ID: 1090468752

View in Genome Browser
Species Human (GRCh38)
Location 11:126959482-126959504
Sequence CAAGTATAGCATGCAGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090468752_1090468756 24 Left 1090468752 11:126959482-126959504 CCTCACTCTGCATGCTATACTTG 0: 1
1: 0
2: 1
3: 14
4: 141
Right 1090468756 11:126959529-126959551 TCCCAAGACCACACTTATGTTGG 0: 1
1: 0
2: 1
3: 8
4: 101
1090468752_1090468753 0 Left 1090468752 11:126959482-126959504 CCTCACTCTGCATGCTATACTTG 0: 1
1: 0
2: 1
3: 14
4: 141
Right 1090468753 11:126959505-126959527 AATAATCCCACTTTCTTCAATGG 0: 1
1: 1
2: 2
3: 34
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090468752 Original CRISPR CAAGTATAGCATGCAGAGTG AGG (reversed) Intronic
900716822 1:4150417-4150439 CAAGAAAAGCCTGGAGAGTGGGG + Intergenic
901700584 1:11043156-11043178 CAAGTGTGGGAGGCAGAGTGGGG - Intronic
905213007 1:36387085-36387107 CAAGTGCTCCATGCAGAGTGTGG - Intergenic
905886233 1:41493563-41493585 CTGGTATAGGAGGCAGAGTGGGG + Intergenic
908831118 1:68179484-68179506 CAATTATATCTGGCAGAGTGAGG - Intronic
912714873 1:111975988-111976010 CAAGTATGGAGTGCTGAGTGTGG - Intronic
913199348 1:116483605-116483627 CAAGAATAGCAGGCAGGGTCTGG - Intergenic
916773263 1:167935240-167935262 GAAGTAAAGCATGCAGTTTGGGG + Intronic
917080220 1:171250252-171250274 CAAGTATTGCATGAAAACTGAGG - Intronic
919151085 1:193699987-193700009 CATGTATATAATGCAGAGAGAGG - Intergenic
922191609 1:223323605-223323627 CAGGTACAGGATGCAGGGTGAGG + Intronic
924153983 1:241156975-241156997 CAAGTACAGGAAGCAGACTGTGG - Intronic
1071339597 10:84632054-84632076 AAAGTATAGCATGTACAGTTAGG + Intergenic
1071924624 10:90391804-90391826 TCAGTATAGCATGCAGAAAGTGG - Intergenic
1075482208 10:122791490-122791512 CAAGTATAACCTGTGGAGTGTGG + Intergenic
1075819847 10:125297462-125297484 AAAGTAAAGCATGCTGGGTGTGG + Intergenic
1076545658 10:131244415-131244437 AGAGTGGAGCATGCAGAGTGGGG + Intronic
1078160995 11:8839646-8839668 CAAGCATTACATACAGAGTGGGG + Intronic
1079387273 11:19991601-19991623 CGAGTATAGCATTAAGACTGTGG + Intronic
1083495414 11:63047791-63047813 CAAGTGTAGCATTCAGTTTGTGG + Intergenic
1085342925 11:75745140-75745162 CAAGTACAGCATGCAAAGAGGGG - Intergenic
1085796853 11:79549667-79549689 CAAGCTAAGCAGGCAGAGTGAGG + Intergenic
1086273671 11:85097878-85097900 AAAATATTGCATGCAGAGTAAGG - Intronic
1086455051 11:86953018-86953040 CAAGGATGGGATGCAGATTGAGG + Intronic
1087372786 11:97305725-97305747 CAAGTAGAGTATACAGAGTAGGG + Intergenic
1089181452 11:116585943-116585965 CAAGATTGGCATGTAGAGTGAGG - Intergenic
1089437155 11:118479035-118479057 TAATCATATCATGCAGAGTGGGG + Intronic
1090468752 11:126959482-126959504 CAAGTATAGCATGCAGAGTGAGG - Intronic
1091539053 12:1442307-1442329 CAAGTAGAGAATTTAGAGTGGGG - Intronic
1095442050 12:42247155-42247177 CGAGTGTAGCATGGAGGGTGGGG + Intronic
1099590640 12:84584398-84584420 AGAAAATAGCATGCAGAGTGAGG - Intergenic
1101158103 12:101946762-101946784 TAAGTATGGCATGCAGGGTGTGG - Intronic
1107190036 13:37570893-37570915 CAAGTATGACATGGAGAGTTAGG - Intronic
1111693890 13:91598715-91598737 CAAGTATATCATGTAAAGTCAGG + Intronic
1115887378 14:37987900-37987922 GAAGTCTAACATGCAGTGTGTGG + Intronic
1116930071 14:50681976-50681998 TAAGTATATCATGGAGAATGGGG + Intergenic
1120566575 14:86066633-86066655 CAAGTATGGAACCCAGAGTGGGG + Intergenic
1122342763 14:101039007-101039029 CAAGTAAAGCAGGCAAAGTAGGG - Intergenic
1127014356 15:54666560-54666582 CAAGTATGGTGTGCAGAATGGGG + Intergenic
1129678631 15:77645669-77645691 CGTGTATGGGATGCAGAGTGCGG - Intronic
1133143635 16:3767241-3767263 GAAGCTGAGCATGCAGAGTGAGG - Intronic
1136632488 16:31497040-31497062 CAAGGACAGCATTCAGAGTTTGG - Intronic
1137555737 16:49469224-49469246 CAGATCTAGCATGCAGTGTGAGG - Intergenic
1140962059 16:79925326-79925348 CAAATATAGCATGCATTGGGAGG + Intergenic
1149468506 17:56897948-56897970 CACCTGTAGCAGGCAGAGTGTGG - Intronic
1203172852 17_GL000205v2_random:166849-166871 GAATTATATCATGCACAGTGAGG - Intergenic
1154312155 18:13275666-13275688 TAAGTAAATCATGCAGAATGGGG - Intronic
1156514814 18:37670722-37670744 CAAGGCTAGCCTCCAGAGTGAGG + Intergenic
1158530223 18:58254174-58254196 CAGCTCTAGCATCCAGAGTGTGG - Intronic
1159200673 18:65180114-65180136 CAAATATAGAATTCATAGTGTGG + Intergenic
1160576241 18:79855567-79855589 CGAGCCTAGCATGCACAGTGGGG - Intergenic
1162515918 19:11147582-11147604 AAAGTATAGCAGGCCAAGTGTGG - Intronic
1162784140 19:13023735-13023757 CAGGGATAGCAAGCAGAGAGAGG - Intronic
1165432880 19:35782444-35782466 GAAGTAGAGCTTGCAGAGGGAGG - Exonic
1167215481 19:48161540-48161562 CGACTACAGCAGGCAGAGTGGGG + Intronic
925013809 2:506550-506572 CAAATACAGCATGCGGAATGTGG - Intergenic
927315543 2:21677000-21677022 TATGTATAGAATGCAGAGTGAGG - Intergenic
929378824 2:41324604-41324626 CAAGAATAGAATGCAGAGGAAGG + Intergenic
929953481 2:46435717-46435739 CAAGAATAGCATGTAGAATATGG + Intronic
931307812 2:61049071-61049093 GAACTATAGCATGCACAGTTTGG + Exonic
935362832 2:102262247-102262269 CAAAAATAGCAATCAGAGTGAGG + Intergenic
937662005 2:124441287-124441309 CAAATATACTATGCAGCGTGAGG + Intronic
939614865 2:144350698-144350720 CAAGTAAAGCCTGGAGAGGGAGG + Intergenic
941812683 2:169769289-169769311 GAAGTATAGAATGAAAAGTGGGG + Intronic
941864113 2:170315858-170315880 CTAGGAGAGCCTGCAGAGTGTGG - Intronic
945340565 2:208648168-208648190 AAACTATAACCTGCAGAGTGTGG - Intronic
945435952 2:209817716-209817738 CAAGGACAGCAGGGAGAGTGTGG - Intronic
945473382 2:210253123-210253145 AAAGAAGAGTATGCAGAGTGAGG - Intergenic
945738003 2:213625354-213625376 CAAGCATATCATGGAGAATGGGG - Intronic
947719980 2:232364416-232364438 TAAGTATGGCATGCAGGGAGTGG - Intergenic
948003217 2:234585641-234585663 CAATTATCTCCTGCAGAGTGCGG + Intergenic
1169749798 20:8980454-8980476 CAAGTGTAAAATGCAAAGTGAGG - Intergenic
1172818770 20:37713068-37713090 CAAGTTCATCATGCTGAGTGAGG - Intronic
1174625573 20:51911781-51911803 CAAGGAAAGCAGGAAGAGTGAGG + Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1185016960 22:48350014-48350036 CATGTACAGCATGAAGACTGTGG + Intergenic
952008428 3:28870640-28870662 CAGGAATAGCATGCAGAAAGGGG + Intergenic
952173445 3:30835253-30835275 GGAGTATAGCATGTAGAATGAGG + Intronic
953224305 3:41002364-41002386 GAAGTAGAGCTTGGAGAGTGGGG - Intergenic
958943882 3:100342671-100342693 CAACTATAGCATAAAGAATGAGG - Intronic
966332947 3:178835562-178835584 CAAGCATAGAATGCAAAGTCTGG + Intronic
970311244 4:14784572-14784594 CAAGTTTAGCATGGAGGGAGAGG + Intergenic
971876587 4:32316657-32316679 CAAGAATAGCAGGCACAATGTGG - Intergenic
973864084 4:55094413-55094435 CAGGTAAAGCATGCAACGTGGGG + Intronic
974599555 4:64059701-64059723 CAAATATAGAATTCAGAGTCTGG - Intergenic
974628859 4:64457630-64457652 CAAGCATAGAAGGCAGACTGAGG + Intergenic
979352162 4:119656769-119656791 CAAGGATAGCAGACAGGGTGAGG - Intergenic
980406681 4:132361995-132362017 CAAGTAAAGAATGCAGAGAGTGG - Intergenic
981078882 4:140618499-140618521 AAAGCAAACCATGCAGAGTGTGG - Intergenic
986068907 5:4263350-4263372 CAATGTGAGCATGCAGAGTGAGG - Intergenic
987696381 5:21338885-21338907 CAAGTACAACATGCAGACTAAGG + Intergenic
988162036 5:27531155-27531177 CAAATATAGAATGCAGAATCTGG - Intergenic
988755820 5:34247661-34247683 CAAGTACAACATGCAGACTAAGG - Intergenic
989078327 5:37588544-37588566 TAAATATAGTATGGAGAGTGGGG - Intronic
989658445 5:43771186-43771208 CAATTATAGCATGGAGAATTTGG + Intergenic
990387012 5:55274923-55274945 ATAGAATAGCATGCTGAGTGCGG + Exonic
990559023 5:56965359-56965381 AAAGTAGAACTTGCAGAGTGTGG - Intronic
991398215 5:66226484-66226506 CAAGTATAGCAAGCTGACTCAGG - Intergenic
991744078 5:69713517-69713539 CAAGTACAACATGCAGACTAAGG - Intergenic
991753629 5:69841719-69841741 CAAGTACAACATGCAGACTAAGG + Intergenic
991795650 5:70293241-70293263 CAAGTACAACATGCAGACTAAGG - Intergenic
991803246 5:70398446-70398468 CAAGTACAACATGCAGACTAAGG + Intergenic
991823451 5:70588785-70588807 CAAGTACAACATGCAGACTAAGG - Intergenic
991832947 5:70716844-70716866 CAAGTACAACATGCAGACTAAGG + Intergenic
991888019 5:71292760-71292782 CAAGTACAACATGCAGACTAAGG - Intergenic
992133624 5:73720422-73720444 CAAAAATAGCAGGCAGAGAGAGG + Intronic
992718814 5:79539179-79539201 GAAGCAAAGCATGAAGAGTGTGG + Intergenic
993385333 5:87255617-87255639 CAGATCTAGCATGCAGAGTGGGG - Intergenic
994683041 5:102913340-102913362 CAAGTATACCATGCTTATTGAGG + Intronic
994845200 5:104980017-104980039 TAAGTATATCATGGAGAATGGGG + Intergenic
996473326 5:123885715-123885737 CAATTATATCATGCAGCGTCTGG + Intergenic
999114161 5:149147859-149147881 TTAGTGTAGTATGCAGAGTGTGG + Intronic
1001467274 5:171978635-171978657 CATGGACAGTATGCAGAGTGAGG + Intronic
1002841592 6:911451-911473 CGAGAAGAGCATGCAAAGTGAGG - Intergenic
1003519811 6:6848620-6848642 AATTTATAGCATCCAGAGTGGGG - Intergenic
1005264632 6:24099043-24099065 CAAGTAAAGCATGCTGCATGTGG - Intergenic
1005554466 6:26959473-26959495 CAAGTACAACATGCAGACTAAGG - Intergenic
1007299753 6:40857932-40857954 CAAGGATAGCATGAAGAGGACGG - Intergenic
1008421752 6:51309029-51309051 CATGTCTAGAGTGCAGAGTGAGG - Intergenic
1009362475 6:62831600-62831622 TAAGTATAGCAGGGAGAGTGAGG - Intergenic
1011492637 6:87908120-87908142 AAAGTATAGCATGAAGATTGGGG - Intergenic
1012438357 6:99238660-99238682 CAAGTATAGAAAGTACAGTGAGG - Intergenic
1012837891 6:104293540-104293562 GAAGAATAGCATGAAGATTGTGG - Intergenic
1013191827 6:107810227-107810249 CCAGTATGGCAGGCAGTGTGGGG - Intronic
1017679035 6:156845263-156845285 AAAGTACAGAATGCAGAATGCGG - Intronic
1023206664 7:37758182-37758204 CAAGTATAACTTGGAGAGTGGGG + Intronic
1024125075 7:46285879-46285901 CAAGACTTGCATGCAGAGTGAGG - Intergenic
1024351846 7:48374514-48374536 CAAGTAGAGCATTCAGAATGAGG + Intronic
1026578265 7:71592604-71592626 TAAATAAAGCATGCAGAGTGAGG + Intronic
1027631024 7:80606549-80606571 TAAGTTTTGCATGCAGACTGGGG - Intronic
1031069851 7:117150111-117150133 CAGGGATATCAGGCAGAGTGAGG - Intronic
1031742013 7:125444644-125444666 CAAGCATTGCAGGCAGATTGGGG - Intergenic
1032095180 7:128934707-128934729 CAATTCTAGATTGCAGAGTGAGG + Intergenic
1032548493 7:132762910-132762932 CAAGGAGAGGATGGAGAGTGTGG - Intergenic
1035352903 7:158258949-158258971 CAACTAAAGGATCCAGAGTGGGG + Intronic
1039551634 8:38447451-38447473 AATGTCAAGCATGCAGAGTGTGG + Intronic
1041881728 8:62759505-62759527 CTAGAATAGCATGAAGAATGTGG + Intronic
1042782608 8:72508757-72508779 CAAATGTATCATGAAGAGTGGGG + Intergenic
1042814082 8:72859254-72859276 CACGTATAGCAAACAAAGTGGGG + Intronic
1045129859 8:99139220-99139242 CCAGTAAAGGAGGCAGAGTGTGG - Intronic
1045296407 8:100875094-100875116 CAAGTCTAGAAGACAGAGTGGGG + Intergenic
1047385941 8:124409338-124409360 CAAATAGTGCAAGCAGAGTGAGG - Intergenic
1050894073 9:10863508-10863530 CAAATATAGCATGCTGACTGGGG + Intergenic
1056870974 9:90277994-90278016 CAATTATAACATGCATAATGGGG + Intergenic
1058268931 9:102944670-102944692 GAAGTATCGCATGCACAGTGAGG - Intergenic
1059045035 9:110857422-110857444 CAAGGAAAGCATGCAGAGTGAGG - Intergenic
1203433263 Un_GL000195v1:111830-111852 GAATTATATCATGCAGAGTGAGG + Intergenic
1187210371 X:17224600-17224622 CAAGTCTGGCAAGCAGAATGGGG - Intergenic
1188723943 X:33557915-33557937 GAAGTTTTGCATACAGAGTGAGG + Intergenic
1189005408 X:36988815-36988837 AAAGTATAGAACACAGAGTGAGG + Intergenic
1189043619 X:37569127-37569149 AAAGTATAGAACACAGAGTGAGG - Intronic
1191979408 X:66909467-66909489 AAAGCATATGATGCAGAGTGGGG + Intergenic
1191996623 X:67102584-67102606 AAAGTATAGGATAAAGAGTGAGG - Intergenic
1194069491 X:89303411-89303433 TAAGTATATCATGAAGAATGGGG + Intergenic
1196003419 X:110810495-110810517 CAAGTACATCATGGAGAATGGGG + Intergenic
1199416223 X:147586092-147586114 CCAATACAGCTTGCAGAGTGAGG + Intergenic
1199664586 X:150086703-150086725 CAAGTCTATCATGCACAGTCTGG + Intergenic