ID: 1090469135

View in Genome Browser
Species Human (GRCh38)
Location 11:126963917-126963939
Sequence CGTTATGGACAAGTGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090469135_1090469142 3 Left 1090469135 11:126963917-126963939 CCCACCTGCACTTGTCCATAACG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1090469142 11:126963943-126963965 GAGGGATGTGTATTTGAGCGAGG 0: 1
1: 1
2: 1
3: 12
4: 135
1090469135_1090469144 5 Left 1090469135 11:126963917-126963939 CCCACCTGCACTTGTCCATAACG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1090469144 11:126963945-126963967 GGGATGTGTATTTGAGCGAGGGG 0: 1
1: 0
2: 0
3: 9
4: 133
1090469135_1090469145 8 Left 1090469135 11:126963917-126963939 CCCACCTGCACTTGTCCATAACG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1090469145 11:126963948-126963970 ATGTGTATTTGAGCGAGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 183
1090469135_1090469143 4 Left 1090469135 11:126963917-126963939 CCCACCTGCACTTGTCCATAACG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1090469143 11:126963944-126963966 AGGGATGTGTATTTGAGCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090469135 Original CRISPR CGTTATGGACAAGTGCAGGT GGG (reversed) Intronic
904466893 1:30713642-30713664 AGTTAAGGAGAGGTGCAGGTTGG + Intronic
906821550 1:48935453-48935475 CGTTATTGGCAAGGGGAGGTAGG + Intronic
908699617 1:66884387-66884409 CATTATGGAAAACTGTAGGTAGG - Intronic
915275309 1:154784311-154784333 CCTTTTGGCCAAGTGCAGCTAGG - Intronic
1068603409 10:58979081-58979103 AGTTAAGGTCAAGTTCAGGTTGG - Intergenic
1076892925 10:133293615-133293637 CCTGATGGACAGGTCCAGGTTGG + Exonic
1079665748 11:23103447-23103469 CTTGATGGAAAAATGCAGGTAGG - Intergenic
1081341067 11:41928446-41928468 CAATATGGACAAGATCAGGTGGG - Intergenic
1082765472 11:57164121-57164143 CGTGATGGAGAAGTGAAGGCTGG - Intergenic
1084455118 11:69263971-69263993 TGCTATGGCCCAGTGCAGGTGGG - Intergenic
1088691481 11:112332179-112332201 CCTTATGGATAGGTGCAGGATGG + Intergenic
1090469135 11:126963917-126963939 CGTTATGGACAAGTGCAGGTGGG - Intronic
1097939988 12:65293687-65293709 CATTATGAACAAGTGCAGTAAGG - Intronic
1100159987 12:91846815-91846837 CCTTAAGGACAGCTGCAGGTGGG - Intergenic
1102329870 12:112019893-112019915 AGGTATGGACAAGTCCAGGACGG + Exonic
1108010287 13:46000171-46000193 CGTTAGGGGCCAGTGCAGCTGGG - Intronic
1111519162 13:89377580-89377602 CATTAAGGACAACTGCAGTTAGG + Intergenic
1111931369 13:94516235-94516257 GATGATGGCCAAGTGCAGGTGGG + Intergenic
1114894301 14:26967256-26967278 CGTCATGCACAGGTGCTGGTTGG + Intergenic
1115401609 14:32967752-32967774 CATTATGGACAACAGCATGTGGG + Intronic
1124006532 15:25799288-25799310 CGTTATGTCCAAACGCAGGTCGG + Intronic
1131571483 15:93541734-93541756 CGTTTTGGTCAAGAGAAGGTGGG - Intergenic
1134085846 16:11356995-11357017 CATTATGGCCAAGCCCAGGTGGG + Intergenic
1141210254 16:81973035-81973057 CGTTATGAACAAGTGAACATTGG - Intergenic
1143724534 17:8836219-8836241 CATTATGGCCAAGGGCAGGATGG + Intronic
1149035159 17:52125589-52125611 TGATTTGGACAAGTGCAGCTTGG - Intronic
1149650426 17:58272980-58273002 AGTCAGGGACAAGTCCAGGTAGG + Intronic
1150980513 17:70136644-70136666 TGTCATGGACAAGTACAAGTTGG - Intergenic
1151721516 17:75859198-75859220 CGCTAAGGAGGAGTGCAGGTTGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
930851422 2:55965284-55965306 TGTTTTGGACAAGTCCAGCTTGG + Intergenic
932491820 2:72127469-72127491 TGTTTTGGAAAAGTGCAGGGAGG + Intergenic
942494520 2:176525819-176525841 TGCTCTGAACAAGTGCAGGTAGG - Intergenic
942794005 2:179794697-179794719 AGTTATGGACAAGTGGATGTTGG - Intronic
1173047836 20:39529482-39529504 CTCTAGGGACAAGTGCAGGAGGG + Intergenic
1175798062 20:61784889-61784911 GGCTATGGGCAAGTGCAGGCTGG + Intronic
1178742728 21:35217668-35217690 CCTGAGGCACAAGTGCAGGTGGG + Intronic
1184120770 22:42448609-42448631 AGGAATGGACAAGAGCAGGTTGG - Intergenic
1184234007 22:43173607-43173629 CCTTATGGACAGGTCCAGGCTGG - Intronic
1184566509 22:45295228-45295250 CAGCATGGACAAGCGCAGGTGGG - Intronic
958919655 3:100090334-100090356 CCTTTTGGAAAAGTGCAGCTGGG + Intronic
960550348 3:118969435-118969457 CGTAAAGGACAGGTTCAGGTTGG + Intronic
970879142 4:20907569-20907591 TGCTATGGACAACTTCAGGTAGG + Intronic
981002440 4:139840659-139840681 CCTTATGAACAGGTGGAGGTGGG + Intronic
986875083 5:12097597-12097619 CGTTCTGTACAATTCCAGGTTGG + Intergenic
987425623 5:17769441-17769463 TGTTATGGAAAAATGCAGCTGGG - Intergenic
988345471 5:30032337-30032359 CATTATAGACAATTCCAGGTAGG - Intergenic
996080406 5:119253010-119253032 TCTTATGGACAAGTGTAGGGGGG - Intergenic
996180188 5:120409330-120409352 CTTTAGGGCCAAGTCCAGGTGGG + Intergenic
999689423 5:154134040-154134062 CCTTTTGGACAATTCCAGGTGGG - Intronic
1001901403 5:175433484-175433506 GGATATGGACAAGTGCAAGGGGG - Intergenic
1012935495 6:105363572-105363594 CATTTTGGACATGTGCAGGAGGG + Intronic
1014914587 6:127130736-127130758 CGGTATGGACAAATGCTGCTTGG + Intronic
1018928068 6:168220868-168220890 CGTTATGGACAAAAGCAACTTGG - Intergenic
1018932373 6:168249792-168249814 CGTCATGGACAGGTGCACTTTGG - Intergenic
1022972228 7:35528715-35528737 CTTGATGGAGAAGTGCAGGATGG + Intergenic
1029601329 7:101565139-101565161 GGTTATGGGCAGGGGCAGGTGGG + Intergenic
1040822174 8:51573647-51573669 CGTTATTGTCAGGTGCAGGTAGG - Intronic
1050168496 9:2791373-2791395 CATTATGGGCAAGAGCAGATGGG - Intronic
1057543280 9:95996568-95996590 TGTTAGGGACTAGTGCAGCTGGG + Intronic
1059998530 9:119937303-119937325 GGCTATGGAGAACTGCAGGTAGG + Intergenic