ID: 1090466381

View in Genome Browser
Species Human (GRCh38)
Location 11:126938131-126938153
Sequence CTACTTTGCCAGGTAGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090466381 Original CRISPR CTACTTTGCCAGGTAGGTAT AGG (reversed) Intronic
900929015 1:5724607-5724629 TTACTTAGCCAGGAAGGTTTGGG - Intergenic
905696681 1:39979782-39979804 CTATTTTGCCAGGCATATATGGG - Intergenic
906665605 1:47619640-47619662 CTACTTTGGTAGGTAGATTTAGG + Intergenic
912392877 1:109316952-109316974 CTTCTTTGCCTGGTAGGTACCGG - Exonic
912472211 1:109913494-109913516 CTACTGGGCCAGGTAGGTGCTGG + Intronic
913318015 1:117568481-117568503 CTACTTTGCCTGGTTGTTGTAGG + Intergenic
913997131 1:143660777-143660799 CCACTCTGCCGGGTAGGAATGGG - Intergenic
914505124 1:148282005-148282027 CCACTCTGCCACGTAGGAATGGG + Intergenic
914507441 1:148302143-148302165 CCACTCTGCCACGTAGGAATGGG - Intergenic
918263880 1:182822117-182822139 CTTTTTTCCCAGGTAGTTATAGG - Exonic
923777615 1:236994296-236994318 CTACTTCTCTAGGTAGATATTGG - Intergenic
1063872591 10:10434734-10434756 CAACTTTGCCAGGTAGTGATAGG - Intergenic
1064759720 10:18605417-18605439 CAACTTTGCCAGTCAGGAATGGG - Intronic
1067777575 10:49174644-49174666 CAGCTTTGCCAGGTAGGTTTGGG - Intronic
1071036473 10:81252566-81252588 CTACTTTGCCTGCTAGCTTTGGG + Intergenic
1075673339 10:124279421-124279443 CTATTCTGCCACTTAGGTATGGG - Intergenic
1078856018 11:15206903-15206925 CTACTTTTCCAGGCTGGTCTGGG + Intronic
1080224044 11:29940084-29940106 CTGCTTTGGCAAGTAGATATTGG + Intergenic
1081028492 11:38046789-38046811 ATAGTTTGGCAGGTAGGTGTTGG + Intergenic
1083733617 11:64667370-64667392 CTACTTTGCCATGGAGCTATTGG - Exonic
1087196264 11:95307096-95307118 CTACTCTGCCATCTAGGTATTGG - Intergenic
1089224215 11:116902321-116902343 TTACTTTGCCAGGGAGGTGAAGG + Intronic
1090466381 11:126938131-126938153 CTACTTTGCCAGGTAGGTATAGG - Intronic
1090475340 11:127015090-127015112 CTACCCTTGCAGGTAGGTATAGG + Intergenic
1095628325 12:44344128-44344150 CTACTATGCCAGGGAAATATAGG + Intronic
1096766609 12:53896033-53896055 CTCCTTTGCTTGGTAGGTTTAGG - Intergenic
1097266750 12:57750317-57750339 CTACTTTGGGAGGTAGGGGTGGG + Intronic
1100904658 12:99284112-99284134 CTACTTTACTAGGTAAGTTTCGG - Intronic
1108465557 13:50711793-50711815 CTGCTTTCTCATGTAGGTATAGG - Intronic
1109008571 13:56910077-56910099 CAACTTTGCCAGGTAGGCGGGGG - Intergenic
1112110537 13:96292643-96292665 CTACTGTGCCAGGTACTAATAGG + Intronic
1112242162 13:97693112-97693134 CTTCTTTGCCAGGTTGTTATAGG + Intergenic
1113142135 13:107165748-107165770 CTAATATAGCAGGTAGGTATTGG - Exonic
1115483511 14:33886165-33886187 CTTTTTTGCCAGCTAGTTATAGG - Intergenic
1118171206 14:63390899-63390921 CTACTTTGTGAGGTTGTTATGGG - Intronic
1119463686 14:74834822-74834844 GGACTTTGCCTGGTAGGTAGGGG + Intronic
1120666006 14:87307749-87307771 CAACTCTGCAAGGTAGGTAAAGG + Intergenic
1124580265 15:30947205-30947227 CAACACTGCCAGGTAGGTTTCGG + Exonic
1127197855 15:56609353-56609375 GTACGTTGCCAGGGAGCTATAGG - Intergenic
1131784762 15:95900147-95900169 AAACCTTGCCAGGTAGATATGGG - Intergenic
1132457732 16:33394-33416 CACCTTTGCCAGGTGGGTTTGGG - Intergenic
1135519466 16:23163442-23163464 CTTCTTTGTCAGGAAGCTATTGG + Intergenic
1139668095 16:68472370-68472392 ATACTTTGTCAGGTAGGTGTGGG + Intergenic
1148609048 17:48951797-48951819 CTACCTTGCCAGGTTGGGAGAGG + Intergenic
1149380745 17:56091191-56091213 CTTCTTTGCTGGGTTGGTATAGG - Intergenic
1149541384 17:57470622-57470644 CTACTCTGCCAGCTAGGTCTGGG - Intronic
1150160485 17:62893957-62893979 TTACTTTCCAAGGTAGGGATGGG + Intergenic
1153459502 18:5318091-5318113 GGCCTTTGCCAGGTAGGCATGGG - Intergenic
1155474161 18:26221431-26221453 CTACTCTGCCATGTAGCCATGGG - Intergenic
1167955037 19:53057759-53057781 CTACTTTGCCATGTGTTTATGGG + Intergenic
925498518 2:4479364-4479386 CAACTTTTCCAGGTAGGTGCTGG + Intergenic
926279079 2:11430339-11430361 CTCCTTTGACTGGTAGGTCTAGG + Intergenic
926279083 2:11430363-11430385 CTCCTTTGACTGGTAGGTCTAGG + Intergenic
926279087 2:11430387-11430409 CTCCTTTGACTGGTAGGTCTAGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
930221242 2:48748841-48748863 CTAATTTGCACTGTAGGTATTGG - Intronic
934742457 2:96734833-96734855 CTACTTTGCTGGGTGGGTGTAGG - Intronic
935195015 2:100808430-100808452 TTACTTTGCCAAGTAGGCAATGG + Intergenic
936167792 2:110138830-110138852 CTGCTTTGCCTGGCAGGCATTGG + Intronic
939279572 2:140044901-140044923 CTCCTATGCAAGGTAAGTATGGG - Intergenic
941753901 2:169164218-169164240 CTTCTGTGCCTGATAGGTATTGG - Intronic
943542344 2:189232258-189232280 CTAATTTCCCAGGTGGGTAAGGG + Intergenic
946026232 2:216673425-216673447 CTGCTTTGCCAGGTGGGTCAGGG + Exonic
946742180 2:222813668-222813690 CTACTTTGGCACCTAGGTTTGGG - Intergenic
1169106361 20:2998634-2998656 CTACCTTCCAAGGTAGGTCTTGG - Intronic
1169281679 20:4272998-4273020 CTACTTTGCACTGTAAGTATAGG + Intergenic
1170643322 20:18175341-18175363 CAACTTTGCCAGCCACGTATTGG - Intronic
1172447735 20:35001958-35001980 ATACTTGGCCAGGTTGGTGTTGG - Exonic
1173084775 20:39905101-39905123 CTACTCTGACAGGAAGGTATAGG + Intergenic
1175375437 20:58520590-58520612 CTTCTTTGCCTGGGAGGTTTGGG + Intergenic
1179999290 21:44987781-44987803 CGACTTGGCCAGGGAGGTGTGGG + Intergenic
1184605972 22:45575119-45575141 CTGCTGTGCCAGGTGGGTGTGGG - Intronic
953252744 3:41261487-41261509 CAACTTTGCCAGGTACTTAGTGG - Intronic
953254141 3:41273348-41273370 CTAGTTTGCCTGGTGGGAATGGG + Intronic
955395873 3:58556870-58556892 CTACTCTGCCAGATTGGTAAAGG + Intergenic
956450186 3:69366480-69366502 CTCCCCTGCCAGGTAAGTATAGG + Intronic
957436772 3:80187595-80187617 CTACTGTGACAGGAAGGTGTCGG - Intergenic
962706223 3:138047245-138047267 CAACCTTGCAAGGTAGGTATTGG - Intergenic
962921122 3:139951496-139951518 CTGCTTTGCCAGTTAAGCATGGG + Intronic
964301747 3:155294989-155295011 CAACTTTGCCAGGTAAGCAAGGG - Intergenic
974821887 4:67077437-67077459 GTACTTTGCAAGGGAGGTGTCGG - Intergenic
974962003 4:68714234-68714256 CTACTATTCCAGGTAGTTCTTGG + Intergenic
977314816 4:95432571-95432593 CTGCTTTTCCAGGAAGGTAGGGG - Intronic
980599087 4:134995822-134995844 CTGTTTTCCCAGGTAGTTATGGG - Intergenic
985480229 5:105577-105599 CTGCTTTGCCAGGTCTGTCTGGG - Intergenic
987127472 5:14827906-14827928 CAACATTCCCAGGTAGGTGTAGG + Intronic
989861988 5:46389287-46389309 CTACATTTCCAGCTAAGTATGGG + Intergenic
990724021 5:58733456-58733478 CTAATTTGCCAGATATCTATTGG + Intronic
991468990 5:66947516-66947538 TTACTTTGCCATCTAGATATTGG + Intronic
1001759695 5:174197211-174197233 AGACTTTGCCAGGCAGGTAGAGG + Intronic
1003615492 6:7651607-7651629 CAAGTTTCCCAGATAGGTATGGG + Intergenic
1003992812 6:11503652-11503674 CTCATTTACCAGGTAAGTATTGG + Intergenic
1004237492 6:13887302-13887324 CTACTTTACTAGGTAGCTGTGGG - Intergenic
1006256576 6:32837526-32837548 CTCCTTTGGCAGGTAGGTGGTGG - Exonic
1006782209 6:36639653-36639675 CTCCCCTGCCAGGTAAGTATAGG + Intergenic
1012568567 6:100693639-100693661 CTACTTTGTCATGTATGCATTGG - Intronic
1012622476 6:101362981-101363003 CTACTTCATCAGGTAGGGATGGG + Intergenic
1014502630 6:122211645-122211667 CTCCCCTGCCAGGTAAGTATAGG - Intergenic
1021457247 7:20843234-20843256 CTACATTGTCAGATATGTATTGG - Intergenic
1021909002 7:25365421-25365443 CTCCCTTGCCAGGAAGGTCTTGG + Intergenic
1023107735 7:36779184-36779206 CTACCTTTGCAGGTAGGGATGGG + Intergenic
1026483641 7:70799442-70799464 CGACCTTGCAAGGCAGGTATAGG + Intergenic
1028328768 7:89561624-89561646 CAACCTTACCAGCTAGGTATAGG - Intergenic
1030550485 7:110953020-110953042 TACCTTTGCTAGGTAGGTATTGG - Intronic
1043880447 8:85536279-85536301 CTATTTTGACATGTAGGAATAGG + Intergenic
1044387180 8:91602880-91602902 CAATTTTGCCAGGTAGGAAACGG + Intergenic
1044626265 8:94237037-94237059 CTATGTGGCCAGGCAGGTATCGG - Intergenic
1047147751 8:122223840-122223862 CTAATTTGCCATGTGGGGATAGG - Intergenic
1047843954 8:128785742-128785764 CAACTTTGCCAGGTAGCATTAGG + Intergenic
1048477866 8:134759336-134759358 CTACTGAGCCAGGTAGATTTGGG + Intergenic
1052353966 9:27485272-27485294 CTACCTTGCCAGGTTGTTGTTGG - Intronic
1052476434 9:28966421-28966443 CAACTTTGTCAGGTAGGCAGTGG + Intergenic
1057001297 9:91512504-91512526 CTTCATTGCCAGGTAGGCAGGGG - Intergenic
1062326228 9:136013853-136013875 CTTCTTTGACAGGTAGGTCGGGG - Exonic
1062736393 9:138139901-138139923 CACCTTTGCCAGGTGGGTTTGGG + Intergenic
1189601184 X:42628252-42628274 CCATTTTTCCAGGTAGGTCTAGG - Intergenic
1190478285 X:50849840-50849862 GAACTTTGCCAGGTTGATATTGG - Intergenic
1200398631 X:156006006-156006028 CACCTTTGCCAGGTGGGTTTGGG + Intronic
1200460638 Y:3450116-3450138 CTGCGTTCCCAGGGAGGTATCGG + Intergenic
1201018249 Y:9625846-9625868 CTTCTTGGCCAGGTAGGGAGAGG + Intergenic