ID: 1090472083

View in Genome Browser
Species Human (GRCh38)
Location 11:126989756-126989778
Sequence GTGTCTCTCCTGCAGCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090472072_1090472083 19 Left 1090472072 11:126989714-126989736 CCAACAGGGGAACGAAGTCTTAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1090472083 11:126989756-126989778 GTGTCTCTCCTGCAGCATGAAGG 0: 1
1: 0
2: 0
3: 21
4: 241
1090472078_1090472083 -6 Left 1090472078 11:126989739-126989761 CCAACAGGGTTCCCCCGGTGTCT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1090472083 11:126989756-126989778 GTGTCTCTCCTGCAGCATGAAGG 0: 1
1: 0
2: 0
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090472083 Original CRISPR GTGTCTCTCCTGCAGCATGA AGG Intronic
900521193 1:3106279-3106301 GTGTCTCTCCTTCAGCTTCCAGG - Intronic
901640068 1:10688641-10688663 GAGGCTCTCCTGCAGCAAGAGGG - Intronic
902153164 1:14461284-14461306 GGGTCCCTCCTACAACATGAGGG - Intergenic
903288514 1:22292179-22292201 GAGTCTCTCCTTCCACATGAAGG + Intergenic
903814816 1:26057320-26057342 CTGTCTCCCCTGCAGCATTGTGG - Exonic
903943974 1:26950402-26950424 GTGTCTTTCCAGCACCATGCTGG + Intronic
904057264 1:27679675-27679697 CTGTCCCTCCTGCAACATGTGGG + Intergenic
906654980 1:47541585-47541607 GGGTCCCTCCTGAAACATGAGGG - Intergenic
906776056 1:48530646-48530668 GTTTGTCTGCTGCAGCTTGAGGG + Intergenic
906785157 1:48609271-48609293 GTTACTCTCCTGAAGCCTGAAGG + Intronic
909436272 1:75646568-75646590 ATGTCCCTCCTGCAACATGTGGG - Intergenic
909530088 1:76672360-76672382 GTCCCTCTGCTGCAGCAAGAAGG - Intergenic
911404898 1:97424313-97424335 GTTTCCATCCTGCAGCATTATGG - Intronic
912182821 1:107238552-107238574 GTGTCTCTCCCACAACATGTGGG - Intronic
912708892 1:111935712-111935734 CTGTCTCTCCTGCAAATTGAGGG + Intronic
914656997 1:149751284-149751306 GTCTCTCTACTGCATCTTGATGG - Intergenic
914876991 1:151519379-151519401 GGGTCTGACCTGCAGCATGGTGG - Exonic
916187749 1:162149142-162149164 CTGCCTCTCCTGCAGGATGCAGG - Intronic
916880107 1:169012576-169012598 GTGTCTCATCAACAGCATGAAGG + Intergenic
917731204 1:177876790-177876812 GGGTCTCTCCCACAACATGAGGG - Intergenic
917846397 1:179024147-179024169 GTGTCTGTCCTGCAGTATGTGGG + Intergenic
918037814 1:180892937-180892959 GTGTCTCCCCTGCAGCAGCCAGG - Intergenic
919980189 1:202638052-202638074 GTGGCTGTACTGCAGCAGGAAGG - Intronic
920305614 1:205016358-205016380 GTCACTCTCCTGCTGCTTGATGG - Exonic
920578308 1:207079729-207079751 GTGCCTCTCATGCATCAAGATGG + Intronic
921364126 1:214357863-214357885 GTGACTCTCCTCCAGCGCGATGG + Exonic
922322880 1:224503467-224503489 GTGGCTCCCCTGCAGGAGGAGGG + Intronic
923429966 1:233910400-233910422 GAGGCTCTGCTGCAGGATGAAGG + Intronic
923937654 1:238781373-238781395 ATGTGCCTCCTACAGCATGATGG + Intergenic
1062881806 10:985066-985088 GTGTCTCTCCAGCTGTGTGACGG + Intergenic
1063039179 10:2319328-2319350 GTGTTTTACCTGCAGAATGAGGG - Intergenic
1063235232 10:4107409-4107431 TTGTATCTACTGCAGCAGGAAGG - Intergenic
1065446911 10:25812156-25812178 TTGTATCTCATGAAGCATGAAGG + Intergenic
1065693743 10:28360337-28360359 TTCTCTCTCCTGTAACATGACGG + Intergenic
1065911771 10:30312761-30312783 GTCTCTTTCCTGCAGGAAGAGGG + Exonic
1070684438 10:78470514-78470536 GTGCCTCTCTTGCAGAATGTAGG + Intergenic
1071025819 10:81111774-81111796 GGGTCTCTCCTACAACATGTGGG + Intergenic
1072533184 10:96338855-96338877 TTGTCTTTCCTTCAGCACGATGG - Intergenic
1073186061 10:101615640-101615662 GTGACTCTACTGCAGCTGGAGGG + Intronic
1075065880 10:119288594-119288616 GTGTCACTGCTGCAGCAACATGG + Intronic
1076485945 10:130817191-130817213 GTCTCTGTGCTGCAGCATGAGGG - Intergenic
1076674660 10:132141781-132141803 GGGTCTCTCTAGCAGCATGAGGG - Intronic
1077009168 11:372647-372669 TTTTCTCTCCTGCAGCCCGAAGG + Exonic
1079247804 11:18765875-18765897 CTCTCACTCCTGCAGCAGGATGG + Exonic
1080247304 11:30194323-30194345 GTGCCTCTGCCACAGCATGAAGG - Intergenic
1081047064 11:38288867-38288889 GTGTCTCACATGCCACATGATGG - Intergenic
1081284655 11:41252932-41252954 GTGTCCCTCCTACAACATGTGGG + Intronic
1083187824 11:61027649-61027671 GAGTCTCTCCTGCTGCACGCAGG - Intergenic
1083668755 11:64289022-64289044 GTTTCTCTGCTGCAGTATGTCGG + Intronic
1083873256 11:65505236-65505258 TTGTCTCTCCTGCCACAGGAAGG - Intergenic
1084337194 11:68466135-68466157 GTGTTTCTCCTGCTGCATTATGG + Intronic
1084363595 11:68684349-68684371 GAGTCTCTCCCGCGGGATGAGGG + Intronic
1084576602 11:69992696-69992718 GTGTGGCTCCTGCAGCAACAAGG - Intergenic
1085310527 11:75513990-75514012 GTTTCTCACCTGCAAAATGAGGG + Intronic
1086020804 11:82227278-82227300 ATGTCTCTCCTATAGCAGGAGGG + Intergenic
1086064980 11:82734168-82734190 GTGCCTCTCCTGAGGCAAGAAGG + Intergenic
1088537275 11:110874990-110875012 GGGTCTCTCATCCAGCATGGGGG + Intergenic
1089737700 11:120561476-120561498 GTGGCTCTCCAGCAGCAGAAGGG - Intronic
1090225770 11:125071397-125071419 GAGTCCCTGCTGCAGCATGAAGG + Intronic
1090472083 11:126989756-126989778 GTGTCTCTCCTGCAGCATGAAGG + Intronic
1090878709 11:130814635-130814657 GAGTCTATCCTGCAGAATCAGGG + Intergenic
1091216742 11:133906911-133906933 GCGTCTCTCCTGGGGGATGACGG - Intergenic
1092047656 12:5443408-5443430 CTCTCTCTCCTGCTGCATGTGGG - Intronic
1092593524 12:9974879-9974901 ATGTCCCTCCTACAGCATGTGGG - Intronic
1095600319 12:44005745-44005767 GGGTCTCTCCTGTAACATGTGGG - Intronic
1096627971 12:52906832-52906854 GTGTCTCTCCTAGAGAAGGATGG - Intronic
1098036263 12:66305306-66305328 GTTTCTCATCTGTAGCATGAAGG + Intronic
1100692378 12:97052117-97052139 GGGTCTTTCTTGCAGTATGAAGG + Intergenic
1103583395 12:121933381-121933403 GTGTGGCTGCTGCACCATGAGGG + Intronic
1105280768 13:18961399-18961421 GAGTCTGCCCAGCAGCATGAGGG - Intergenic
1107015681 13:35706400-35706422 TTCTCTCTCCTGCAGCCTGCTGG - Intergenic
1109084518 13:57952462-57952484 GAGTCACTCCTACAGCATGTAGG + Intergenic
1112214957 13:97420702-97420724 GTGTCCCTCCCACAACATGAGGG - Intergenic
1113135148 13:107080744-107080766 GTGTGGCTGCAGCAGCATGAGGG - Intergenic
1113154539 13:107304053-107304075 GTGTCACTCCTGAATCATGTAGG - Intronic
1113936658 13:113998478-113998500 GTGCCCCGACTGCAGCATGAGGG - Intronic
1114675878 14:24440170-24440192 CTGGCCCTCCAGCAGCATGATGG + Exonic
1115654258 14:35428186-35428208 GTGCCTCTCATGCACTATGATGG + Intergenic
1115822209 14:37224622-37224644 GAGTCCCTCCTACAACATGAGGG + Intronic
1118311410 14:64696335-64696357 GTGTCTCTTCAGGAGCATGGTGG - Intergenic
1118806399 14:69240955-69240977 GCGGCTCTCCAGCTGCATGAGGG - Exonic
1119131647 14:72178332-72178354 GTGTCCCTCCTGCAGAAGGCTGG - Intronic
1119406330 14:74401889-74401911 TTGTCTCATCTGTAGCATGAGGG + Intergenic
1119992555 14:79215684-79215706 GAGTCCCTCCCGCAACATGAGGG + Intronic
1120213022 14:81653035-81653057 GGGTCTCTCCTGCAACATGTGGG - Intergenic
1120825963 14:88955723-88955745 GTGTCTCTCCTGCTGCTGGAAGG + Intergenic
1121689725 14:95868679-95868701 GAGGCTCTCCTTCAGCGTGACGG + Intergenic
1122201128 14:100123430-100123452 ATGTCTCTTCTGCAGCCAGAAGG + Intronic
1123947596 15:25246307-25246329 GTGGGTCTCCTGGAGCCTGATGG + Intergenic
1124495800 15:30186097-30186119 GTGGCTATACTGCAGCAGGAAGG - Intergenic
1124495986 15:30187425-30187447 GTGGCTATACTGCAGCAGGAAGG - Intergenic
1124747588 15:32351222-32351244 GTGGCTATACTGCAGCAGGAAGG + Intergenic
1124747773 15:32352549-32352571 GTGGCTATACTGCAGCAGGAAGG + Intergenic
1126333420 15:47559223-47559245 GTGTTTCTCTTCAAGCATGACGG + Intronic
1126935247 15:53699878-53699900 GTGGCTCTCCTTCACCTTGAGGG - Exonic
1127118948 15:55754626-55754648 GTGCCTCTAATGAAGCATGAAGG - Intergenic
1129129824 15:73483795-73483817 GTGTATCTGCTGCAGCCTGGAGG + Intronic
1130416747 15:83701532-83701554 GGGTCTCTCCCACAGCATGTGGG - Intronic
1130935469 15:88467145-88467167 GCGTCTCTACTGCAGCAGGTGGG - Exonic
1131116554 15:89799662-89799684 GCGTCTCCCCAGCAGCTTGAGGG - Intronic
1132404041 15:101531459-101531481 GTGACTCTCCTGCAGCCTTGGGG + Intergenic
1132985807 16:2766964-2766986 ATGTCTGTCCTGCAGCAAGCCGG + Exonic
1132990304 16:2789043-2789065 TTGTCTCCCCTCCAGCATCAGGG + Intergenic
1133736220 16:8617799-8617821 GTGTCTGTCCTGACGCATGGAGG + Intergenic
1133825595 16:9275467-9275489 GTGTATCTCCTCCAGTATGTGGG + Intergenic
1133902273 16:9988230-9988252 GTGTCTCTCCTGAACACTGAAGG + Intronic
1135707731 16:24689223-24689245 GTGTCTATGTTGCAGCTTGATGG - Intergenic
1137537480 16:49338345-49338367 ATATCTCTCCTGCAGCCAGACGG + Intergenic
1137581567 16:49636677-49636699 GTGCTTCTCCAGCAGGATGATGG + Exonic
1139472464 16:67185461-67185483 GTGTCTGTCCTGCAGCTGGACGG - Exonic
1140745302 16:77975553-77975575 GTGTGTGTCCTGCAGCATGCTGG - Intronic
1141352385 16:83309923-83309945 GTGGCTCTCCCTCAGCATAAAGG + Intronic
1142013552 16:87730506-87730528 CTTTCTCTCCTGAAGCATTAAGG - Intronic
1142840096 17:2622091-2622113 GGGTCTCTCCTGCAACACGTGGG + Intronic
1144390857 17:14792122-14792144 GTGTTTCTCTTGCATCTTGAAGG + Intergenic
1144848353 17:18231594-18231616 GAGTCTCTCCTCCCTCATGATGG + Intronic
1147298949 17:39508521-39508543 CTCTCTCTCCTCCTGCATGAAGG - Intronic
1147377738 17:40032940-40032962 GGGTTTCTCCTGCTCCATGATGG - Intronic
1153747563 18:8195578-8195600 ATGTCTTTGCAGCAGCATGAAGG + Intronic
1155665893 18:28307756-28307778 GGGTCCCTCCCACAGCATGAGGG - Intergenic
1157370820 18:47109701-47109723 GGGTCTGACCTGAAGCATGAAGG - Intronic
1157729725 18:49993033-49993055 GTATTTCTTCTGCAGCATCAGGG + Intronic
1157817931 18:50743887-50743909 CTATTTCTCCTTCAGCATGAGGG + Intergenic
1159437970 18:68442949-68442971 GTGTCTTTATAGCAGCATGATGG + Intergenic
1161409409 19:4108604-4108626 GTCTCCCTCCTGCAGCCTGGTGG + Intronic
1162375061 19:10299969-10299991 GTGTCTGTTCTGAATCATGATGG - Intergenic
1164208650 19:23078377-23078399 ATGTCTCACCTGCAGCCTTAAGG - Intronic
1164813602 19:31177311-31177333 ATGTCTCTCCTGCAGCTTCTGGG - Intergenic
1165110243 19:33498058-33498080 GTGTCCCTCCCGCAGCGGGAGGG + Intronic
1165621591 19:37252761-37252783 GTGTCTCACCTCCAGCCTTAAGG + Intergenic
1165726196 19:38114773-38114795 GTGGCACTCCTGGGGCATGAAGG + Intronic
1168438109 19:56338492-56338514 ATGTCTCACCTTCAGCATGTTGG - Intronic
927320084 2:21733459-21733481 ATGTCCCTCCTGCAACATGTGGG + Intergenic
927358139 2:22198592-22198614 GTGTCTCTCTTGCAAAATGTAGG + Intergenic
932187551 2:69711921-69711943 GGGTCTCTACTGCAGCAAAAAGG + Intronic
933547708 2:83736356-83736378 GTGGCTCTCCAGCAGCAGCAAGG - Intergenic
934571312 2:95374834-95374856 GGGACACTCCTGCAGCAGGAAGG - Exonic
936051402 2:109226836-109226858 GTTTCTCTCCTGCAGCTGTAGGG - Intronic
937826556 2:126373386-126373408 GTGTCTCTCCGGCATCATTCTGG + Intergenic
938546057 2:132332739-132332761 AAGTCTCACATGCAGCATGATGG - Intergenic
940193054 2:151062711-151062733 GGGTCTCTCCCGCAACATGTGGG + Intergenic
942764597 2:179439789-179439811 GTTTCTCTCCTAAAGCATCATGG + Intergenic
943284048 2:185974322-185974344 GTCTCTCTCCTGCTTCATCATGG - Intergenic
943328876 2:186535188-186535210 CTCTCTCTCCTGCATCATAAGGG - Intergenic
945180969 2:207090793-207090815 ATGTCTCTCCTGCAGGGTGCTGG - Intronic
945916287 2:215707908-215707930 CTGTCTCTGCTGCAACATGGTGG + Intergenic
947324880 2:228963203-228963225 GTGTCTCTAATCCACCATGATGG + Intronic
948365486 2:237451992-237452014 GGGTCTCAGCTGCAGCAGGAAGG - Intergenic
1171349600 20:24492479-24492501 GTGGCTCCCCTGCAGGATAAAGG + Intronic
1171874921 20:30565472-30565494 AAGTCTCACATGCAGCATGATGG - Intergenic
1172763896 20:37340695-37340717 GGGCCTCTTCTGCAGCCTGAGGG + Intergenic
1175568218 20:59997905-59997927 TTGTCTTCCCTGCGGCATGAAGG + Intronic
1177783942 21:25649508-25649530 GTGTCTCTCCCACAACATGTGGG + Intronic
1177937327 21:27365849-27365871 GAGTCTCTGCTGCAGCAAAAGGG + Intergenic
1179510787 21:41871859-41871881 CAGTCTCTCCTGTAGCATGCCGG + Intronic
1179604977 21:42509307-42509329 CTGTCTGTCCTACAGCATCAGGG - Intronic
1180091547 21:45536086-45536108 GGGCCTCTCCTGCAGCCAGAGGG + Intronic
1180195566 21:46191602-46191624 GGGTCTGTCCTGCAGCAAAAAGG + Intronic
1181872642 22:25912302-25912324 GTGACTTTCCTTCAGCATCAGGG + Intronic
1182143470 22:27982399-27982421 CTGTCCCTGCAGCAGCATGACGG - Exonic
1184636273 22:45834528-45834550 AACTGTCTCCTGCAGCATGAAGG + Intronic
1185250888 22:49801106-49801128 GTGTCTGTCCTGTGGCATGCTGG - Intronic
1185373000 22:50469511-50469533 GTGTGGCTCCCGCAGCAGGACGG + Intronic
949702856 3:6779398-6779420 GTGTCTGTCCTGCAGCCACACGG - Intronic
949861608 3:8510244-8510266 GTGGCTCTCCTCCAGGATGAGGG - Intronic
950132565 3:10557426-10557448 GTGCCCCTGCTGCAGCATGATGG + Intronic
950236496 3:11326075-11326097 CTTTCTCTCCTGCAAGATGAAGG - Intronic
951909579 3:27735901-27735923 GTATCTTTCCTGCTGCATGTTGG + Intergenic
955035880 3:55267055-55267077 GGGTCCCTCCTGCAACATGTGGG + Intergenic
955530119 3:59864219-59864241 GGGTCTCTCCCACAGCATGTGGG - Intronic
957300769 3:78389150-78389172 GTGTCCCTCCCACAGCATGCAGG - Intergenic
958041276 3:88229785-88229807 GTTTCTCTAGTGCAGCAAGAAGG - Intergenic
959576417 3:107939138-107939160 TTGTCTGTCCTGAAGCCTGATGG + Intergenic
961626013 3:128264297-128264319 GCTACTCTCCTGCAGCATGGAGG + Intronic
962969539 3:140386024-140386046 GAGTTTCACCTTCAGCATGAAGG + Intronic
964107160 3:153051631-153051653 GTGGCTCTCCTGCAGGATCATGG - Intergenic
965711864 3:171563597-171563619 GGGCCTCTCCTGCAGCATGGTGG + Intergenic
966394039 3:179482921-179482943 ATTTCTCTCCTTCATCATGATGG + Intergenic
969070003 4:4528719-4528741 GTGTGTCTCAAGCAGCAGGAAGG + Intronic
970882524 4:20948521-20948543 GTTACACTCCTGCAGCATGCTGG + Intronic
971881304 4:32377335-32377357 GTGTCTCTCCTGCTACTTGAGGG - Intergenic
972086427 4:35222808-35222830 GTGTCTCTCCCACAACATGAGGG + Intergenic
977995689 4:103495835-103495857 GTGTCTCTCCCACAGCACGTGGG - Intergenic
979411320 4:120383498-120383520 GGGTCTCTCCTACAACATGTGGG - Intergenic
980446239 4:132911883-132911905 TTGTCTATCATGGAGCATGAGGG - Intergenic
981412494 4:144449522-144449544 CATTCACTCCTGCAGCATGAAGG - Intergenic
981694754 4:147549135-147549157 GGGTCTATCCCGCAGCATGTGGG - Intergenic
983170112 4:164526029-164526051 GGGTATGTCTTGCAGCATGAAGG - Intergenic
984047013 4:174814040-174814062 GTGGCTCTGCAGCAGCATCAAGG + Intronic
986504971 5:8440316-8440338 GTGTCCCTCCTTCAACTTGAGGG - Intergenic
986872364 5:12064337-12064359 GGGTCTTTCCTGCATCCTGAGGG + Intergenic
991562610 5:67970336-67970358 GGGTCACCCCTGCAGGATGATGG - Intergenic
993589007 5:89770625-89770647 GGGTCTCTCCCGCAACATGTAGG - Intergenic
995449668 5:112286711-112286733 TTCTCTTTCCTGCATCATGAAGG + Intronic
996931585 5:128895864-128895886 TGGACTCACCTGCAGCATGAGGG - Intronic
999687693 5:154117361-154117383 GAATCTCTCCTGCAGTTTGAGGG - Intronic
1000573922 5:162952135-162952157 GGGTCCCTCCCCCAGCATGAGGG + Intergenic
1001419553 5:171576287-171576309 GTGGCTCTCCTCCAGCACGAGGG + Intergenic
1002377495 5:178798651-178798673 GTGTCTCACCTCCAGCCTTAAGG - Intergenic
1004788223 6:18993319-18993341 GTCTCTGCCCTGCAGCAGGAAGG + Intergenic
1005909086 6:30292432-30292454 CTCTGTCTCCTGCAACATGAAGG - Intergenic
1006364527 6:33607586-33607608 GTGACCCTTCTGCAGCATGGAGG + Intergenic
1006854010 6:37120121-37120143 ATCTCTCTCCTGCTGCATTAGGG + Intergenic
1008211078 6:48726752-48726774 GTTCCTCACCTGCAGCAAGAGGG + Intergenic
1009341600 6:62561420-62561442 ATGTTTCTCCTACAACATGAAGG + Intergenic
1012560374 6:100572992-100573014 CTGTCTGTCCCTCAGCATGAAGG + Intronic
1013076869 6:106779594-106779616 GGGTCCCTCCTGCAACATGTGGG - Intergenic
1017055426 6:150431669-150431691 GTTTCTCTCCTGCAGAATATGGG + Intergenic
1017800734 6:157893519-157893541 GTGTCTGTCCTACAACATTAGGG + Intronic
1018558858 6:165079227-165079249 GGGTCTCTCCCACAGCATGTGGG + Intergenic
1019717394 7:2545870-2545892 AAGTCTGTCCTGCAGCAAGATGG + Intronic
1020389060 7:7639808-7639830 GTTTCTCGCCTGTAGAATGAGGG + Intronic
1021040700 7:15858354-15858376 GGGTCCCTCCCACAGCATGAGGG - Intergenic
1021636274 7:22697141-22697163 GAGTCTCTGCTGCAGCCTGAAGG - Intergenic
1022443466 7:30451941-30451963 GTCTCTCTCCTGCAGCCCGGAGG + Exonic
1023592485 7:41794652-41794674 GTGCCCTTCCTGCAGTATGAGGG - Intergenic
1023987539 7:45105477-45105499 GTGTCCCACCTTCATCATGACGG + Exonic
1024299885 7:47878929-47878951 ATGTGTCTCCTGCACCATTAAGG + Intronic
1024495131 7:50037525-50037547 CTGTCTCTCCTGCTCCATCATGG - Intronic
1024973998 7:55096729-55096751 GGGCCTCTGCTGCAGCGTGAGGG - Intronic
1026528585 7:71177098-71177120 GTGTCTCTTCTGGAGCATGTAGG + Intronic
1026671126 7:72391572-72391594 GGGTCTCTCCCACAGCATGTGGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028990644 7:97045640-97045662 GTCTCTCTTCTGCAGCATGCTGG - Intergenic
1030161868 7:106517520-106517542 GGGTCCCTCCTGCAACATGTAGG - Intergenic
1033604817 7:142919157-142919179 GTGTCTCTCCTGGGACATGTGGG + Intronic
1034229300 7:149508755-149508777 GTTTCTCAACTGCAGCAGGAGGG - Intergenic
1034729323 7:153370328-153370350 CTGTCCCTGCTGCAGCAGGATGG + Intergenic
1035326316 7:158068207-158068229 CTGTCACTCCTTCAACATGAAGG + Intronic
1037794987 8:21985568-21985590 GTCTGTCTCCTGCTGCAGGAAGG + Exonic
1038220999 8:25607738-25607760 GTGTTTCTCAGGCAGCAGGATGG + Intergenic
1038914298 8:32003009-32003031 GTGTCTTTCCTACAGCAATATGG - Intronic
1039150733 8:34502436-34502458 GGGTCCCTCCTACAGCATGTGGG + Intergenic
1041957511 8:63572401-63572423 GTGTCTGTGCTGCAGCATCTGGG + Intergenic
1043788551 8:84433501-84433523 GGGTCTCTCCCGCAACATGTGGG - Intronic
1043816893 8:84812656-84812678 CTGCCTCTTCTGCATCATGAAGG + Intronic
1045422610 8:102031148-102031170 CTGTATTTCCTGCAGCATGGTGG - Intronic
1045777470 8:105822634-105822656 CTGTCTCTCCTGCAGAGAGAGGG + Intergenic
1046416681 8:113924209-113924231 GGGTCACTCCTGCATGATGAAGG + Intergenic
1047525812 8:125633268-125633290 GTGACTCTCCCGCAGAAGGAAGG + Intergenic
1048178331 8:132172649-132172671 GTGTTGCTCCTGCACCTTGAGGG + Exonic
1048340700 8:133536566-133536588 ATGTCTCTGCTGCAGCCAGACGG + Intronic
1051376562 9:16408286-16408308 GTGTCTCTCCCAAAGCATCAGGG - Intergenic
1053558475 9:39163181-39163203 CTGTCCCTCCTTCAGGATGAGGG - Intronic
1053822592 9:41983406-41983428 CTGTCCCTCCTTCAGGATGAGGG - Intronic
1054138639 9:61455760-61455782 CTGTCCCTCCTTCAGGATGAGGG + Intergenic
1054607983 9:67203959-67203981 CTGTCCCTCCTTCAGGATGAGGG + Intergenic
1055474008 9:76643522-76643544 GTGTGTCACTTGCAGCAAGATGG + Intronic
1055679997 9:78704925-78704947 GGGTCCCTCCTGCAACATGTGGG - Intergenic
1056831744 9:89923007-89923029 GTCTCTCTCCTGCAGGAAGTGGG - Intergenic
1057517125 9:95731243-95731265 TTGTCTCTCCTGCAAAATGGTGG + Intergenic
1059465779 9:114467900-114467922 GTGTCTTTCCTGGTGCCTGAAGG - Intronic
1060328478 9:122642414-122642436 GTGTCTGTCCTTCAGCACCATGG - Intergenic
1060343215 9:122794723-122794745 GTGTGTGTACTGCAGTATGAGGG - Intergenic
1061420499 9:130470819-130470841 GTCTCTTTCCTGCAGCAACACGG + Exonic
1187767044 X:22654062-22654084 CTGCCGCTGCTGCAGCATGAAGG + Intergenic
1189011245 X:37047853-37047875 GTGTCTCTCCCTCAACATGTGGG - Intergenic
1191120925 X:56904101-56904123 GGGTCCCTCCTGCAACATGAAGG - Intergenic
1192676451 X:73202121-73202143 GTGTCTCTCCCACAACATGGGGG + Intergenic
1194936480 X:99955819-99955841 GTGTATCTCCTGCCTCTTGAGGG - Intergenic
1196369965 X:114966546-114966568 ATGTCTCTGTTGAAGCATGATGG + Intergenic
1197613584 X:128666372-128666394 GTATCTCACCTACAGAATGAGGG + Intergenic
1199762876 X:150918570-150918592 ATGACTCTCCTCCCGCATGAGGG + Intergenic