ID: 1090472579

View in Genome Browser
Species Human (GRCh38)
Location 11:126993381-126993403
Sequence TTGTATTTGCATACACTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090472577_1090472579 14 Left 1090472577 11:126993344-126993366 CCATGGCTTCTGAACATATCGCA 0: 1
1: 0
2: 2
3: 9
4: 86
Right 1090472579 11:126993381-126993403 TTGTATTTGCATACACTGTAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1090472575_1090472579 26 Left 1090472575 11:126993332-126993354 CCATCATACTGCCCATGGCTTCT 0: 1
1: 0
2: 3
3: 16
4: 198
Right 1090472579 11:126993381-126993403 TTGTATTTGCATACACTGTAAGG 0: 1
1: 0
2: 1
3: 18
4: 212
1090472576_1090472579 15 Left 1090472576 11:126993343-126993365 CCCATGGCTTCTGAACATATCGC 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1090472579 11:126993381-126993403 TTGTATTTGCATACACTGTAAGG 0: 1
1: 0
2: 1
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090472579 Original CRISPR TTGTATTTGCATACACTGTA AGG Intronic
901932478 1:12604437-12604459 CAGTATTTGCATACAATGAATGG - Intronic
903094871 1:20961614-20961636 ATGAATTTGTATACACTATATGG - Intronic
905747219 1:40428345-40428367 TTGTATTTCCATACACATTTTGG + Intergenic
909217455 1:72908531-72908553 TTGTAGGTGCTTACACTGTTAGG + Intergenic
909572308 1:77129217-77129239 TTGTATATGCATACCCTTGATGG - Intronic
910048900 1:82953812-82953834 ATTTATTTGCATTCACTCTAAGG + Intergenic
910607573 1:89103560-89103582 TTGTATTTGCATTGTCAGTATGG - Intergenic
915375107 1:155387299-155387321 TTGTTTTTGTATATGCTGTAAGG + Intronic
915741171 1:158119352-158119374 CTGTATTTGGAAACACTGTAAGG - Intergenic
916477557 1:165184474-165184496 TTCCATTTGCATACACTTAAGGG + Intergenic
917388614 1:174506667-174506689 TGATATATGCATACACTGTAAGG - Intronic
919268228 1:195302745-195302767 TTGCATTTGGATCCACTGTCTGG + Intergenic
923216001 1:231848303-231848325 TTCTATGTGCAAACACTGCAGGG - Intronic
924392101 1:243572875-243572897 TTGTTTTTGCAGAGACTATAGGG - Intronic
1064885990 10:20113223-20113245 TTGTAATACCTTACACTGTATGG + Intronic
1065356199 10:24844392-24844414 ATGTATGTGCACACACTGTCTGG + Intergenic
1066285090 10:33958195-33958217 TTGTATCTTCATACAATGTGGGG + Intergenic
1069509271 10:69029399-69029421 TTGTATCTGCATTCAATGTAAGG + Intergenic
1070052162 10:72899976-72899998 TTGGATTTGCAGAAACTCTATGG + Intronic
1071238612 10:83678739-83678761 TGTTATTTGCAAACACTGTGGGG + Intergenic
1074912647 10:117925491-117925513 TGGTATTTTTATACACGGTATGG + Intergenic
1080758075 11:35221245-35221267 TTGTTTTTTAATACAATGTAAGG + Intronic
1081541642 11:44038900-44038922 TTGAATTTGCAGTCTCTGTAAGG + Intergenic
1086944680 11:92833160-92833182 TTGTATTTTCATAGACTGTATGG + Intronic
1087942365 11:104114044-104114066 TTGTCTTTGCATTCTCTTTATGG + Intronic
1088384877 11:109242531-109242553 TTGTAATTCCATACAGTGTGTGG + Intergenic
1090472579 11:126993381-126993403 TTGTATTTGCATACACTGTAAGG + Intronic
1092128850 12:6094323-6094345 TTATAGTTGCAGACACTGAAGGG - Intronic
1092282783 12:7109915-7109937 TTGTGTGTGCATACAACGTAAGG - Intergenic
1093298578 12:17423733-17423755 GTGTATTTGCATATATTGTTGGG + Intergenic
1093487887 12:19671850-19671872 TTGTGTTTGCATAAACCATATGG - Intronic
1093492761 12:19724213-19724235 TTGATTTTGTATACAGTGTAAGG - Intergenic
1094784093 12:33825544-33825566 TTGTCATTGCATACCCTGTTGGG - Intergenic
1095251991 12:39989721-39989743 TTGCATAAGAATACACTGTAGGG + Intronic
1096444778 12:51679536-51679558 TTGTTTTAACAGACACTGTATGG + Intronic
1099867094 12:88296521-88296543 TAGTATTTTGATACAATGTATGG + Intergenic
1100853172 12:98734811-98734833 TTTTATTTGTACACACTGTTAGG + Intronic
1101581364 12:106044452-106044474 ATGTATATGTATACACTTTAGGG + Intergenic
1103377158 12:120466198-120466220 TTTTATTTCCATAGACTTTATGG - Intronic
1103425316 12:120829131-120829153 CTGTTTTTGCATACAGTGTGAGG - Intronic
1103813282 12:123633099-123633121 ATGTATTAGCATAGACTGTCTGG - Intronic
1105814608 13:24023288-24023310 GTGTATTTGCATACACACCATGG - Intronic
1106656767 13:31754943-31754965 TTCTATTTTCTTACATTGTATGG + Intronic
1108116953 13:47139238-47139260 TTTAAATTGCATACACTATAGGG + Intergenic
1108371201 13:49770690-49770712 TGGTTTTTGCATACTGTGTAAGG + Intronic
1109305994 13:60642568-60642590 ATGTATCTGTATATACTGTAGGG + Intergenic
1109430498 13:62227310-62227332 TAGTATTTACTTTCACTGTATGG + Intergenic
1110904752 13:80872475-80872497 TAGTATTTGCATACAAAGTTAGG - Intergenic
1111146583 13:84189861-84189883 TTCTATTTCCATAAAATGTAAGG - Intergenic
1111421964 13:88023071-88023093 ATGTATTTGCATGAACTGTAAGG - Intergenic
1111484212 13:88874409-88874431 TTGAATTTGCCTACATTTTATGG + Intergenic
1115108448 14:29789875-29789897 TTGTGTCTGCATACACTATCAGG - Intronic
1118682169 14:68253437-68253459 TTGTATTGGCTTATACAGTAAGG + Intronic
1124356883 15:29002345-29002367 TTGCATTTCCATACAGTCTAGGG + Intronic
1125307813 15:38341319-38341341 TTCTATTTGCCTACACTATTAGG + Intronic
1125676518 15:41505063-41505085 TTTTTTTTGCCTACTCTGTAGGG - Exonic
1127204205 15:56695886-56695908 ATGTATTTGCAAATACTATAGGG + Intronic
1127852943 15:62930270-62930292 TTGTATTTTCATACTATTTATGG + Intergenic
1129896298 15:79109361-79109383 TTTTTTTTGTATACAGTGTAAGG - Intergenic
1131632325 15:94191617-94191639 TTCTATTTGGTTACACTATATGG - Intergenic
1133628371 16:7593419-7593441 GTGTATTTGCATACCCAATATGG + Intronic
1134035777 16:11030197-11030219 CTGTATGGGCATACATTGTATGG - Intronic
1135737955 16:24947972-24947994 CTGTATTTGAAAACACTTTATGG + Intronic
1135832747 16:25790847-25790869 ATGTTTTTTCATACACTCTATGG + Intronic
1137451146 16:48575634-48575656 TAGTATTGGCATACACTAAAGGG + Intronic
1138483896 16:57323283-57323305 TTGATTTTGTATATACTGTAAGG - Intergenic
1141270566 16:82536927-82536949 TTATATTTACTTACACTCTAGGG - Intergenic
1144671610 17:17135924-17135946 TTGTTCTTGCATTCACTGTAAGG + Intronic
1148391760 17:47277685-47277707 TAGTATTTCCCTCCACTGTAGGG - Intronic
1148762480 17:50014020-50014042 TTGTATTTTCATACACTCATGGG - Intergenic
1149024131 17:52005141-52005163 TTGTATTTTCCTACATTTTATGG - Intronic
1150494188 17:65594659-65594681 TTGTGGTTGCAAACACTGTCAGG - Intronic
1150741769 17:67784854-67784876 TTGTATATGCATACGCTTGATGG - Intergenic
1155685859 18:28549435-28549457 TTGTATTTCAATAAACAGTAAGG + Intergenic
1155849236 18:30750176-30750198 TTGTATTTGTGTATACTGTTTGG + Intergenic
1156775950 18:40789153-40789175 TTGTATTGTATTACACTGTATGG + Intergenic
1157031435 18:43913617-43913639 TGCTATTTTCATACACTTTATGG - Intergenic
1157131093 18:45008073-45008095 TTGCATTAGCATATACTGGAGGG - Intronic
1157172024 18:45416260-45416282 TTTTTTTTGCATACACAGCAAGG + Intronic
1157645663 18:49267316-49267338 ATGTATTTTCATATACAGTATGG - Intronic
1158957840 18:62557997-62558019 GTTCATTTGCATACACTGTTGGG + Intronic
1159114520 18:64098918-64098940 TTGAAGTTTCATACAATGTAAGG + Intergenic
1159435414 18:68410549-68410571 TTGCATTTGCATATAGTGCATGG - Intergenic
1160197580 18:76769308-76769330 TTGTATTTTCATACTTTGTACGG + Intergenic
1163602706 19:18258383-18258405 TTGTCTTTGCACATACTGTAAGG + Intronic
1165177554 19:33941297-33941319 TTGTATTTGCATCCCCTGGGGGG - Intergenic
1167304922 19:48702667-48702689 CTGTATATGTATACAATGTATGG + Intronic
928024693 2:27730036-27730058 GTATATTTGCATACACTTGAGGG + Intergenic
928675504 2:33647156-33647178 GTGTATTTGCATAGAGAGTATGG - Intergenic
928992527 2:37249193-37249215 ATGTACTTGCATACAAAGTAAGG + Intronic
930147670 2:48023875-48023897 TTATATTTGCATAAACCTTAAGG + Intergenic
930898409 2:56473518-56473540 CTGTTTTTGCAGACATTGTAGGG + Intergenic
931256071 2:60574040-60574062 TTCTATTTACATACACAGGATGG + Intergenic
931833743 2:66077883-66077905 TTTAATTTGCATAATCTGTATGG + Intergenic
934500119 2:94853094-94853116 TTGTATTTGCATTCAGGGAATGG + Intergenic
937476473 2:122219751-122219773 TTCTAATTTAATACACTGTATGG - Intergenic
937820498 2:126304715-126304737 ATGTATATGGATACTCTGTATGG - Intergenic
939536479 2:143437377-143437399 TTTTATTTGCATACATTAAAGGG + Intronic
940205218 2:151194964-151194986 GTGTATTTGCAGACAATTTAAGG - Intergenic
940843567 2:158614084-158614106 TTGAATTTGAACACACTATATGG + Intronic
942553472 2:177146128-177146150 TTGTATTTGTGTATACTGCAGGG - Intergenic
944162189 2:196675506-196675528 CTGTATTTGCAAAAACTTTATGG + Intronic
945820411 2:214657807-214657829 TTATTTTTGTATACAGTGTAAGG + Intergenic
945874360 2:215263115-215263137 TTCCATTTGCATTTACTGTAGGG - Intergenic
947446179 2:230164275-230164297 TTGTCTTTCCATACAATGAAGGG + Intergenic
1169832926 20:9844231-9844253 TTCCATTTTCATACTCTGTAAGG - Intergenic
1170948139 20:20910180-20910202 TTGTATTTGCAGATACTCAAAGG - Intergenic
1173736875 20:45368081-45368103 CTGTATTTGTATACACAGGAAGG - Exonic
1175553627 20:59832572-59832594 TTGCATTTGCAAACACTCTCCGG - Intronic
1175580898 20:60098493-60098515 TTGTATTTGCATAAACTCTTTGG - Intergenic
1179014111 21:37580372-37580394 TTGTATTTTCATTGTCTGTAGGG + Intergenic
1182140190 22:27948164-27948186 TTGTATTTGTAAACACTGAAGGG - Intergenic
1184914623 22:47561131-47561153 TTCAATTTGCATACATTTTATGG - Intergenic
949093452 3:57690-57712 TCATATTTGGATACACTATATGG - Intergenic
952025528 3:29076493-29076515 TTGTATTTTAATACACACTATGG + Intergenic
952323472 3:32299174-32299196 CTGTATTATCATACAGTGTAAGG + Intronic
952816283 3:37450927-37450949 TTGTGTGTGGATACATTGTAGGG + Intergenic
956269876 3:67440205-67440227 TAGTTTTTGCATAAAGTGTAAGG - Intronic
957034329 3:75279824-75279846 TTGTATTTGGATATACTATGTGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965023831 3:163271547-163271569 TTCTACTTGCATAGAATGTATGG + Intergenic
967129161 3:186454642-186454664 TTGTATAAGGATACACTGTGAGG + Intergenic
967463776 3:189778308-189778330 TAGTATTAACATACACTGAATGG + Intronic
967463859 3:189779534-189779556 TTTTATTTGCATGCTCTGCAAGG - Intronic
970267451 4:14304556-14304578 TTGAGTTTGCATACAGTGTAAGG - Intergenic
972202225 4:36727241-36727263 TTGTATATACATACACAATAAGG + Intergenic
972863734 4:43204405-43204427 TGGTATTTGCAGACATTTTAAGG - Intergenic
974229873 4:59096910-59096932 TTGTATTTTCAAAAACTTTAAGG + Intergenic
974422840 4:61700104-61700126 GTGTATTTGTATACATTTTATGG - Intronic
977423640 4:96837275-96837297 TTGCATTTTCTTACACAGTAAGG + Intergenic
977485921 4:97646226-97646248 TTTTATTTGCACACAGTGCAAGG + Intronic
980504326 4:133695507-133695529 TTATATTTGTATATACTGAAAGG - Intergenic
980793868 4:137655953-137655975 TTGTATTTGCATTTAATGTAAGG + Intergenic
981025410 4:140072704-140072726 TTGTATTTGCATATAACTTACGG - Intronic
981181451 4:141750855-141750877 TTTTATGTGGATACACTATATGG - Intergenic
981269861 4:142832891-142832913 TTTTATTTTAATACACTTTATGG - Intronic
981383156 4:144096454-144096476 TTAAATTTGCTTATACTGTATGG - Intergenic
981620248 4:146688536-146688558 TTGTATTTTCAAAATCTGTAGGG + Intergenic
981895861 4:149798240-149798262 TTGTTTTTGCAAACAGTGTTAGG + Intergenic
982060781 4:151602202-151602224 TTTGATTTTCATACCCTGTAAGG - Intronic
983901577 4:173141510-173141532 TTGTATAATCATACACTGGAAGG - Intergenic
985018894 4:185666297-185666319 TTTTATTTGCAAGCACTTTAAGG + Intronic
987490168 5:18569991-18570013 TTCTATTAGCATTCACTGAATGG - Intergenic
987820355 5:22958022-22958044 TTGAATTTGAAGACACTATAAGG + Intergenic
988230737 5:28475479-28475501 TTTTATTTGCAGAGACTCTAGGG - Intergenic
989994772 5:50816328-50816350 CTGTTTTTGCACACAGTGTAAGG - Intronic
990801652 5:59610986-59611008 TTGTATGTGAATCCTCTGTAAGG - Intronic
992029839 5:72710108-72710130 TTGCATTTCCATACACAGCAGGG - Intergenic
993774676 5:91976769-91976791 TATTGTTTGCATACATTGTATGG + Intergenic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
994785147 5:104150008-104150030 TAGTTTTTGTATACAGTGTAAGG - Intergenic
995447640 5:112263676-112263698 TTGTATTAGCATGCACTAGAAGG - Intronic
996154965 5:120087503-120087525 TTGTCTTTGAATACTCTGTCTGG + Intergenic
999145787 5:149392554-149392576 TTGCATTTGCATAGACTCTCTGG + Intronic
1000679187 5:164161517-164161539 TTATAATTGCATACATTGTGTGG + Intergenic
1002631019 5:180578707-180578729 TTGTATTTACATAAACTAAATGG + Intergenic
1003469676 6:6417488-6417510 TAGAATTTGCAAACACTGTACGG + Intergenic
1004833679 6:19506406-19506428 TAATTTTTGCATACAGTGTAAGG + Intergenic
1005368555 6:25105476-25105498 TTGTATTTGAACACAATGAAAGG - Intergenic
1006278479 6:33026936-33026958 TTGTATTTGCATATGGTGTCAGG + Intergenic
1007876648 6:45110854-45110876 TTTTAATGGCATAAACTGTAAGG + Intronic
1008847024 6:55979256-55979278 GTGTATTTACATAAACTTTAGGG - Intergenic
1009652770 6:66497587-66497609 TAGTATTTGCATATACCCTATGG - Intergenic
1011427903 6:87250609-87250631 TAGTATTTGCATACAAACTATGG - Intronic
1012576684 6:100810772-100810794 TAGTAGTTGCAAACACTTTAAGG + Intronic
1013610928 6:111794207-111794229 TTGTTTTTGCATAGACTTTTCGG + Intronic
1014182376 6:118399520-118399542 TTGCAATTAAATACACTGTATGG + Intergenic
1014940734 6:127435745-127435767 TTGTATGTGCATACCCTTGATGG - Intergenic
1015084718 6:129276276-129276298 CTGTATTTGCATACACAACAGGG - Intronic
1018152159 6:160950540-160950562 TTCTTTTTGCAAACACTCTAGGG - Intergenic
1020061625 7:5156780-5156802 GTGTGTTCGCATACAATGTACGG - Intergenic
1020211501 7:6161409-6161431 TTGTATCTGAATAATCTGTATGG + Exonic
1020623828 7:10552743-10552765 TTATATTTGGAAACACTGTTTGG + Intergenic
1021279096 7:18694797-18694819 TTCCATTTGCATAAACTGGAGGG - Intronic
1021343990 7:19500139-19500161 TTTAATTTTCATACACTGAAAGG - Intergenic
1021634115 7:22674398-22674420 TTGTATTTGCATAAAAAGTTAGG + Intergenic
1023658751 7:42452277-42452299 TTGTATTTGCATACAGTCAGAGG - Intergenic
1023672806 7:42597140-42597162 ATGAATTTGCATAAACTGTGGGG - Intergenic
1025193640 7:56915622-56915644 TTGTGTTTCCACACAGTGTAAGG - Intergenic
1025678303 7:63661319-63661341 TTGTGTTTCCACACAGTGTAAGG + Intergenic
1027406114 7:77862986-77863008 TTTTATTTGAATAAACTCTATGG - Intronic
1028471436 7:91211013-91211035 TTGTATTTGTATTCAGTGGAGGG - Intergenic
1028890122 7:95977692-95977714 TTGAATTTGCATCCCCTATATGG + Intronic
1028928951 7:96391636-96391658 ATGTATATTCTTACACTGTAAGG - Intergenic
1030263394 7:107589947-107589969 TTCTATTTTCATACTCTGTAGGG - Intronic
1030658356 7:112192617-112192639 TTGTTTTTAAATACACAGTAAGG - Intronic
1031398862 7:121307202-121307224 TAGTAGTTGCATGCACTGTCTGG - Intergenic
1031539102 7:122971530-122971552 TTGTATTTACATACAGTTTAAGG - Intergenic
1032808004 7:135377519-135377541 TAGTATGTGAATATACTGTAAGG - Intronic
1037110877 8:15163412-15163434 TTGCATTTATATACACTGAAAGG + Intronic
1040682074 8:49823100-49823122 TTAAAATTGCATACACTGCAGGG - Intergenic
1041266433 8:56069995-56070017 TAGTATTTGCATATAATCTATGG - Intronic
1041603652 8:59754008-59754030 CTCCATGTGCATACACTGTAGGG + Intergenic
1041605246 8:59774352-59774374 TTTTATTTGCGTATGCTGTAAGG - Intergenic
1041830793 8:62150714-62150736 TTGTATTTGTATTCACTCTGTGG + Intergenic
1043760767 8:84064603-84064625 TATTATTTGCATACATTATAGGG - Intergenic
1044153031 8:88805004-88805026 TACTATTTAAATACACTGTATGG - Intergenic
1045166158 8:99607424-99607446 TGGTAGTTTCATACACTGTTGGG + Intronic
1046409594 8:113822901-113822923 TTGTATTTTTGTAAACTGTATGG + Intergenic
1046470185 8:114662400-114662422 TTCTATTTGTAAACACTGCAAGG + Intergenic
1046980785 8:120334255-120334277 TTGTATGTGCATAACCTGTATGG - Intronic
1051962325 9:22782044-22782066 TTTAATTTTCATGCACTGTATGG + Intergenic
1052435372 9:28421150-28421172 TTGCATTTGTATACACTAAAAGG + Intronic
1053572623 9:39325529-39325551 TTGTATTTGAATACACTTCCAGG - Intergenic
1053657052 9:40227443-40227465 TTGTATTTGCATTCAGGGAATGG - Intronic
1053907418 9:42856734-42856756 TTGTATTTGCATTCAGGGAATGG - Intergenic
1054094183 9:60884241-60884263 TTGTATTTGAATACACTTCCAGG - Intergenic
1054115654 9:61160156-61160178 TTGTATTTGAATACACTTCCAGG - Intergenic
1054124522 9:61293482-61293504 TTGTATTTGAATACACTTCCAGG + Intergenic
1054369171 9:64373723-64373745 TTGTATTTGCATTCAGGGAATGG - Intronic
1054527545 9:66148781-66148803 TTGTATTTGCATTCAGGGAATGG + Intronic
1054592101 9:67022386-67022408 TTGTATTTGAATACACTTCCAGG + Intergenic
1054676801 9:67863477-67863499 TTGTATTTGCATTCAGGGAATGG - Intronic
1057685401 9:97229724-97229746 TTGTATTTGTATACATTTAAGGG - Intergenic
1059636502 9:116176462-116176484 TTGTTTTTTCATACCCTTTATGG + Intronic
1187129215 X:16485177-16485199 ATGTAGTTGTATAGACTGTACGG - Intergenic
1188127658 X:26390425-26390447 CTGGATTTGTATAAACTGTAAGG + Intergenic
1188614674 X:32143004-32143026 CTGGATTTGCATACACTGTTTGG + Intronic
1189967599 X:46390642-46390664 TTGTAATTACACAAACTGTAGGG + Intergenic
1190361258 X:49651014-49651036 TAGTGTTTGAATACACAGTAGGG - Intergenic
1192752671 X:74010289-74010311 TTGTATTTTCATACTATTTATGG - Intergenic
1193854212 X:86578618-86578640 TTGTATTTCCCAACACTGTATGG + Intronic
1194024662 X:88736558-88736580 TAGTATATACATACACTTTAAGG + Intergenic
1194415997 X:93612811-93612833 TTGTTTTTGTATATAGTGTAAGG + Intergenic
1194494486 X:94595054-94595076 TTGTATTTTCATCCTCTTTATGG - Intergenic
1196500132 X:116371356-116371378 TTGTATATGCATACTATCTATGG + Intergenic
1196671534 X:118373232-118373254 TTATATTTTAATACACTTTAGGG - Intronic
1198879917 X:141269109-141269131 TTGTTACTGCATACACTGCATGG + Intergenic
1198896684 X:141463373-141463395 TTGTAGGTGCATACACATTAAGG + Intergenic
1201018263 Y:9625958-9625980 TTGTGTTGGCATCCTCTGTAAGG + Intergenic
1201644195 Y:16209760-16209782 TTGTAATTGCATACAATTTTTGG - Intergenic
1201658620 Y:16375561-16375583 TTGTAATTGCATACAATTTTTGG + Intergenic