGG - Intergenic
1157500070 18:48184110-48184132 GGTGCTGCCTTCAAGGAGGAAGG - Intronic
1160370552 18:78369153-78369175 CGTGATGATTTAAGGGAGGCAGG + Intergenic
1160872596 19:1283957-1283979 CGAGATCCCTTGAAGCAGGAGGG + Intergenic
1162182280 19:8878307-8878329 AGTGATAAATGGAAGGAGGAAGG - Intronic
1163142825 19:15362036-15362058 CCGGATCCCTTGAAGGAGGAAGG - Intronic
1165466592 19:35978527-35978549 CGTGGTGAAGTGAGGGAGGAGGG - Intergenic
1166876422 19:45900517-45900539 GGTGATGACTTGAGGGAGCAGGG - Intronic
1167524122 19:49973043-49973065 AGTGAGGTCTTGCAGGAGGAAGG + Intergenic
1167693602 19:51001745-51001767 CGTGAAATCTTGAGGGAGGAGGG + Intronic
1167706249 19:51082849-51082871 CTTGATGTCTTGATGAAGGAAGG + Exonic
1168472300 19:56649592-56649614 AGTGAGGACCTGAAGGAGGTGGG + Intronic
925144594 2:1572391-1572413 CGTGATGACTAGCTGCAGGACGG - Intergenic
925903869 2:8527592-8527614 CGAGAGGAGGTGAAGGAGGAAGG - Intergenic
928071209 2:28219297-28219319 ATTGCTGGCTTGAAGGAGGAAGG - Intronic
928435434 2:31251734-31251756 CGTGCTGGCTGGAAGGAGGGAGG - Intronic
929581588 2:43084929-43084951 TTTGATGACTTGAAGAAGGAGGG - Intergenic
930032685 2:47068171-47068193 TTTTCTGACTTGAAGGAGGAAGG + Intronic
930678148 2:54226726-54226748 GGTGAGGACTTAAAGGAGGGAGG - Intronic
931711607 2:64992695-64992717 CATGTTGACTTGGAGGAAGAGGG - Intronic
932705208 2:74019460-74019482 CATGAGGACTTGAGGGAGAAAGG - Intronic
934108390 2:88717443-88717465 CGGGAAGACTTGAAGCAGGGAGG + Intronic
934108930 2:88723899-88723921 CGGGAAGACTTGAAGCTGGAAGG + Intronic
935364541 2:102275545-102275567 CGAGACAACTTGAAGTAGGAGGG - Intergenic
935394186 2:102588157-102588179 CTAGATCACTTGAAGGAGAAAGG - Intergenic
937609739 2:123846414-123846436 AGGGATGACTAGAAGGAGGATGG + Intergenic
939671598 2:145019237-145019259 CATGATTATTTGAAAGAGGAAGG - Intergenic
939905847 2:147913619-147913641 GGTGATCACTTGAAGAATGAGGG + Intronic
944517930 2:200531097-200531119 AGTGATGTCTTTAAGGAGGCAGG + Intronic
945678298 2:212881967-212881989 GATGATGACTTGAATCAGGATGG + Intergenic
947338724 2:229114607-229114629 AGTGAAGGCTTGTAGGAGGAGGG - Intronic
947983503 2:234429270-234429292 CCTGCTGACTTGGAGGAGAAAGG - Intergenic
948443243 2:238011357-238011379 AATGATGAATTGAAGGAGGAGGG - Intronic
1170215838 20:13890113-13890135 TGTGCTGGCTTGAGGGAGGAGGG - Intronic
1170825672 20:19792772-19792794 CGGGGTGATTTGAGGGAGGAGGG + Intergenic
1173528501 20:43750745-43750767 GGAGCTGCCTTGAAGGAGGAGGG + Intergenic
1175573993 20:60046757-60046779 CATGATGAATTGGAGTAGGAGGG - Intergenic
1178265779 21:31141721-31141743 CCTGATGAGTTAAAGGATGACGG + Intronic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1182134556 22:27889161-27889183 CCTGATAACCTGAGGGAGGAGGG + Intronic
1183346644 22:37311817-37311839 CGTGGGGACTTTAGGGAGGATGG + Intronic
1183398235 22:37585486-37585508 GGTGGGGCCTTGAAGGAGGAAGG + Intergenic
1184552929 22:45214524-45214546 CGTAGTGACTTAAAGCAGGAGGG + Intronic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
951322185 3:21258549-21258571 GTTTATGACTTGAAGGAGGATGG + Intergenic
951732217 3:25823012-25823034 AGTGATGACTTCGAGGAGAAAGG - Intergenic
952750813 3:36823429-36823451 CGTGATGAACTGAAGGAGAGAGG + Intergenic
952979953 3:38726655-38726677 CTTGATGACTTGGAGGATGATGG - Exonic
955545386 3:60023092-60023114 AGTTAAGACTTGAAGGAGTATGG + Intronic
956402628 3:68896376-68896398 GGTGATGGCTTGGAGCAGGATGG + Intronic
957030290 3:75232924-75232946 AGTGAAGACTTGTAGGAGGAAGG + Intergenic
957816413 3:85304254-85304276 CTTGATTACATGAAGGAGTACGG - Intronic
958049258 3:88323585-88323607 TGTGATGGCTTGAAGAAAGAGGG + Intergenic
962760050 3:138503190-138503212 GGTGATGGCTAGAGGGAGGAGGG - Intronic
964534146 3:157700960-157700982 GGACATGTCTTGAAGGAGGAGGG + Intergenic
967304739 3:188049583-188049605 AGTGATGCCTTGATGGAGGCAGG + Intergenic
968748276 4:2372387-2372409 GCTGAGGACTAGAAGGAGGATGG - Intronic
979058972 4:116030540-116030562 CATGATGGCATGAAGGAGAAGGG - Intergenic
981636081 4:146880922-146880944 ATTGATTACTTGAAGGGGGAGGG + Intronic
982505608 4:156213602-156213624 CAGGAAGACTTGAAGCAGGAGGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987468022 5:18295703-18295725 CCTGTTGACTTAAAGGTGGAAGG + Intergenic
988102126 5:26693603-26693625 CCTGATGACTGGAAGAAAGATGG + Intergenic
988298440 5:29393390-29393412 CCTGAAGCCTTGAGGGAGGATGG - Intergenic
988848281 5:35152459-35152481 TGTGATGATTTGAAGGTGGGAGG - Intronic
988885719 5:35556047-35556069 GGTGCTGACTTAGAGGAGGAGGG - Intergenic
995434363 5:112119260-112119282 CATAATGAGTTGATGGAGGAGGG + Intergenic
1000489113 5:161886830-161886852 CATGATGGCATAAAGGAGGAAGG + Intronic
1000683060 5:164210658-164210680 CATGATGCCTTAACGGAGGAAGG - Intergenic
1000881576 5:166703869-166703891 CTTGATCACTTGCAGGAGGATGG + Intergenic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1004740177 6:18452401-18452423 GGTTATGACTTGAAGAAGAAAGG + Intronic
1007555460 6:42762036-42762058 CGTGGTGACTGGAAGGCAGAAGG - Intronic
1008544382 6:52572970-52572992 TGTGATGACTTAAAGGTTGAGGG - Intronic
1011358424 6:86497092-86497114 TGTGATGACTTGAGAGAAGAAGG - Intergenic
1014164212 6:118205119-118205141 TGTCTTGACTTGACGGAGGATGG - Intronic
1015195520 6:130521207-130521229 CGTGATGACTGTATGGAGAAAGG + Intergenic
1017150593 6:151275681-151275703 CATGATCACTGGAAGGAGTAAGG + Intronic
1019578993 7:1750880-1750902 CGTGCTGGCTCGATGGAGGATGG - Intergenic
1019597340 7:1864246-1864268 CCTGAACACCTGAAGGAGGAGGG + Intronic
1021288148 7:18808171-18808193 CGTGAAGCAGTGAAGGAGGAAGG + Intronic
1021320451 7:19203959-19203981 TGTGGTGACTGGAAAGAGGAAGG + Intergenic
1021454930 7:20819506-20819528 CTTGTTGAAATGAAGGAGGATGG - Intergenic
1023687604 7:42752503-42752525 AGTGCAGACTTGAAGGAGGAGGG - Intergenic
1024531121 7:50393422-50393444 CAGGATGACATGAAGGGGGAAGG + Intronic
1024550294 7:50557166-50557188 TCTGCTGACATGAAGGAGGAAGG + Intronic
1024570512 7:50719240-50719262 AGTGAAGACTGCAAGGAGGAAGG + Intronic
1026562578 7:71462665-71462687 CGGGAAGACTTGAAGTGGGAGGG + Intronic
1026739177 7:72967954-72967976 AGTTATGACTGGAAGGAGGCAGG - Intronic
1027104554 7:75397119-75397141 AGTTATGACTGGAAGGAGGCAGG + Intronic
1030224396 7:107132699-107132721 TGGGAAAACTTGAAGGAGGAAGG + Intronic
1034996099 7:155578108-155578130 GGTGATGACTTGACTGGGGAAGG + Intergenic
1035817589 8:2557769-2557791 CTTGCTGGCTTGAAGAAGGAGGG - Intergenic
1037947038 8:22996147-22996169 CGTGATGGCCTGGAGGAGGGTGG + Intronic
1041272017 8:56118034-56118056 CGTGATGACTCTAAAGAGAAAGG - Intergenic
1041300920 8:56410454-56410476 CATGCTGATTTGAAGGTGGAGGG + Intergenic
1042349559 8:67763301-67763323 TGTTCTGATTTGAAGGAGGAAGG - Intergenic
1043858530 8:85289016-85289038 CATGAGGACTTGATGAAGGATGG - Intergenic
1046633956 8:116651213-116651235 TGTGGTGACTTGAACTAGGATGG + Intronic
1046753058 8:117945310-117945332 CCTGATGATTTGATTGAGGAAGG - Intronic
1047306763 8:123658989-123659011 GATGATGAATTGATGGAGGAGGG - Intergenic
1048263102 8:132962107-132962129 GGTGATGAAGTGAAGAAGGAAGG + Intronic
1048339053 8:133524989-133525011 CGTGGTGAATGGAGGGAGGAGGG + Intronic
1050330223 9:4538287-4538309 CGTGACAACTTGAAGCAGGCAGG + Intronic
1052243681 9:26307004-26307026 CGTGTTGACTTGAAGTTGGGTGG + Intergenic
1054743047 9:68827856-68827878 CGAGTTTACTTGAAAGAGGATGG + Intronic
1058358384 9:104109423-104109445 GGTGATGGCTTGAACGAGGTTGG - Intronic
1059343373 9:113612292-113612314 CGAGATGACTTGAGAGAGGGAGG + Intergenic
1185565483 X:1092053-1092075 AATGATGACTTGGAGAAGGAAGG - Intergenic
1185880557 X:3736236-3736258 TGTGCTGGCTTGGAGGAGGAGGG - Intergenic
1187007186 X:15244067-15244089 TGTGATGACTTGATCGAGGCAGG - Exonic
1188905453 X:35785963-35785985 CCTGCTGACTTCAAGGAAGAAGG - Intergenic
1189309397 X:40009178-40009200 CGGGATGACTTGGAGGGGGGAGG + Intergenic
1190006920 X:46749154-46749176 CATAAGAACTTGAAGGAGGAGGG + Intronic
1192759082 X:74077109-74077131 TGTGATCATTTGAAGGAGAAGGG + Intergenic
1193942494 X:87692944-87692966 CCTGGTGACTAGAAGAAGGATGG - Intergenic
1194193641 X:90866061-90866083 TGTGATCATTTGTAGGAGGAGGG - Intergenic
1194915977 X:99709146-99709168 GTTGATGGCTTGAAGAAGGAAGG - Intergenic
1196921231 X:120587182-120587204 AATGATGACTTGAACCAGGATGG + Intergenic
1198919579 X:141710217-141710239 GGTGAAGACATGAAGGAGAATGG - Intergenic
1199766572 X:150945797-150945819 GGTGATGTCTTGATGGGGGAAGG + Intergenic
1200540251 Y:4448443-4448465 TGTGATCATTTGTAGGAGGAGGG - Intergenic
1200784596 Y:7249116-7249138 TGTGCTGGCTTGGAGGAGGAGGG + Intergenic
1200945076 Y:8826899-8826921 GGTGAAGACCTGAAGGAGAATGG - Intergenic
1201424000 Y:13829787-13829809 TGTGATGCTTTGAGGGAGGAAGG + Intergenic
1201690890 Y:16763196-16763218 CTTGATGAGTTGAAAGAAGAAGG + Intergenic